Skip to main content

Enhancement of the expression of HCV core gene does not enhance core-specific immune response in DNA immunization: advantages of the heterologous DNA prime, protein boost immunization regimen

Abstract

Background

Hepatitis C core protein is an attractive target for HCV vaccine aimed to exterminate HCV infected cells. However, although highly immunogenic in natural infection, core appears to have low immunogenicity in experimental settings. We aimed to design an HCV vaccine prototype based on core, and devise immunization regimens that would lead to potent anti-core immune responses which circumvent the immunogenicity limitations earlier observed.

Methods

Plasmids encoding core with no translation initiation signal (pCMVcore); with Kozak sequence (pCMVcoreKozak); and with HCV IRES (pCMVcoreIRES) were designed and expressed in a variety of eukaryotic cells. Polyproteins corresponding to HCV 1b amino acids (aa) 1–98 and 1–173 were expressed in E. coli. C57BL/6 mice were immunized with four 25-μg doses of pCMVcoreKozak, or pCMV (I). BALB/c mice were immunized with 100 μg of either pCMVcore, or pCMVcoreKozak, or pCMVcoreIRES, or empty pCMV (II). Lastly, BALB/c mice were immunized with 20 μg of core aa 1–98 in prime and boost, or with 100 μg of pCMVcoreKozak in prime and 20 μg of core aa 1–98 in boost (III). Antibody response, [3H]-T-incorporation, and cytokine secretion by core/core peptide-stimulated splenocytes were assessed after each immunization.

Results

Plasmids differed in core-expression capacity: mouse fibroblasts transfected with pCMVcore, pCMVcoreIRES and pCMVcoreKozak expressed 0.22 ± 0.18, 0.83 ± 0.5, and 13 ± 5 ng core per cell, respectively. Single immunization with highly expressing pCMVcoreKozak induced specific IFN-γ and IL-2, and weak antibody response. Single immunization with plasmids directing low levels of core expression induced similar levels of cytokines, strong T-cell proliferation (pCMVcoreIRES), and antibodies in titer 103(pCMVcore). Boosting with pCMVcoreKozak induced low antibody response, core-specific T-cell proliferation and IFN-γ secretion that subsided after the 3rd plasmid injection. The latter also led to a decrease in specific IL-2 secretion. The best was the heterologous pCMVcoreKozak prime/protein boost regimen that generated mixed Th1/Th2-cellular response with core-specific antibodies in titer ≥ 3 × 103.

Conclusion

Thus, administration of highly expressed HCV core gene, as one large dose or repeated injections of smaller doses, may suppress core-specific immune response. Instead, the latter is induced by a heterologous DNA prime/protein boost regimen that circumvents the negative effects of intracellular core expression.

Background

Globally, an estimated 170 million people are chronically infected with hepatitis C virus (HCV), and 3 to 4 million persons are newly infected each year [1, 2]. The human immune system has difficulties in clearing the virus in either the acute, or chronic phase of the infection with up to 40% of patients progressing to cirrhosis and liver failure [3–6]. Extensive studies have unraveled important reliable correlates of viral clearance [7–11]. This, together with the growing need to diminish the magnitude of HCV associated liver disease served as a basis for intensive HCV vaccine research. A series of HCV vaccine candidates have moved into clinical trials [11]. One such is the peptide vaccine IC41 consisting of a panel of MHC class I and class II restricted epitopes adjuvanted by poly-L-arginine administered to healthy volunteers [12] and to chronic HCV patients including non-responders to the standard therapy [13, 14]. Another therapeutic vaccine employed peptides chosen individually for their ability to induce the strongest in vitro cellular response [15]. In a further vaccine trial, chronic hepatitis C patients received the recombinant HCV envelope protein E1 [16]. The first clinical trial of an HCV DNA vaccine consisting of a codon-optimized NS3/4A gene administered to chronic hepatitis C patients is currently ongoing (CHRONVAC-C®; http://www.clinicaltrials.gov/ct2/results?term=NCT00563173; http://www.bion.no/moter/Vaccine/Matti_S%E4llberg.pdf).

So far, none of the peptide or protein vaccines were able to induce a significant improvement in the health conditions of chronic HCV patients, or a significant decrease of HCV RNA load, specifically if compared to the conventional IFN-based therapy [13, 15, 16]. The vaccine trials have, however, demonstrated that when achieved, HCV RNA decline in the vaccine recipients correlates with induction of strong IFN-gamma T-cell response [13]. Such a response can best be recruited by DNA vaccines, either alone or with the aid of heterologous boosts [11, 17]. Indeed, vaccination of chimpanzees showed the ability to elicit effective immunity against heterologous HCV strains using T-cell oriented HCV genetic vaccines that stimulated only the cellular arm of the immune system [17, 18].

An attractive target for HCV vaccine is the nucleocapsid (core) protein [19–21]. It is highly conserved among various HCV genotypes with amino acid homology exceeding 95% [21, 22]. Core binds and packages the viral genomic RNA, regulates its translation [23–26] and drives the production of infectious viruses [27–29]. Core contributes to HCV persistence also indirectly by interfering with host cell transcription, apoptosis, lipid metabolism, and the development of immune response [30–33]. Extermination of core expressing cells and inhibition of the activity of extracellular core (non-enveloped particles containing HCV RNA [34]) could be highly beneficial.

Ideally, HCV core could be eliminated by a specific vaccine-induced immune response. It is a strong immunogen with anti-core immune response evolving very early in infection [35, 36]. Early and broad peripheral and intrahepatic CD8+ T-cell and antibody response to core/core epitopes is registered in chimpanzees controlling HCV infection HCV, but not in chimpanzees that become chronically infected [37–39]. In mice, potent experimentally induced anti-core immune response conferred partial protection against challenge with core expressing recombinant vaccinia virus [40]. However, despite high immunogenicity in the natural infection, core does not perform well as an immunogen, specifically if introduced as naked DNA [2, 41–43]. Attempts to enhance core immunogenicity by targeting HCV core protein to specific cellular compartments [44], co-immunization with cytokine expressing plasmids [2, 41], adjuvants as CpG [45], or truncated core gene versions [46] had limited or no success.

Prime-boost strategies have been used to increase immune responses to a number of DNA vaccines. Immunization regimens comprised of a DNA prime and a viral vector boost for instance for vaccinia virus [47, 48], adenovirus [49], fowlpox [50, 51], and retrovirus [52]. Priming with DNA and boosting with protein is another promising approach. This regimen has been studied for HIV [53, 54], hepatitis C virus [55, 56], anthrax [57], Mycobacteria [58, 59], Streptococcus pneumoniae [60] and BVDV [61]. DNA vaccines and recombinant protein vaccines utilize different mechanisms to elicit antigen-specific responses. Due to the production of antigen in transfected cells of the host, a DNA vaccine induces robust T-cell responses, which are critical for the development of T-cell-dependent antibody responses [62]. DNA immunization is also highly effective in priming antigen-specific memory B cells. In contrast, a recombinant protein vaccine is generally more effective at eliciting antibody responses than cell-mediated immune responses and may directly stimulate antigen-specific memory B cells to differentiate into antibody-secreting cells, resulting in production of high titer antigen-specific antibodies [63]. Therefore, a DNA prime plus protein boost is a complementary approach that overcomes each of their respective shortcomings. Certain improvement of the immune response was reached after co-delivery of HCV core DNA and recombinant core [2, 40, 64]. In this study, we have shown that in DNA immunization, poor core-specific immune response can be a consequence of high levels of intracellular core expression, and that such a response can be improved by using low-expressing core genes, or single core gene primes in combination with recombinant core protein boosts.

Methods

Plasmids for expression of HCV core

Region encoding aa 1–191 of HCV core was reverse-transcribed and amplified from HCV 1b isolate 274933RU (GeneBank accession #AF176573) [65] using oligonucleotide primers: sense GATCCAAGCTTATGAGCACGAATCC and antisense GATCCCTCGAGTCAAGCGGAAGCTGG containing recognition sites of HindIII and XhoI restriction endonucleases. The amplified DNA was cleaved with HindIII/XhoI and inserted into pcDNA3 (Invitrogen, USA) cleaved with HindIII/XhoI resulting in pCMVcore. Region encoding aa 1–191 of HCV core was also reverse-transcribed and amplified from HCV isolate 274933RU using another set of primers that carried Kozak consensus sequence sense AGCTGCTAGCGCCGCCACCATGAGCACGAATCCT and antisense GATCGTTAACTAAGCGGAAGCTGGATGG primers containing recognition sites of restriction endonucleases NheI and XhoI, respectively. The amplified DNA was cleaved with NheI/KspAI and inserted into the plasmid pCMVE2/p7-2 [66] cleaved with NheI/XhoI, resulting in pCMVcoreKozak. The region corresponding to HCV 5'UTR, and coding sequences for aa 1–809 was reverse-transcribed and amplified from HCV 1b isolate AD78P1 (GeneBank accession #AJ132997) [67], kindly provided by Prof. M. Roggendorf (Essen, Germany) using sense-GACCCAAGCTTCGTAGACCGTGCACCAT and antisense CATGCTCGAGTTAGGCGTATGCTCG primers. The amplified DNA was cleaved with HindIII/XhoI and inserted into pcDNA3 cleaved with HindIII/XhoI resulting in pCMVcoreIRES. HCV 274933RU core differed from HCV AD78P1 core in positions 70 (H versus R), 75 (T versus A), and 147 (V versus T), respectively.

Growth of pcDNA3, pCMVcore, pCMVcoreKozak, and pCMVcoreIRES was accomplished in the E. coli strain DH5alpha. Plasmid DNA was extracted and purified by Endo Free plasmid Maxi kit (Qiagen GmbH, Germany). The purified plasmids were dissolved in the phosphate buffered saline (PBS) and used for in vitro expression assays and for DNA immunization.

