- Research article
- Open access
- Published:
Differential genome evolution and speciation of Coix lacryma-jobi L. and Coix aquatica Roxb. hybrid guangxi revealed by repetitive sequence analysis and fine karyotyping
BMC Genomics volume 15, Article number: 1025 (2014)
Abstract
Background
Coix, Sorghum and Zea are closely related plant genera in the subtribe Maydeae. Coix comprises 9–11 species with different ploidy levels (2n = 10, 20, 30, and 40). The exclusively cultivated C. lacryma-jobi L. (2n = 20) is widely used in East and Southeast Asia for food and medicinal applications. Three fertile cytotypes (2n = 10, 20, and 40) have been reported for C. aquatica Roxb. One sterile cytotype (2n = 30) closely related to C. aquatica has been recently found in Guangxi of China. This putative hybrid has been named C. aquatica HG (Hybrid Guangxi). The genome composition and the evolutionary history of C. lacryma-jobi and C. aquatica HG are largely unclear.
Results
About 76% of the genome of C. lacryma-jobi and 73% of the genome of C. aquatica HG are repetitive DNA sequences as shown by low coverage genome sequencing followed by similarity-based cluster analysis. In addition, long terminal repeat (LTR) retrotransposable elements are dominant repetitive sequences in these two genomes, and the proportions of many repetitive sequences in whole genome varied greatly between the two species, indicating evolutionary divergence of them. We also found that a novel 102 bp variant of centromeric satellite repeat CentX and two other satellites only appeared in C. aquatica HG. The results from FISH analysis with repeat probe cocktails and the data from chromosomes pairing in meiosis metaphase showed that C. lacryma-jobi is likely a diploidized paleotetraploid species and C. aquatica HG is possibly a recently formed hybrid. Furthermore, C. lacryma-jobi and C. aquatica HG shared more co-existing repeat families and higher sequence similarity with Sorghum than with Zea.
Conclusions
The composition and abundance of repetitive sequences are divergent between the genomes of C. lacryma-jobi and C. aquatica HG. The results from fine karyotyping analysis and chromosome pairing suggested diploidization of C. lacryma-jobi during evolution and C. aquatica HG is a recently formed hybrid. The genome-wide comparison of repetitive sequences indicated that the repeats in Coix were more similar to those in Sorghum than to those in Zea, which is consistent with the phylogenetic relationship reported by previous work.
Background
Coix lacryma-jobi L. (2n = 20), also commonly called adlay (Job’s tears), is widely cultivated as a food and medicine plant in East and Southeast Asian countries [1]. Its grain has the highest protein content among cereal crops [2], and its seed extracts are used to treat several diseases [3, 4]. Previous research on Coix has focused mainly on its medicinal components and their efficacy [5, 6]. Genetic and genomic studies on Coix are sparse, although there are some reports on cytogenetic analysis [7–9], genetic linkage map development [10], construction of BAC libraries [11], and isolation of prolamin gene families [12, 13].
The genus Coix belongs to Maydeae of Poaceae family and is the closest group to the genera Zea, Tripsacum, and Sorghum[14]. The places of the origin of the three genera are very different. Zea originates from America, and Sorghum originates from Africa, while the genus Coix is indigenous to Southeast Asia [1]. Previous studies have shown that Coix comprises of 9–11 species with different levels of ploidy. Tetraploids (2n = 20) predominate, including the exclusively cultivated Coix lacryma-jobi L., while diploids (2n =10), hexaploids (2n = 30), and octoploids (2n = 40) with a basic chromosome number of x = 5 are less frequent [15]. Coix aquatica Roxb. has been reported to have three fertile cytotypes (2n = 10, 20 and 40). A sterile cytotype (2n = 30) of very close botanical relationship to C. aquatica was found in southwest China [16]. The results from genomic in situ hybridization (GISH) demonstrated that 20 out of its 30 chromosomes are highly homologous to the chromosomes of C. lacryma-jobi[7]. The genomic and evolutionary information of C. lacryma-jobi and this sterile C. aquatica remains elusive. Furthermore, the phylogenetic relationship between Coix and Zea/Sorghum is still unclear. Comparative analysis of genomic DNA sequences may contribute to answer those questions.
The majority of the genomic sequences in higher eukaryotes are repetitive elements including transposable elements and satellite repeats [17]. Large-scale accumulation of satellites and transposable elements serves as a major driving force for genome expansion [18, 19]. Most long terminal repeat (LTR) retrotransposable elements disperse throughout plant chromosomes, while some elements locate in specific regions of chromosomes [20]. Satellite DNA sequences, consisting of short tandem repeats, share a common structural feature [21]. They are usually located in specific chromosomal regions and may be broadly classified as centromeric, subtelomeric, or intercalary repetitive sequences [22]. Satellite repeats are very powerful tools for chromosome identification, chromosome karyotyping, and comparative genome analysis [23, 24]. Because of similar chromosome lengths and/or arm ratios and lack of sufficient landmarks, adequate identification of Coix chromosome pairs remains challenging. Therefore, identification and characterization of major repetitive sequences are essential for understanding the organization and structure of Coix genomes.