Cell transfection, lysis and Western-blotting

BHK-21, COS-7, and NIH3T3 cells were seeded into plates (3 × 105 cells/well) and transfected by plasmid DNA (2 μg) using Lipofectamine (GIBCO-BRL, Scotland) or ExGen 500 (Fermentas, Lithuania) as described by the manufacturers. HCV core expression was analyzed 24, 48 and 72 h post transfection. Cells were lysed for 10 min at 0°C in the buffer containing 50 mM Tris-HCl, pH 7.5, 1 mM EDTA, 1 mM PMSF and 1% NP-40. Lysates were cleared by 10 min centrifugation at 6000 g, resolved by 12% SDS-PAAG, and transferred to PVDF membranes (Amersham Pharmacia Biotech, Ireland). HCV core expression was detected by immunostaining with polyclonal rabbit anti-core antibodies [68], and secondary horseradish peroxidase (HRP)-conjugated anti-rabbit immunoglobulins (Amersham Pharmacia Biotech, Ireland) followed by ECL™ detection (ECL Plus, Amersham Pharmacia Biotech, Ireland).

Quantification of core expression in mouse cells

NIH3T3 cells were transfected with either pcDNA3, pCMVcore, pCMVcoreKozak, pCMVcoreIRES, or pEGFP-N1 (Clontech, CA, USA). The percent of transfection was evaluated by counting the number of GFP expressing cells per 500 transfected NIH3T3 cells using a fluorescence Leica DM 6000 microscope (Leica Camera AG, Germany). Cells were harvested 48 h post-transfection, counted, and 104 cells were lysed in 2× SDS Sample buffer. Lysates and samples containing 1 to 50 ng of recombinant core aa 1–173 (corresponding to p21) were run simultaneously on 12% SDS-PAAG and transferred onto PVDF membrane for calibration. Blots were blocked overnight in PBS-T with 5% non-fat dry milk, stained with polyclonal anti-core antibodies #35-6 (1:5000) followed by the secondary anti-rabbit HRP-conjugated antibodies (DAKOPatts AB, Denmark). Signals were detected using the ECL™ system (Amersham Pharmacia Biotech, Ireland). X-ray films were scanned, and processed using Image J software http://rsb.info.nih.gov/ij. The data are presented as the Mean Grey Values (MGV). The core content was quantified by plotting the MGV of each sample onto a calibration curve prepared using recombinant core aa 1–173. After core detection, blots were striped according to the ECL protocol and re-stained with monoclonal anti-tubulin antibodies (Sigma, USA) and secondary anti-mouse HRP-conjugated antibodies (DAKOPatts AB, Denmark). Core content per transfected cell was evaluated after accounting for the percent of transfection and normalization to the tubulin content per well.

Immunofluorescence staining

BHK-21 cells were seeded on the chamber slides (Nunc International, Denmark) and transfected as above. 24 h post transfection, the slides were dried, fixed with acetic acid and ethanol (1:3) for 15 min and rinsed thoroughly in distilled water. Fixed cells were re-hydrated in PBS, and incubated for 24 h at 4°C with anti-HCV core rabbit polyclonal antibodies (1:50) in the blocking buffer (PBS with 2.5 mM EDTA and 1% BSA). Secondary antibodies were goat anti-rabbit immunoglobulins labeled with TRITC (1:200; DAKO, Denmark). Slides were then mounted with PermaFluor aqueous mounting medium (Immunon, Pa., USA) and read using a fluorescence microscope.

Recombinant HCV-core proteins and core-derived peptides

Peptides covering core amino acids 1–18, 1–20, 23–43, 34–42, 133–142 and a control peptide TTAVPWNAS from gp41 of HIV-1 were purchased from Thermo Electron GmbH (Germany). Core proteins representing aa 1–152 of HCV 274933RU and aa 1–98, and 1–173 of AD78P1 were expressed in E. coli and purified by chromatography as was described earlier [69, 70]. Purified proteins were dissolved in PBS.

Mice and immunization

The following immunizations were performed:

Scheme I

Groups of 12 female 8-week old C57BL/6 mice (Stolbovaya, Moscow Region, Russia) were immunized with a total of 100 μg of pCMVcoreKozak, or empty vector, split into four i.m. injections done with 3–4 week intervals. Control mice were mock-immunized with PBS.

Scheme II

Female 6–8 week old BALB/c mice (Animal Breeding Centre of the Institute of Microbiology and Virology, Riga) had injected into their Tibialis anterior (TA), 50 μl of 0.01 mM cardiotoxin (Latoxan, France) in sterile 0.9% NaCl five days prior to immunization. Groups of 6 to 7 mice were immunized with a single 100 μg dose of either pCMVcoreIRES, or pCMVcore, or pCMVcoreKozak, or empty vector, all dissolved in 100 μl PBS, applied intramuscularly (i.m.) into the cardiotoxin-treated TA. Control mice were left untreated.

Scheme III

Groups of 5 to 6 female 6–8 week old BALB/c mice pretreated with cardiotoxin, were injected i.m. with 100 μg of pCMVcoreKozak and boosted three weeks later with 20 μg of core aa 1–98 in PBS, or primed and boosted subcutaneously with 20 μg of core aa 1–98 in PBS. Control animals were left untreated.

ELISA

Mice were bled from retro-orbital sinus prior to, and 2 to 3 weeks after each immunization, or 5 weeks post a single gene immunization (in Scheme II). Peptides corresponding to core aa 1–20, 23–43 or 133–142 were coated onto 96-well MaxiSorp plates (Nunc, Denmark), and recombinant core aa 1–98, 1–152, or 1–173, on the 96-well PolySorp plates (Nunc, Denmark). Coating was done overnight at 4°C in 50 mM carbonate buffer, pH 9.6 at antigen concentration of 10 μg/ml. After blocking with PBS containing 1% BSA for 1 h at 37°C, serial dilutions of mouse sera were applied on the plates and incubated for an additional hour at 37°C. Incubation was followed by three washings with PBS containing 0.05% Tween-20. Afterwards, plates were incubated with the horseradish peroxidase-conjugated anti-mouse antibody (Sigma, USA) for 1 h at 37°C, washed, and substrate OPD (Sigma, USA) added for color development. Plates were read on an automatic reader (Multiscan, Sweden) at 492 nm. ELISA performed on plates coated with core aa 1–98, 1–152, or 1–173 showed similar results (data not shown). Immune serum was considered positive for anti-core antibodies whenever a specific OD value exceeded, by at least two-fold, the signals generated by: pre-immune serum reacting with core-derived antigen, and by immune serum reacting with BSA-coated plate, the assays performed simultaneously.

T-cell proliferation assay

For T-cell proliferation tests, mice were sacrificed and spleens were obtained two weeks after each immunization in Scheme I; and three and five weeks after the last immunization in Schemes II and III. Murine splenocytes were harvested using red blood cell lysing buffer (Sigma, USA), single cell-suspensions were prepared in RPMI 1640 supplemented with 2 mM L-Glutamine and 10% fetal calf serum (Gibco BRL, Scotland) at 6 × 106 cells/ml. Cell were cultured in U-bottomed microculture plates at 37°C in a humidified 5% CO2 chamber (Gibco, Germany). Cell stimulation was performed with peptides representing core aa 1–20, 23–43, 34–42 and recombinant core aa 1–98, 1–152, and aa 1–173 at dilutions to 3.1, 6.25, 12.5, 25.0, 50.0, and 100 μg/ml, all in duplicate. Concanavalin A (ConA) was used as a positive control at 2 μg/ml. Cells were grown for 72 h, after which [3H]-thymidine (1 μCi per well; Amersham Pharmacia Biotech, Ireland) was added. After an additional 18 h, cells were harvested onto cellulose filters and the radioactivity was measured on a beta counter (Beckman, USA). The results were presented as stimulation indexes (SI), which were calculated as a ratio of mean cpm obtained in the presence and absence of a stimulator (protein or peptide). Empty-vector immunized and control mice showed SI values of 0.8 ± 0.4. SI values ≥ 1.9 were considered as indicators of specific T-cell stimulation.

Quantification of cytokine secretion

For detection of cytokines, cell culture fluids from T-cell proliferation tests were collected, for IL-2 – 24 h, and for IL-4 and IFN-γ – 48 h post the on-start of T-cell stimulation. Detection of cytokines in the cell supernatants was performed using commercial ELISA kits (Pharmingen, BD Biosciences, CA, USA) according to the manufacturers' instructions.

Results

Cloning and expression

Plasmids were constructed encoding core of HCV 1b isolate 274933RU without translation initiation signals (pCMVcore); and with Kozak translation initiation signal (pCMVcoreKozak). Core with viral translation initiation signal IRES taken in the natural context was derived from HCV 1b isolate AD78P1 [67]. Viral cores had a minimal sequence difference in positions 70, 75, and 147, all three cases representing homologous substitutions.

Expression from these plasmids was tested both in vitro and in cell cultures. Plasmids pCMVcore and pCMVcoreKozak were used as the templates for the T7-driven mRNA transcription; mRNA was translated in vitro in the rabbit reticulocyte lysate system. Both mRNAs generated a translation product of approximately 23 kDa corresponding to the molecular mass of unprocessed HCV core (p23; data not shown). Next, core-expressing vectors were used to transfect a series of mammalian cell lines. Western blotting of BHK-21 and COS-7cells transfected with pCMVcore, pCMVcoreKozak and pCMVcoreIRES using core-specific antibodies demonstrated an accumulation of proteins with the expected molecular mass of 21 kDa that corresponds to core aa 1–171 cleaved from the full-length core by cellular proteases [71, 72] (Fig. 1). Minimal amounts of p23 were also detected, specifically after transfections of BHK-21 with pCMVcore and pCMVcoreIRES (Fig. 1). The overall level of HCV core synthesis in BHK-21 cells was somewhat higher than in COS-7 cells (Fig. 1). In both cell lines, the highest level of core expression was achieved with pCMVcoreKozak (Fig. 1, 2). All cells expressing core and immunostained with core-specific antibodies demonstrated cytoplasmic granular staining characteristic of the processed p21 form of HCV core [72–74] (Fig. 2).

Figure 1
figure 1

Expression of HCV core proteins. Expression of HCV core protein directed by pCMVcore (A), pCMVcoreKozak (B), pCMVcoreIRES (C) in COS-7 cells 72 h post-transfection (Field 1); in BHK-21 cells 48 h (Field 2) and 72 h post transfection (Field 3). Transfection with the recommended amount (lane 1), and two-fold excess of transfection reagent (lane 2).

Figure 2
figure 2

Immunocytochemical detection of HCV core proteins. Immunocytochemical detection of HCV core expression after transfection of BHK-21 cellswith pCMVcore (A1–C1), pCMVcoreKozak (A2–C2, C4), pCMVcoreIRES (A3–C3); nontransfected BHK-21 cells (A4). Immunostaining for HCV core protein using rabbit polyclonal anti-HCVcore antibody 35-7 as primary and TRITC-conjugated anti-rabbit immunoglobulin (IgG) as secondary antibody (panel A); nuclear staining by DAPI (panel B); overlay of A and B (panel C); negative control (nontransfected BHK-21 cells) after staining (A4). Fluorescent images A1–4, B1–3, C1–3 and A4 were taken with Leica DM 6000 B microscope and a Leica DFC 480 camera, and confocal image of cells transfected with pCMVcoreKozak and showing cytoplasmic, granular distribution (C4) with a Leica TCS SP2 SE.

The expression capacity of the vectors was quantified in murine fibroblasts to reproduce DNA immunization that was to be done in mice. Core expression was assessed on Western blots of SDS-PAAG resolving lysates of NIH3T3 transfected with core expressing and control plasmids (Fig. 3A and 3B). Images of Western blots were processed using the ImageJ software and individual bands were represented in arbitrary units (Mean Grey Values, MGV). Their correspondence to core quantity was established using calibration curves built with the use of recombinant core aa 1–173 (see Additional file 1) after normalization to the percent of transfection and protein content of the samples. Plasmid pCMVcore with no translation initiation signals provided the lowest level of core expression (Fig. 3B). IRES promoted a two-fold increase, and the Kozak sequence, a 35-fold increase of core expression with > 15 ng of protein produced per expressing cell (Fig. 3B).

Figure 3
figure 3

Expression of proteins in mouse fibroblasts NIH 3T3 48 h post-transfection. A calibration curve was prepared using recombinant core protein aa 1–173 loaded in amounts of 25, 20, 15, and 10 ng per well (lanes 5, 6, 7 and 8, respectively). Western blotting was done using rabbit anti-core antibodies [82] (A). ECL photos of blots were scanned, and images were quantified with ImageJ software http://rsb.info.nih.gov/ij. The results of quantification of HCV core expression in four independent experiments (B).

Immunization of mice with HCV core DNA

All plasmids were purified by standard protocols in accordance with a GLP practice for preparation of DNA vaccines, and used in a series of mouse immunization experiments.

HCV core DNA in priming and boosts

Plasmid directing the highest level of core expression was selected and a pilot experiment defining the strategy of DNA immunization was performed. C57BL/6 mice were immunized four times with 25 μg of pCMVcoreKozak, and core-specific antibody and cellular responses were evaluated. No specific response was registered after the 1st injection (data not shown). The immune response generated after the following three boosts is illustrated by Fig. 4. Three injections of 25 μg led to no increase of core-specific IgG response over the initial levels achieved after the first two plasmid injections (Fig. 4A). Three plasmid injections generated a better T-cell proliferative response to core and core-derived peptides than two. However, the response could not be boosted further (Fig. 4B). IFN-γ and IL-2 response to core was also boostable. However again, no boosting was seen after the initial two pCMVcoreKozak injections (Fig. 4C). Furthermore, the repeated injections led to a significant decrease of IL-2 secretion in response to splenocyte stimulation by recombinant core and peptides representing core N-terminus (p < 0.05; Fig. 4B, and data not shown). Core-specific IL-4 secretion was not detected.

Figure 4
figure 4

Core-specific immune response in C57Bl/6 mice receiving 2 (2 × 25 μg), 3 (3 × 25 μg), and 4 (4 × 25 μg) injections of pCMVcoreKozak. Maximal titers of IgG specific to recombinant core and a peptide representing core aa 1–20 (A); T-cell proliferation measured as the stimulation index (SI) in response to HCV core (1–173) and a peptide pool covering aa 23–43 of HCV core (B); cytokine secretion (pg/ml) in response to recombinant HCV core (C). Data are average values for mice assayed at a given time point.

Thus, the development of core-specific immune responses occurred within six weeks after the on-start of immunization; repeated boosts with HCV core gene did not lead to a significant enhancement of core-specific immunity.

HCV core DNA as a single injection

In the next series of experiments, we selected BALB/c mice as a strain that is expected to support a better Th2-type response with stronger antibody production [75]. Plasmid pCMVcore Kozak was given as a single 100 μg injection with the effect of repeated intramuscular DNA boosts substituted by pre-treatment of the injection sites by cardiotoxin [76]. T-cell proliferative response, antibody production and cytokine secretion were monitored two and five weeks after immunization.

Significant responses in the form of core-specific IFN-γ and IL-2 secretion exceeding the background levels in empty-vector-immunized mice were detected five weeks after a single administration of HCV core gene (Fig.5). Immunization generated no core-specific T-cell response and a low titer of core-specific IgG. Antibody response against HCV core has already been shown to develop slowly [46], mirroring the development of anti-core antibody response in HCV infected individuals [77]. Here as well, a slow increase in the level of anti-core antibodies was observed 35 days after a single gene injection as compared to levels detected at day 21 (data not shown). There was no difference between BALB/c and C57BL/6 mice with respect to core-specific IFN-γ secretion (Fig. 4C versus Fig. 5C), or core-specific IgG production (p > 0.05 Mann Whitney U-test; Fig. 4A versus Fig. 5A and Additional file 1).

Figure 5
figure 5

Core-specific immune response in BALB/c mice immunized with one 100 μg dose of pCMVcoreKozak (n = 7), pCMVcoreIRES (n = 6), pCMVcore (n = 6), and empty vector (n = 7). The highest titers of IgG specific to core reached throughout immunization (A); T-cell proliferation measured as the stimulation index (SI) in response to recombinant HCV cores aa 1–98 and aa 1–173 and peptide representing HCV core aa 133–142 (B); the levels of core-specific IFN-γ, IL-2, and IL-4 secretion in the cell culture fluids collected after splenocyte stimulation with HCV core aa 1–98 (C). Cytokine secretion in BALB/c mice is represented by the amounts detected in the pooled cell culture fluids from the T-cell proliferation test; therefore, no standard deviations are presented.

High core gene expression affects core-specific immune response

The magnitude of anti-core response suggested that the increase of HCV core gene dose either by one-time large dose injection, or by repeated injections of smaller doses, did not significantly enhance core-specific immunity. To delineate if that could be influenced by core expression level, BALB/c mice were immunized with a single dose of low-expressing core genes with no translation initiation signals (pCMVcore), or with IRES (pCMVcoreIRES). The results were compared to immunization with core gene regulated by the Kozak sequence (pCMVcoreIRES) (Fig. 5). The T-cell proliferative response to core- and core-derived peptides was stronger in mice immunized with pCMVcoreIRES (Fig. 5). The highest anti-core IgG response was raised in mice immunized with pCMVcore that directed the lowest level of HCV core expression (Fig. 3; Fig. 5A). It was significantly higher than the antibody response induced by pCMVcoreKozak (p < 0.05); the immune response in pCMVcoreIRES-immunized mice was intermediate (Fig. 5A). The T-cell proliferative response to core- and core-derived peptides was stronger in mice immunized with pCMVcoreIRES (Fig. 5B; p < 0.05). While IL-2 secretion was somewhat higher in mice immunized with highly expressing pCMVcoreKozak, both DNA immunogens provided a similar level of core-specific IFN-γ secretion (Fig. 5C).

Heterologous DNA prime-protein boost regimen

We aimed to see if core-specific immune response could be enhanced without increasing core gene doses, but instead by using the heterologous prime-boost immunization regimens. HCV core protein aa 1–98 and pCMVcoreKozak were used to immunize BALB/c mice either separately, or in the DNA prime-protein boost regimen. A high titer of core-specific antibodies was achieved only after the heterologous boost (Fig. 6A). The heterologous regimen effectively induced a proliferative response, both in SI values (p levels 0.034, Mann Whitney U-test) and in the number of positive T-cell proliferation tests (p level 0.014; Fig. 6B); and potent core-specific IFN-γ and IL-2 secretion (Fig. 6C). Core-specific IL-4 secretion was, in all cases, very low.

Figure 6
figure 6

Core-specific immune response in BALB/c mice immunized with the recombinant N-terminal domain of HCV core aa 1–98 alone (n = 5); with pCMVcoreKozak (n = 7); and primed with pCMVcoreKozak and boosted with HCV core aa 1–98 (n = 6). The kinetics of IgG response to core aa 1–98 (A);-T-cell proliferation measured as the stimulation index (SI) in response to HCV core aa 1–98, recombinant core aa 1–173, and a peptide covering HCV core aa 133–142 (B); levels of core-specific IFN-γ and IL-2 secretion (pg/ml) in the pooled cell culture after splenocyte stimulation with HCV core aa 1–98 or aa 1–173 (C).

Heterologous regimen induced significant anti-core antibody production (Fig. 6A). Sera of mice primed with pCMVcoreKozak and boosted with core aa 1–98 were analysed for the presence of anti-core antibodies of IgG, IgG1, IgG2a, IgG2b and IgM subclasses, and the results were compared to seroreactvivity in mice immunized with single injection of core or core expressing plasmids (Fig. 7). Mice primed with pCMVcoreKozak and boosted with core protein had significantly higher levels of anti-core IgG than mice immunized with pCMVcoreKozak (p = 0.0006, Mann-Whitney U-test) or pCMVcore (p = 0.002) (immunization with pCMVcore gave higher level of IgG than immunization with pCMVcoreKozak, p < 0.05). Group with heterologous prime/boost regimen had also an increased levels of anti-core IgG1, although the difference with the control group did not reach the level of significance (p < 0.1). Antibodies of IgG2a or IgG2b subclasses were not found. Low specific anti-core IgM were observed only in mice immunized with recombinant core aa 1–98 (p < 0.1; Fig. 7). It was higher than in mice primed with core DNA and boosted with core protein (p level 0.05). At the same time, core-immunized mice had no anti-core IgG1 or IgG2 (Fig. 7). Thus, the heterologous core DNA prime/core protein boost regimen preferentially induced anti-core IgG, while protein immunization triggered mostly low-level anti-core IgM.

Figure 7
figure 7

Spectrum of core-specific immune response. The kinetics of IgG, IgM, IgG1, IgG2a and IgG2b response to core aa 1–98 after immunization with different immunogens.

Discussion

The immune response in DNA immunization depends on the amount of antigen produced from the immunogen in vivo as predetermined by the gene dose and by the gene capacity to direct an efficient antigen expression [78, 79]. Normally, the response increases with the increase of the dose and efficacy of gene expression (for examples, see [80–83]). However, the DNA immunogen used here encodes not just a structural component of the virus, but also a pathogenic factor. HCV core protein interacts with a broad range of cellular proteins and influences numerous host cell functions [31, 32, 39, 71, 84, 85]. Of importance for HCV vaccine design was to find to what extent the immune response to HCV core in DNA immunization is influenced (positively, or negatively) by the level of core expression as determined by gene dose (i), and gene expression efficacy (ii).

The first issue was addressed in a series of immunizations in which the same dose of HCV core was given as a single or split into multiple injections. We and others have earlier observed that repeated HCV core gene boosts do not lead to an enhancement of core-specific immune response [42, 46, 68]. On the contrary, both core-specific IFN-γ and IL-2 production [68] and anti-core antibody response [2, 46, 64] appear to be down-regulated. Here as well, the overall comparison between immunizations carried out by single and multiple core gene injections in different mouse strains demonstrated that the outcomes of immunization with one 100 μg versus two to four 25 μg core gene doses were quite similar (Fig. 4; see also the summary in Additional file 2). Furthermore, antibody response was not boosted; T-cell proliferative response and core-specific IFN-γ secretion could not be boosted beyond the levels reached after the initial two injections, and core-specific IL-2 secretion even appeared to be suppressed. Thus, core-specific immune response can be achieved after single DNA immunization, while repeated core gene administration may actually suppress core-specific immunity.

The issue of translation efficacy was assessed in single-dose immunizations with plasmids directing different levels of HCV core expression. There are different ways to increase the level of gene expression efficacy such as the use of strong promoters, optimal species-specific codons, and manipulations with RNA folding [78, 78, 79]. An important factor is the efficacy of translation initiation. In the CAP-dependent translation of mammalian genes it is determined by sequences flanking the AUG initiator codon. High levels of translation are achieved with the Kozak sequence, a guanine at position +4 and an adenine at -3 from AUG [86, 87]. The alternative mechanisms of initiation site selection on eukaryotic cellular and viral mRNAs, also of HCV, include the translation initiation from IRESs (internal ribosome entry sites/segments) [88]. Located in the 5'-UTR region of viral genome, HCV IRES is optimized to hijack the ribosomes and translation factors from the host for the translation of HCV polyprotein [89]. Core is tightly involved in the IRES-mediated regulation of HCV translation with several regulatory signals localized in both core protein and core coding sequence [24, 90, 91]. Thus, the 5'-end of HCV genome incorporating 5'-UTR and core coding sequence were harmonized during evolution to provide for the levels of core expression essential for the virus.

Both CAP and IRES translation initiation options were employed in the design of core DNA immunogens. Eukaryotic expression vectors were constructed encoding core of HCV 1b without translation initiation signal (pCMVcore), core preceded by the 5'-UTR of HCV 1b isolate AD (pCMVcoreIRES), and core preceded by the consensus Kozak sequence (pCMVcoreKozak). The latter directed the expression of 35-fold more core than the gene devoid of the translation initiation signals, and 16-fold more core than the gene regulated by IRES. However, despite a considerable difference in the core expression capacity, Kozak- and IRES-regulated DNA immunogens induced similar levels of core-specific IFN-γ secretion (Fig. 5C). More so, while IL-2 secretion was somewhat higher in mice immunized with highly expressing pCMVcoreKozak, a T-cell proliferative response to core- and core-derived peptides was stronger in mice immunized with pCMVcoreIRES (Fig. 5B). Thus, high core expression levels did not promote a better core specific cellular response.

DNA-based immunization can induce potent antibody response including virus neutralizing antibodies [92–96]. However, no significant antibody response has ever been induced in core gene immunization unless it was followed by the protein boost [2, 64]. Anti-core antibody titers obtained here after immunization with both CAP- and IRES-regulated core genes were also low. Interestingly, however, significantly higher titers of anti-core antibodies were obtained in mice that received the least expressed core gene devoid of any translation regulation signals (pCMV core; Figs. 5A, 7). Thus, the use of highly expressing HCV core DNA did not promote an effective core-specific antibody response.

Altogether, this points to possible adverse effects of the high-level as well as of the prolonged HCV core gene expression. We have additional data in support of this concept from immunization of C57BL/6 mice with a synthetic truncated HCV core gene devoid of HCV core nucleotide-sequence dependent regulatory signals. The latter expressed HCV 1b core at five to six-fold lower levels than the viral full-length core gene [97], but nevertheless, was capable of inducing potent core-specific cellular and antibody response http://www.meetingsmanagement.com/dna_2004/index.htm[98].

DNA immunization with antigens co-expressed in natural virus infection can result in inhibition of both protein expression and specific immune response [99]. More so, pathological effects were reported of the repeated immunization with certain microbial genes, for example the hsp60 gene of Mycobacterium that causes necrotizing bronchointerstitial pneumonia and bronchiolitis in healthy mouse recipients, and multifocal regions of cellular necrosis in lungs when applied therapeutically [100, 101]. HCV core is the factor of HCV pathogenicity. It activates cellular and viral promoters [102], induces ER- and mitochondrial stress [103, 104], regulates apoptosis [105, 106], tumorigenesis [107, 108], and induces abnormal lipid metabolism [109]. In experimental systems, core expression leads to the development of diverse pathological effects including CD4+ T-cell depletion, liver steatosis, insulin resistance, and hepatocellular carcinoma [33, 110]. One of the notable although controversial features is the capacity of HCV core to suppresses host immunity [32, 39, 84, 85]. These features of HCV core may explain why here a better immune response was achieved after single immunization with vectors providing for comparatively low HCV core expression.

Altogether, this points to the necessity to devise alternative immunization regimens that would help to circumvent possible adverse effects of HCV core.

Many approaches can be pursued, with DNA vaccination combined with heterologous protein or recombinant viral boosts considered as the most promising [11]. The principle of this strategy is to prime T-cells to be antigen-specific and then, upon repeated exposure to a specific antigen, induce a rapid T-cell expansion. In heterologous boosts, the encoded antigen is delivered in a different form/different vehicle [111]. DNA plasmids are perfectly fit for priming since they are internalized by antigen presenting cells and can induce antigen presentation via MHC class I or class II. Such heterologous regimens can be effective when infection occurs with both viral particles and virus-infected cells, and neither cellular, nor antibody response is sufficient for sterilizing protection or viral clearance, if acting alone. This approach may help to circumvent the negative effects of intracellular core expression. Indeed, here, the heterologous DNA-prime/protein boost strategy was shown to be advantageous to both immunizations with core DNA and with the recombinant core protein (Figs. 6, 7). Protein alone performed even worse than single DNA injections (Figs. 6, 7). Only the heterologous DNA-prime-protein boost regimen induced a significant core-specific antibody production and potent T-cell response of mainly Th1-profile. This may be beneficial since most correlates of spontaneous HCV clearance are Th1-oriented [32, 39, 84, 85].

Conclusion

This data suggests that the administration of highly expressed HCV core gene, as well as repeated core gene injections may hamper core-specific immune response. The boosting effect of repeated core gene injections is transient as it disappears with subsequent injections. One possible way to enhance core-specific response is to deliver limited intracellular amounts of core, either by giving lower plasmid doses, or by giving vectors with low expression efficacy. An additional option is the use of heterologous DNA prime/protein boost regimen that leads to potent immune response of a mixed Th1/Th2-type. We are currently testing if transient HCV core gene expression and acquisition of anti-HCV core immunity affect the immune status and functionality of the immune system in gene recipients.

References

  1. Lauer GM, Walker BD: Hepatitis C virus infection. N Engl J Med. 2001, 345: 41-52. 10.1056/NEJM200107053450107.

    CAS  PubMed  Google Scholar 

  2. Tokushige K, Wakita T, Pachuk C, Moradpour D, Weiner DB, Zurawski VR, Wands JR: Expression and immune response to hepatitis C virus core DNA-based vaccine constructs. Hepatology. 1996, 24: 14-20. 10.1002/hep.510240104.

    CAS  PubMed  Google Scholar 

  3. Cox GM, Lawless MC, Cassin SP, Geoghegan TW: Syringe exchanges: a public health response to problem drug use. Ir Med J. 2000, 93: 143-146.

    CAS  PubMed  Google Scholar 

  4. Koziel MJ, Dudley D, Wong JT, Dienstag J, Houghton M, Ralston R, Walker BD: Intrahepatic cytotoxic T lymphocytes specific for hepatitis C virus in persons with chronic hepatitis. J Immunol. 1992, 149: 3339-3344.

    CAS  PubMed  Google Scholar 

  5. Theodore D, Fried MW: Natural history and disease manifestations of hepatitis C infection. Curr Top Microbiol Immunol. 2000, 242: 43-54.

    CAS  PubMed  Google Scholar 

  6. Wong DK, Dudley DD, Afdhal NH, Dienstag J, Rice CM, Wang L, Houghton M, Walker BD, Koziel MJ: Liver-derived CTL in hepatitis C virus infection: breadth and specificity of responses in a cohort of persons with chronic infection. J Immunol. 1998, 160: 1479-1488.

    CAS  PubMed  Google Scholar 

  7. Bowen DG, Walker CM: Mutational escape from CD8+ T cell immunity: HCV evolution, from chimpanzees to man. J Exp Med. 2005, 201: 1709-1714. 10.1084/jem.20050808.

    PubMed Central  CAS  PubMed  Google Scholar 

  8. Diepolder HM, Zachoval R, Hoffmann RM, Jung MC, Gerlach T, Pape GR: The role of hepatitis C virus specific CD4+ T lymphocytes in acute and chronic hepatitis C. J Mol Med. 1996, 74: 583-588. 10.1007/s001090050062.

    CAS  PubMed  Google Scholar 

  9. Logvinoff C, Major ME, Oldach D, Heyward S, Talal A, Balfe P, Feinstone SM, Alter H, Rice CM, McKeating JA: Neutralizing antibody response during acute and chronic hepatitis C virus infection. Proc Natl Acad Sci USA. 2004, 101: 10149-10154. 10.1073/pnas.0403519101.

    PubMed Central  CAS  PubMed  Google Scholar 

  10. Umemura T, Wang RY, Schechterly C, Shih JW, Kiyosawa K, Alter HJ: Quantitative analysis of anti-hepatitis C virus antibody-secreting B cells in patients with chronic hepatitis C. Hepatology. 2006, 43: 91-99. 10.1002/hep.20917.

    CAS  PubMed  Google Scholar 

  11. Wintermeyer P, Wands JR: Vaccines to prevent chronic hepatitis C virus infection: current experimental and preclinical developments. J Gastroenterol. 2007, 42: 424-432. 10.1007/s00535-007-2057-5.

    PubMed  Google Scholar 

  12. Firbas C, Jilma B, Tauber E, Buerger V, Jelovcan S, Lingnau K, Buschle M, Frisch J, Klade CS: Immunogenicity and safety of a novel therapeutic hepatitis C virus (HCV) peptide vaccine: a randomized, placebo controlled trial for dose optimization in 128 healthy subjects. Vaccine. 2006, 24: 4343-4353. 10.1016/j.vaccine.2006.03.009.

    CAS  PubMed  Google Scholar 

  13. Klade CS, Wedemeyer H, Berg T, Hinrichsen H, Cholewinska G, Zeuzem S, Blum H, Buschle M, Jelovcan S, Buerger V, Tauber E, Frisch J, Manns MP: Therapeutic vaccination of chronic hepatitis C nonresponder patients with the peptide vaccine IC41. Gastroenterology. 2008, 134: 1385-1395. 10.1053/j.gastro.2008.02.058.

    CAS  PubMed  Google Scholar 

  14. Schlaphoff V, Klade CS, Jilma B, Jelovcan SB, Cornberg M, Tauber E, Manns MP, Wedemeyer H: Functional and phenotypic characterization of peptide-vaccine-induced HCV-specific CD8+ T cells in healthy individuals and chronic hepatitis C patients. Vaccine. 2007, 25: 6793-6806. 10.1016/j.vaccine.2007.06.026.

    CAS  PubMed  Google Scholar 

  15. Yutani S, Yamada A, Yoshida K, Takao Y, Tamura M, Komatsu N, Ide T, Tanaka M, Sata M, Itoh K: Phase I clinical study of a personalized peptide vaccination for patients infected with hepatitis C virus (HCV) 1b who failed to respond to interferon-based therapy. Vaccine. 2007, 25: 7429-7435. 10.1016/j.vaccine.2007.08.005.

    CAS  PubMed  Google Scholar 

  16. Nevens F, Roskams T, Van Vlierberghe H, Horsmans Y, Sprengers D, Elewaut A, Desmet V, Leroux-Roels G, Quinaux E, Depla E, Dincq S, Stichele Vander C, Maertens G, Hulstaert F: A pilot study of therapeutic vaccination with envelope protein E1 in 35 patients with chronic hepatitis C. Hepatology. 2003, 38: 1289-1296. 10.1053/jhep.2003.50474.

    CAS  PubMed  Google Scholar 

  17. Shiina M, Rehermann B: Cell culture-produced hepatitis C virus impairs plasmacytoid dendritic cell function. Hepatology. 2008, 47: 385-395. 10.1002/hep.21996.

    CAS  PubMed  Google Scholar 

  18. Folgori A, Capone S, Ruggeri L, Meola A, Sporeno E, Ercole BB, Pezzanera M, Tafi R, Arcuri M, Fattori E, Lahm A, Luzzago A, Vitelli A, Colloca S, Cortese R, Nicosia A: A T-cell HCV vaccine eliciting effective immunity against heterologous virus challenge in chimpanzees. Nat Med. 2006, 12: 190-197. 10.1038/nm1353.

    CAS  PubMed  Google Scholar 

  19. Grakoui A, McCourt DW, Wychowski C, Feinstone SM, Rice CM: Characterization of the hepatitis C virus-encoded serine proteinase: determination of proteinase-dependent polyprotein cleavage sites. J Virol. 1993, 67: 2832-2843.

    PubMed Central  CAS  PubMed  Google Scholar 

  20. Hijikata M, Mizushima H, Tanji Y, Komoda Y, Hirowatari Y, Akagi T, Kato N, Kimura K, Shimotohno K: Proteolytic processing and membrane association of putative nonstructural proteins of hepatitis C virus. Proc Natl Acad Sci USA. 1993, 90: 10773-10777. 10.1073/pnas.90.22.10773.

    PubMed Central  CAS  PubMed  Google Scholar 

  21. Houghton M, Selby M, Weiner A, Choo QL: Hepatitis C virus: structure, protein products and processing of the polyprotein precursor. Curr Stud Hematol Blood Transfus. 1994, 1-11.

    Google Scholar 

  22. Davis GL: Hepatitis C virus genotypes and quasispecies. Am J Med. 1999, 107: 21S-26S. 10.1016/S0002-9343(99)00376-9.

    CAS  PubMed  Google Scholar 

  23. Fan Z, Yang QR, Twu JS, Sherker AH: Specific in vitro association between the hepatitis C viral genome and core protein. J Med Virol. 1999, 59: 131-134. 10.1002/(SICI)1096-9071(199910)59:2<131::AID-JMV1>3.0.CO;2-C.

    CAS  PubMed  Google Scholar 

  24. Shimoike T, Mimori S, Tani H, Matsuura Y, Miyamura T: Interaction of hepatitis C virus core protein with viral sense RNA and suppression of its translation. J Virol. 1999, 73: 9718-9725.

    PubMed Central  CAS  PubMed  Google Scholar 

  25. Takahashi K, Kishimoto S, Yoshizawa H, Okamoto H, Yoshikawa A, Mishiro S: p26 protein and 33-nm particle associated with nucleocapsid of hepatitis C virus recovered from the circulation of infected hosts. Virology. 1992, 191: 431-434. 10.1016/0042-6822(92)90204-3.

    CAS  PubMed  Google Scholar 

  26. Wang C, Le SY, Ali N, Siddiqui A: An RNA pseudoknot is an essential structural element of the internal ribosome entry site located within the hepatitis C virus 5' noncoding region. RNA. 1995, 1: 526-537.

    PubMed Central  CAS  PubMed  Google Scholar 

  27. Blanchard E, Hourioux C, Brand D, Ait-Goughoulte M, Moreau A, Trassard S, Sizaret PY, Dubois F, Roingeard P: Hepatitis C virus-like particle budding: role of the core protein and importance of its Asp111. J Virol. 2003, 77: 10131-10138. 10.1128/JVI.77.18.10131-10138.2003.

    PubMed Central  CAS  PubMed  Google Scholar 

  28. Hourioux C, Ait-Goughoulte M, Patient R, Fouquenet D, Arcanger-Doudet F, Brand D, Martin A, Roingeard P: Core protein domains involved in hepatitis C virus-like particle assembly and budding at the endoplasmic reticulum membrane. Cell Microbiol. 2007, 9: 1014-1027. 10.1111/j.1462-5822.2006.00848.x.

    PubMed Central  CAS  PubMed  Google Scholar 

  29. Roingeard P, Hourioux C: Hepatitis C virus core protein, lipid droplets and steatosis. J Viral Hepat. 2008, 15: 157-164.

    CAS  PubMed  Google Scholar 

  30. Basu A, Meyer K, Ray RB, Ray R: Hepatitis C virus core protein is necessary for the maintenance of immortalized human hepatocytes. Virology. 2002, 298: 53-62. 10.1006/viro.2002.1460.

    CAS  PubMed  Google Scholar 

  31. Giannini C, Brechot C: Hepatitis C virus biology. Cell Death Differ. 2003, 10 (Suppl 1): S27-S38. 10.1038/sj.cdd.4401121.

    CAS  PubMed  Google Scholar 

  32. Isaguliants MG: Hepatitis C virus clearance: the enigma of failure despite an impeccable survival strategy. Curr Pharm Biotechnol. 2003, 4: 169-183. 10.2174/1389201033489856.

    CAS  PubMed  Google Scholar 

  33. Mori Y, Moriishi K, Matsuura Y: Hepatitis C virus core protein: its coordinate roles with PA28gamma in metabolic abnormality and carcinogenicity in the liver. Int J Biochem Cell Biol. 2008, 40: 1437-1442. 10.1016/j.biocel.2008.01.027.

    CAS  PubMed  Google Scholar 

  34. Maillard P, Krawczynski K, Nitkiewicz J, Bronnert C, Sidorkiewicz M, Gounon P, Dubuisson J, Faure G, Crainic R, Budkowska A: Nonenveloped nucleocapsids of hepatitis C virus in the serum of infected patients. J Virol. 2001, 75: 8240-8250. 10.1128/JVI.75.17.8240-8250.2001.

    PubMed Central  CAS  PubMed  Google Scholar 

  35. Jackson M, Smith B, Bevitt DJ, Steward M, Toms GL, Bassendine MF, Diamond AG: Comparison of cytotoxic T-lymphocyte responses to hepatitis C virus core protein in uninfected and infected individuals. J Med Virol. 1999, 58: 239-246. 10.1002/(SICI)1096-9071(199907)58:3<239::AID-JMV9>3.0.CO;2-V.

    CAS  PubMed  Google Scholar 

  36. Wang YF, Brotman B, Andrus L, Prince AM: Immune response to epitopes of hepatitis C virus (HCV) structural proteins in HCV-infected humans and chimpanzees. J Infect Dis. 1996, 173: 808-821.

    CAS  PubMed  Google Scholar 

  37. Elmowalid GA, Qiao M, Jeong SH, Borg BB, Baumert TF, Sapp RK, Hu Z, Murthy K, Liang TJ: Immunization with hepatitis C virus-like particles results in control of hepatitis C virus infection in chimpanzees. Proc Natl Acad Sci USA. 2007, 104: 8427-8432. 10.1073/pnas.0702162104.

    PubMed Central  CAS  PubMed  Google Scholar 

  38. Shata MT, Anthony DD, Carlson NL, Andrus L, Brotman B, Tricoche N, McCormack P, Prince A: Characterization of the immune response against hepatitis C infection in recovered, and chronically infected chimpanzees. J Viral Hepat. 2002, 9: 400-410. 10.1046/j.1365-2893.2002.00373.x.

    CAS  PubMed  Google Scholar 

  39. Thimme R, Bukh J, Spangenberg HC, Wieland S, Pemberton J, Steiger C, Govindarajan S, Purcell RH, Chisari FV: Viral and immunological determinants of hepatitis C virus clearance, persistence, and disease. Proc Natl Acad Sci USA. 2002, 99: 15661-15668. 10.1073/pnas.202608299.

    PubMed Central  CAS  PubMed  Google Scholar 

  40. Alvarez-Lajonchere L, Gonzalez M, Alvarez-Obregon JC, Guerra I, Vina A, costa-Rivero N, Musacchio A, Morales J, Dueñas-Carrera S: Hepatitis C virus (HCV) core protein enhances the immunogenicity of a co-delivered DNA vaccine encoding HCV structural antigens in mice. Biotechnol Appl Biochem. 2006, 44: 9-17. 10.1042/BA20050202.

    CAS  PubMed  Google Scholar 

  41. Geissler M, Gesien A, Tokushige K, Wands JR: Enhancement of cellular and humoral immune responses to hepatitis C virus core protein using DNA-based vaccines augmented with cytokine-expressing plasmids. J Immunol. 1997, 158: 1231-1237.

    CAS  PubMed  Google Scholar 

  42. Lagging LM, Meyer K, Hoft D, Houghton M, Belshe RB, Ray R: Immune responses to plasmid DNA encoding the hepatitis C virus core protein. J Virol. 1995, 69: 5859-5863.

    PubMed Central  CAS  PubMed  Google Scholar 

  43. Shirai M, Okada H, Nishioka M, Akatsuka T, Wychowski C, Houghten R, Pendleton CD, Feinstone SM, Berzofsky JA: An epitope in hepatitis C virus core region recognized by cytotoxic T cells in mice and humans. J Virol. 1994, 68: 3334-3342.

    PubMed Central  CAS  PubMed  Google Scholar 

  44. Vidalin O, Tanaka E, Spengler U, Trepo C, Inchauspe G: Targeting of hepatitis C virus core protein for MHC I or MHC II presentation does not enhance induction of immune responses to DNA vaccination. DNA Cell Biol. 1999, 18: 611-621. 10.1089/104454999315024.

    CAS  PubMed  Google Scholar 

  45. Encke J, zu Putlitz J, Stremmel W, Wands JR: CpG immuno-stimulatory motifs enhance humoral immune responses against hepatitis C virus core protein after DNA-based immunization. Arch Virol. 2003, 148: 435-448. 10.1007/s00705-002-0935-y.

    CAS  PubMed  Google Scholar 

  46. Duenas-Carrera S, Alvarez-Lajonchere L, Alvarez-Obregon JC, Herrera A, Lorenzo LJ, Pichardo D, Morales J: A truncated variant of the hepatitis C virus core induces a slow but potent immune response in mice following DNA immunization. Vaccine. 2000, 19: 992-997. 10.1016/S0264-410X(00)00209-7.

    CAS  PubMed  Google Scholar 

  47. Dunachie SJ, Walther M, Epstein JE, Keating S, Berthoud T, Andrews L, Andersen RF, Bejon P, Goonetilleke N, Poulton I, Webster DP, Butcher G, Watkins K, Sinden RE, Levine GL, Richie TL, Schneider J, Kaslow D, Gilbert SC, Carucci DJ, Hill AV: A DNA prime-modified vaccinia virus ankara boost vaccine encoding thrombospondin-related adhesion protein but not circumsporozoite protein partially protects healthy malaria-naive adults against Plasmodium falciparum sporozoite challenge. Infect Immun. 2006, 74: 5933-5942. 10.1128/IAI.00590-06.

    PubMed Central  CAS  PubMed  Google Scholar 

  48. McConkey SJ, Reece WH, Moorthy VS, Webster D, Dunachie S, Butcher G, Vuola JM, Blanchard TJ, Gothard P, Watkins K, Hannan CM, Everaere S, Brown K, Kester KE, Cummings J, Williams J, Heppner DG, Pathan A, Flanagan K, Arulanantham N, Roberts MT, Roy M, Smith GL, Schneider J, Peto T, Sinden RE, Gilbert SC, Hill AV: Enhanced T-cell immunogenicity of plasmid DNA vaccines boosted by recombinant modified vaccinia virus Ankara in humans. Nat Med. 2003, 9: 729-735. 10.1038/nm881.

    CAS  PubMed  Google Scholar 

  49. Kim HD, Jin JJ, Maxwell JA, Fukuchi K: Enhancing Th2 immune responses against amyloid protein by a DNA prime-adenovirus boost regimen for Alzheimer's disease. Immunol Lett. 2007, 112: 30-38. 10.1016/j.imlet.2007.06.006.

    PubMed Central  CAS  PubMed  Google Scholar 

  50. Santra S, Sun Y, Parvani JG, Philippon V, Wyand MS, Manson K, Gomez-Yafal A, Mazzara G, Panicali D, Markham PD, Montefiori DC, Letvin NL: Heterologous prime/boost immunization of rhesus monkeys by using diverse poxvirus vectors. J Virol. 2007, 81: 8563-8570. 10.1128/JVI.00744-07.

    PubMed Central  CAS  PubMed  Google Scholar 

  51. Steensels M, Bublot M, Van Borm S, De Vriese J, Lambrecht B, Richard-Mazet A, Chanavat-Bizzini S, Duboeuf M, Le Gros FX, van den Berg T: Prime-boost vaccination with a fowlpox vector and an inactivated avian influenza vaccine is highly immunogenic in Pekin ducks challenged with Asian H5N1 HPAI. Vaccine. 2009, 27: 646-654. 10.1016/j.vaccine.2008.11.044.

    CAS  PubMed  Google Scholar 

  52. Desjardins D, Huret C, Dalba C, Kreppel F, Kochanek S, Cosset FL, Tangy F, Klatzmann D, Bellier B: Recombinant retrovirus-like particle forming DNA vaccines in prime-boost immunization and their use for hepatitis C virus vaccine development. J Gene Med. 2009, 11 (4): 313-25. 10.1002/jgm.1307.

    CAS  PubMed  Google Scholar 

  53. Buonaguro L, Devito C, Tornesello ML, Schroder U, Wahren B, Hinkula J, Buonaguro FM: DNA-VLP prime-boost intra-nasal immunization induces cellular and humoral anti-HIV-1 systemic and mucosal immunity with cross-clade neutralizing activity. Vaccine. 2007, 25: 5968-5977. 10.1016/j.vaccine.2007.05.052.

    CAS  PubMed  Google Scholar 

  54. Kennedy JS, Co M, Green S, Longtine K, Longtine J, O'Neill MA, Adams JP, Rothman AL, Yu Q, Johnson-Leva R, Pal R, Wang S, Lu S, Markham P: The safety and tolerability of an HIV-1 DNA prime-protein boost vaccine (DP6-001) in healthy adult volunteers. Vaccine. 2008, 26: 4420-4424. 10.1016/j.vaccine.2008.05.090.

    PubMed Central  CAS  PubMed  Google Scholar 

  55. Duenas-Carrera S: DNA vaccination against hepatitis C. Curr Opin Mol Ther. 2004, 6: 146-150.

    CAS  PubMed  Google Scholar 

  56. Li YP, Kang HN, Babiuk LA, Liu Q: Elicitation of strong immune responses by a DNA vaccine expressing a secreted form of hepatitis C virus envelope protein E2 in murine and porcine animal models. World J Gastroenterol. 2006, 12: 7126-7135.

    PubMed Central  CAS  PubMed  Google Scholar 

  57. Galloway DR, Baillie L: DNA vaccines against anthrax. Expert Opin Biol Ther. 2004, 4: 1661-1667. 10.1517/14712598.4.10.1661.

    CAS  PubMed  Google Scholar 

  58. Skeiky YA, Sadoff JC: Advances in tuberculosis vaccine strategies. Nat Rev Microbiol. 2006, 4: 469-476. 10.1038/nrmicro1419.

    CAS  PubMed  Google Scholar 

  59. Tanghe A, Dangy JP, Pluschke G, Huygen K: Improved Protective Efficacy of a Species-Specific DNA Vaccine Encoding Mycolyl-Transferase Ag85A from Mycobacterium ulcerans by Homologous Protein Boosting. PLoS Negl Trop Dis. 2008, 2: e199-10.1371/journal.pntd.0000199.

    PubMed Central  PubMed  Google Scholar 

  60. Moore QC, Bosarge JR, Quin LR, McDaniel LS: Enhanced protective immunity against pneumococcal infection with PspA DNA and protein. Vaccine. 2006, 24: 5755-5761. 10.1016/j.vaccine.2006.04.046.

    CAS  PubMed  Google Scholar 

  61. Liang R, Hurk van den JV, Landi A, Lawman Z, Deregt D, Townsend H, Babiuk LA, van Drunen Littel-van den Hurk S: DNA prime protein boost strategies protect cattle from bovine viral diarrhea virus type 2 challenge. J Gen Virol. 2008, 89: 453-466. 10.1099/vir.0.83251-0.

    CAS  PubMed  Google Scholar 

  62. Liang R, Hurk van den JV, Zheng C, Yu H, Pontarollo RA, Babiuk LA, van Drunen Littel-van den Hurk S: Immunization with plasmid DNA encoding a truncated, secreted form of the bovine viral diarrhea virus E2 protein elicits strong humoral and cellular immune responses. Vaccine. 2005, 23: 5252-5262. 10.1016/j.vaccine.2005.06.025.

    CAS  PubMed  Google Scholar 

  63. Lu S: Immunogenicity of DNA vaccines in humans: it takes two to tango. Hum Vaccin. 2008, 4: 449-452.

    CAS  PubMed  Google Scholar 

  64. Hu GJ, Wang RY, Han DS, Alter HJ, Shih JW: Characterization of the humoral and cellular immune responses against hepatitis C virus core induced by DNA-based immunization. Vaccine. 1999, 17: 3160-3170. 10.1016/S0264-410X(99)00130-9.

    CAS  PubMed  Google Scholar 

  65. Mokhonov VV, Novikov DV, Samokhvalov EI, Shatalov AG, Selivanov NA, Prilipov AG, L'vov DK: [Genome analysis of hepatitis C virus strain 274933RU isolated in Russian Federation]. Vopr Virusol. 2002, 47: 9-12.

    CAS  PubMed  Google Scholar 

  66. Sominskaya I, Alekseeva E, Skrastina D, Mokhonov V, Starodubova E, Jansons J, Levi M, Prilipov A, Kozlovska T, Smirnov V, Pumpens P, Isaguliants MG: Signal sequences modulate the immunogenic performance of human hepatitis C virus E2 gene. Mol Immunol. 2006, 43: 1941-1952. 10.1016/j.molimm.2005.11.018.

    CAS  PubMed  Google Scholar 

  67. Rispeter K, Lu M, Lechner S, Zibert A, Roggendorf M: Cloning and characterization of a complete open reading frame of the hepatitis C virus genome in only two cDNA fragments. J Gen Virol. 1997, 78 (Pt 11): 2751-2759.

    CAS  PubMed  Google Scholar 

  68. Isaguliants MG, Petrakova NV, Kashuba EV, Suzdaltzeva YG, Belikov SV, Mokhonov VV, Prilipov AG, Matskova L, Smirnova IS, Jolivet-Reynaud C, Nordenfelt E: Immunization with hepatitis C virus core gene triggers potent T-cell response, but affects CD4+ T-cells. Vaccine. 2004, 22: 1656-1665. 10.1016/j.vaccine.2003.09.047.

    CAS  PubMed  Google Scholar 

  69. Mihailova M, Fiedler M, Boos M, Petrovskis I, Sominskaya I, Roggendorf M, Viazov S, Pumpens P: Preparation of hepatitis C virus structural and non-structural protein fragments and studies of their immunogenicity. Protein Expr Purif. 2006, 50: 43-48. 10.1016/j.pep.2006.06.011.

    CAS  PubMed  Google Scholar 

  70. Petrakova NV, Kalinina TI, Khudiakov I, Gazina EV, Smirnov VD: [Preparation and purification of a polypeptide containing antigenic determinants of hepatitis C core protein]. Vopr Virusol. 1997, 42: 208-212.

    CAS  PubMed  Google Scholar 

  71. McLauchlan J: Properties of the hepatitis C virus core protein: a structural protein that modulates cellular processes. J Viral Hepat. 2000, 7: 2-14. 10.1046/j.1365-2893.2000.00201.x.

    CAS  PubMed  Google Scholar 

  72. Yasui K, Wakita T, Tsukiyama-Kohara K, Funahashi SI, Ichikawa M, Kajita T, Moradpour D, Wands JR, Kohara M: The native form and maturation process of hepatitis C virus core protein. J Virol. 1998, 72: 6048-6055.

    PubMed Central  CAS  PubMed  Google Scholar 

  73. Ravaggi A, Natoli G, Primi D, Albertini A, Levrero M, Cariani E: Intracellular localization of full-length and truncated hepatitis C virus core protein expressed in mammalian cells. J Hepatol. 1994, 20: 833-836. 10.1016/S0168-8278(05)80157-6.

    CAS  PubMed  Google Scholar 

  74. Suzuki R, Matsuura Y, Suzuki T, Ando A, Chiba J, Harada S, Saito I, Miyamura T: Nuclear localization of the truncated hepatitis C virus core protein with its hydrophobic C terminus deleted. J Gen Virol. 1995, 76 (Pt 1): 53-61. 10.1099/0022-1317-76-1-53.

    CAS  PubMed  Google Scholar 

  75. Mosmann TR, Coffman RL: TH1 and TH2 cells: different patterns of lymphokine secretion lead to different functional properties. Annu Rev Immunol. 1989, 7: 145-173. 10.1146/annurev.iy.07.040189.001045.

    CAS  PubMed  Google Scholar 

  76. Pokorna D, Rubio I, Muller M: DNA-vaccination via tattooing induces stronger humoral and cellular immune responses than intramuscular delivery supported by molecular adjuvants. Genet Vaccines Ther. 2008, 6: 4-10.1186/1479-0556-6-4.

    PubMed Central  PubMed  Google Scholar 

  77. Nowicki MJ, Balistreri WF: The hepatitis C virus: identification, epidemiology, and clinical controversies. J Pediatr Gastroenterol Nutr. 1995, 20: 248-274.

    CAS  PubMed  Google Scholar 

  78. Garmory HS, Brown KA, Titball RW: DNA vaccines: improving expression of antigens. Genet Vaccines Ther. 2003, 1: 2-10.1186/1479-0556-1-2.

    PubMed Central  PubMed  Google Scholar 

  79. Sturtz FG, Li Y, Shulok J, Snodgrass HR, Chen Xz: A Nonviral Cytoplasmic T7 Autogene System and Its Applications in DNA Vaccination. 2000, 323-333.

    Google Scholar 

  80. Deml L, Bojak A, Steck S, Graf M, Wild J, Schirmbeck R, Wolf H, Wagner R: Multiple effects of codon usage optimization on expression and immunogenicity of DNA candidate vaccines encoding the human immunodeficiency virus type 1 Gag protein. J Virol. 2001, 75: 10991-11001. 10.1128/JVI.75.22.10991-11001.2001.

    PubMed Central  CAS  PubMed  Google Scholar 

  81. Stratford R, Douce G, Zhang-Barber L, Fairweather N, Eskola J, Dougan G: Influence of codon usage on the immunogenicity of a DNA vaccine against tetanus. Vaccine. 2000, 19: 810-815. 10.1016/S0264-410X(00)00246-2.

    CAS  PubMed  Google Scholar 

  82. Fu TM, Guan L, Friedman A, Schofield TL, Ulmer JB, Liu MA, Donnelly JJ: Dose dependence of CTL precursor frequency induced by a DNA vaccine and correlation with protective immunity against influenza virus challenge. J Immunol. 1999, 162: 4163-4170.

    CAS  PubMed  Google Scholar 

  83. Lee AH, Suh YS, Sung JH, Yang SH, Sung YC: Comparison of various expression plasmids for the induction of immune response by DNA immunization. Mol Cells. 1997, 7: 495-501.

    CAS  PubMed  Google Scholar 

  84. Bassett SE, Thomas DL, Brasky KM, Lanford RE: Viral persistence, antibody to E1 and E2, and hypervariable region 1 sequence stability in hepatitis C virus-inoculated chimpanzees. J Virol. 1999, 73: 1118-1126.

    PubMed Central  CAS  PubMed  Google Scholar 

  85. Rehermann B, Nascimbeni M: Immunology of hepatitis B virus and hepatitis C virus infection. Nat Rev Immunol. 2005, 5: 215-229. 10.1038/nri1573.

    CAS  PubMed  Google Scholar 

  86. Kozak M: Role of ATP in binding and migration of 40S ribosomal subunits. Cell. 1980, 22: 459-467. 10.1016/0092-8674(80)90356-6.

    CAS  PubMed  Google Scholar 

  87. Kozak M: Point mutations close to the AUG initiator codon affect the efficiency of translation of rat preproinsulin in vivo. Nature. 1984, 308: 241-246. 10.1038/308241a0.

    CAS  PubMed  Google Scholar 

  88. Jackson RJ: Alternative mechanisms of initiating translation of mammalian mRNAs. Biochem Soc Trans. 2005, 33: 1231-1241. 10.1042/BST20051282.

    CAS  PubMed  Google Scholar 

  89. Fraser CS, Doudna JA: Structural and mechanistic insights into hepatitis C viral translation initiation. Nat Rev Microbiol. 2007, 5: 29-38. 10.1038/nrmicro1558.

    CAS  PubMed  Google Scholar 

  90. Li D, Takyar ST, Lott WB, Gowans EJ: Amino acids 1–20 of the hepatitis C virus (HCV) core protein specifically inhibit HCV IRES-dependent translation in HepG2 cells, and inhibit both HCV. J Gen Virol. 2003, 84: 815-825. 10.1099/vir.0.18697-0.

    CAS  PubMed  Google Scholar 

  91. Wang TH, Rijnbrand RC, Lemon SM: Core protein-coding sequence, but not core protein, modulates the efficiency of cap-independent translation directed by the internal ribosome entry site of hepatitis C virus. J Virol. 2000, 74: 11347-11358. 10.1128/JVI.74.23.11347-11358.2000.

    PubMed Central  CAS  PubMed  Google Scholar 

  92. Wang B, Merva M, Dang K, Ugen KE, Boyer J, Williams WV, Weiner DB: DNA inoculation induces protective in vivo immune responses against cellular challenge with HIV-1 antigen-expressing cells. AIDS Res Hum Retroviruses. 1994, 10 (Suppl 2): S35-S41.

    CAS  PubMed  Google Scholar 

  93. Ulmer JB, Donnelly JJ, Parker SE, Rhodes GH, Felgner PL, Dwarki VJ, Gromkowski SH, Deck RR, DeWitt CM, Friedman A: Heterologous protection against influenza by injection of DNA encoding a viral protein. Science. 1993, 259: 1745-1749. 10.1126/science.8456302.

    CAS  PubMed  Google Scholar 

  94. Rollman E, Hinkula J, Arteaga J, Zuber B, Kjerrstrom A, Liu M, Wahren B, Ljungberg K: Multi-subtype gp160 DNA immunization induces broadly neutralizing anti-HIV antibodies. Gene Ther. 2004, 11: 1146-1154. 10.1038/sj.gt.3302275.

    CAS  PubMed  Google Scholar 

  95. Faber M, Lamirande EW, Roberts A, Rice AB, Koprowski H, Dietzschold B, Schnell MJ: A single immunization with a rhabdovirus-based vector expressing severe acute respiratory syndrome coronavirus (SARS-CoV) S protein results in the production of high levels of SARS-CoV-neutralizing antibodies. J Gen Virol. 2005, 86: 1435-1440. 10.1099/vir.0.80844-0.

    PubMed Central  CAS  PubMed  Google Scholar 

  96. Bahloul C, Taieb D, Diouani MF, Ahmed SB, Chtourou Y, B'chir BI, Kharmachi H, Dellagi K: Field trials of a very potent rabies DNA vaccine which induced long lasting virus neutralizing antibodies and protection in dogs in experimental conditions. Vaccine. 2006, 24: 1063-1072. 10.1016/j.vaccine.2005.09.016.

    CAS  PubMed  Google Scholar 

  97. Isaguliants MG, Iakimtchouk K, Petrakova NV, Yermalovich MA, Zuber AK, Kashuba VI, Belikov SV, Andersson S, Kochetkov SN, Klinman DM, Wahren B: Gene immunization may induce secondary antibodies reacting with DNA. Vaccine. 2004, 22: 1576-1585. 10.1016/j.vaccine.2003.09.033.

    CAS  PubMed  Google Scholar 

  98. Petrakova N, Yakimchuk K, Suzdaltzeva Y, Jolivet-Reynaud C, Wahren B, Isaguliants MG: "Bacterialized" gene for the C-terminus Truncated Version of Human Hepatitis C virus Core Induces Potent Th2-type Immune Response in Mice. [Abstract] DNA Vaccine Conference, Monte-Carlo, Monaco 17–19 November. 2004

    Google Scholar 

  99. Kjerrstrom A, Hinkula J, Engstrom G, Ovod V, Krohn K, Benthin R, Wahren B: Interactions of single and combined human immunodeficiency virus type 1 (HIV-1) DNA vaccines. Virology. 2001, 284: 46-61. 10.1006/viro.2001.0905.

    CAS  PubMed  Google Scholar 

  100. Taylor JL, Turner OC, Basaraba RJ, Belisle JT, Huygen K, Orme IM: Pulmonary necrosis resulting from DNA vaccination against tuberculosis. Infect Immun. 2003, 71: 2192-2198. 10.1128/IAI.71.4.2192-2198.2003.

    PubMed Central  CAS  PubMed  Google Scholar 

  101. Turner OC, Roberts AD, Frank AA, Phalen SW, McMurray DM, Content J, Denis O, D'Souza S, Tanghe A, Huygen K, Orme IM: Lack of protection in mice and necrotizing bronchointerstitial pneumonia with bronchiolitis in guinea pigs immunized with vaccines directed against the hsp60 molecule of Mycobacterium tuberculosis. Infect Immun. 2000, 68: 3674-3679. 10.1128/IAI.68.6.3674-3679.2000.

    PubMed Central  CAS  PubMed  Google Scholar 

  102. Ray RB, Lagging LM, Meyer K, Steele R, Ray R: Transcriptional regulation of cellular and viral promoters by the hepatitis C virus core protein. Virus Res. 1995, 37: 209-220. 10.1016/0168-1702(95)00034-N.

    CAS  PubMed  Google Scholar 

  103. Li K, Prow T, Lemon SM, Beard MR: Cellular response to conditional expression of hepatitis C virus core protein in Huh7 cultured human hepatoma cells. Hepatology. 2002, 35: 1237-1246. 10.1053/jhep.2002.32968.

    CAS  PubMed  Google Scholar 

  104. Moriya K, Nakagawa K, Santa T, Shintani Y, Fujie H, Miyoshi H, Tsutsumi T, Miyazawa T, Ishibashi K, Horie T, Imai K, Todoroki T, Kimura S, Koike K: Oxidative stress in the absence of inflammation in a mouse model for hepatitis C virus-associated hepatocarcinogenesis. Cancer Res. 2001, 61: 4365-4370.

    CAS  PubMed  Google Scholar 

  105. Hahn CS, Cho YG, Kang BS, Lester IM, Hahn YS: The HCV core protein acts as a positive regulator of fas-mediated apoptosis in a human lymphoblastoid T cell line. Virology. 2000, 276: 127-137. 10.1006/viro.2000.0541.

    CAS  PubMed  Google Scholar 

  106. Ray RB, Meyer K, Ray R: Suppression of apoptotic cell death by hepatitis C virus core protein. Virology. 1996, 226: 176-182. 10.1006/viro.1996.0644.

    CAS  PubMed  Google Scholar 

  107. Moriya K, Fujie H, Shintani Y, Yotsuyanagi H, Tsutsumi T, Ishibashi K, Matsuura Y, Kimura S, Miyamura T, Koike K: The core protein of hepatitis C virus induces hepatocellular carcinoma in transgenic mice. Nat Med. 1998, 4: 1065-1067. 10.1038/2053.

    CAS  PubMed  Google Scholar 

  108. Ray RB, Lagging LM, Meyer K, Ray R: Hepatitis C virus core protein cooperates with ras and transforms primary rat embryo fibroblasts to tumorigenic phenotype. J Virol. 1996, 70: 4438-4443.

    PubMed Central  CAS  PubMed  Google Scholar 

  109. Yamaguchi A, Tazuma S, Nishioka T, Ohishi W, Hyogo H, Nomura S, Chayama K: Hepatitis C virus core protein modulates fatty acid metabolism and thereby causes lipid accumulation in the liver. Dig Dis Sci. 2005, 50: 1361-1371. 10.1007/s10620-005-2788-1.

    CAS  PubMed  Google Scholar 

  110. Moriya K, Yotsuyanagi H, Shintani Y, Fujie H, Ishibashi K, Matsuura Y, Miyamura T, Koike K: Hepatitis C virus core protein induces hepatic steatosis in transgenic mice. J Gen Virol. 1997, 78 (Pt 7): 1527-1531.

    CAS  PubMed  Google Scholar 

  111. Ramshaw IA, Ramsay AJ: The prime-boost strategy: exciting prospects for improved vaccination. Immunol Today. 2000, 21: 163-165. 10.1016/S0167-5699(00)01612-1.

    CAS  PubMed  Google Scholar 

Download references

Acknowledgements

We thank Prof. Eva Stankevica and her group for the oligonucleotide synthesis and automatic sequencing and Ms. Natalija Gabrusheva and Ms. Irena Timofeeva for technical assistance. This work was supported by grants from the Latvian Council of Science 05.1626, ERAF VPD1/ERAF/CFLA/05/APK/2.5.1./000021/010, EU #05-1000004-7748, the European Social Fund (ESF), the New Visby program of the Swedish Institute, CompuVac grant #LSHB-CT-2004-005246 and the Russian Foundation for Basic Research #08-04-01107-a.

Author information

Authors and Affiliations

Authors

Corresponding authors

Correspondence to Ekaterina Alekseeva or Maria Isaguliants.

Additional information

Competing interests

The authors declare that they have no competing interests.

Authors' contributions

IS and EK constructed plasmids and screened their immunogenicity; EA did experiments on expression and wrote a draft of the manuscript; ES and EI carried out quantifications of core expression; DS and NP did immunological experiments; RB conducted the immunocytochemistry; MI was involved with the immunological experiments, statistical evaluations and worked with the manuscript; TK and PP give useful scientific advice and revised the manuscript. All authors read and approved the final manuscript.

Electronic supplementary material

12965_2008_68_MOESM1_ESM.ppt

Additional file 1: Establishment of calibration curves for quantification of core expression in vitro. Recombinant core aa 1–173 in serial dilutions in the range of 10 to 25 ng (A), 10 to 100 ng (B), or 12.5 to 100 ng (C) was loaded on 15% SDS-PAAG and resolved by gel electrophoresis together with the study samples. Proteins were transferred to PVDF membrane and subjected to Western blotting with core-specific rabbit antibodies, and secondary anti-rabbit HRP-conjugated antibodies (DAKOPatts). Signals were registered using X-ray films and ECL detection system, images were saved, scanned, and signal of individual band corresponding to core was quantified by Image J http://rsb.info.nih.gov, and calibration curves were built (D). (PPT 4 MB)

12965_2008_68_MOESM2_ESM.ppt

Additional file 2: Summary on core-specific immune responses in BALB/c and C57BL/6 mice. Summarized data of immunization experiments performed in BALB/c and C57BL6 mice. The empty vector immunized group and the control group are composed of a mixture of BALB/c (n = 7) and C57BL6 (n = 12) mice. All the other groups had been described in Figures 4 to 6. (PPT 56 KB)

Authors’ original submitted files for images

Rights and permissions

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Reprints and permissions

About this article

Cite this article

Alekseeva, E., Sominskaya, I., Skrastina, D. et al. Enhancement of the expression of HCV core gene does not enhance core-specific immune response in DNA immunization: advantages of the heterologous DNA prime, protein boost immunization regimen. Genet Vaccines Ther 7, 7 (2009). https://0-doi-org.brum.beds.ac.uk/10.1186/1479-0556-7-7

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://0-doi-org.brum.beds.ac.uk/10.1186/1479-0556-7-7

Keywords