In this study, we sequenced ~6 Gb genomic sequences of C. lacryma-jobi and 12 Gb genomic sequences of C. aquatica HG, and found highly dynamic nature of these two genomes during evolution. Our karyotyping analysis revealed that C. lacryma-jobi is a diploidized paleotetraploid species, and C. aquatica HG is recently formed hybrid between C. lacryma-jobi and a distantly related species. Comparative repeat sequence analysis supported that Coix is closer to Sorghum than to Zea. The findings in this study advance our understanding of Coix genome evolution and shed new light on the genomics of the Poaceae family.
Results
Low-coverage sequencing of C. lacryma-jobi and C. aquaticaHG genomes and repetitive sequence analysis
To better understand the Coix genus at the genome level, we determined the genome size of the two Coix species using flow cytometry with the maize inbred line B73 (approximately 2,300 Mb) as a reference genome (Additional file 1: Figure S1). The genome size of C. lacryma-jobi was approximately 1,684 Mb (Table 1), similar to the previous report [25]. C. aquatica HG had a genome of approximately 2,335 Mb (Table 1), about 1.4-fold of the C. lacryma-jobi genome.
We sequenced (Table 1) and used cluster-based repeat identification and classification method [26] to analyze the data. Except Penelope retrotransposon and P transposon superfamilies [27], all other plant transposable elements and repetitive DNA were detected in these two species, including LTR and LINE/SINE retrotransposons, Mutator and En-Spm transposons, satellites, and rDNA. The proportion of total repetitive sequences in whole genome is 75.54% in C. lacryma-jobi and 72.88% in C. aquatica HG. The proportion of different types of repetitive DNA was displayed in Table 2.
We found that retroelements occupied 69.08% of the C. lacryma-jobi genome and 63.83% of the C. aquatica HG genome (Table 2). The two dominant families of retroelements are Ty1/Copia and Ty3/Gypsy retrotransposons. The Ty1/Copia occupied 39.57% of the C. lacryma-jobi genome and 31.12% of the C. aquatica HG genome, while the Ty3/Gypsy occupied 29.11% and 32.56%, respectively. The most abundant type I transposon was the Spm class of transposons, and the Mutator was also enriched in Coix.
We believed that the abundance of many repeats varied greatly between these two species. To test this hypothesis, we conducted a comparative analysis by combining reads of these two species and performing cluster-based repeat identification and classification on the combined reads [28, 29]. In spite of lacking statistical examination on these data, we found that CL1, a Ty1/Copia member, occupied 3.44% of the C. lacryma-jobi genome but only 1.16% of the C. aquatica HG genome, and other Ty1/Copia elements including CL4, CL8, CL9, CL11, and CL27 all displayed a similar pattern (Supplemental Data 2). Together, Ty1/Copia retroelements have a higher percentage in C. lacryma-jobi than in C. aquatica HG. Similarly, some clusters of Ty3/Gypsy also showed genome proportion change, for example, CL2 and CL414 occupies 1.7% and 0.000134% of the C. lacryma-jobi genome respectively, while 1.07% and 0.00707% of the C. aquatica HG genome respectively. To further verify these results, we conducted FISH on the chromosomes of the two species using CL2 and CL414 as probes (Additional file 1: Figure S2). CL2 probe exhibited intense signal in both species. In C. aquatica HG, 20 out of 30 chromosomes showed stronger signals than the other 10 chromosomes. CL414 probe only showed faint signal in C. lacryma-jobi, while intense signal was observed on C. aquatica HG chromosomes. Similar to the signal of CL2 probe, 20 out of the 30 chromosomes in C. aquatica HG showed stronger signal of CL414 probe than the other 10 chromosomes. The distribution and proportion of Ty1/Copia and Ty3/Gypsy family members were illustrated in Figure 1. Our sequencing results revealed that four families (CL286, CL411, CL429, and CL472) were present only in one species but absent in the other species. We further confirmed the results of CL411 and CL429 by FISH (Additional file 1: Figure S3). This varied abundance of the LTR retroelements in the two species may result from sweep or accumulation of the same families, or the rapid change during polyploidization [30].
Our results showed that the satellite DNA made up only 0.60% of the C. lacryma-jobi genome in contrast to 4.89% of the C. aquatica HG genome. We also found that the most abundant repeats in these two species were completely different, and the proportion of the co-existing satellite repeats varied greatly in these two genomes (Table 3), indicating rapid evolution of satellite repeats in Coix. In particular, two distinct satellite repeats (SatS1 and SatS2) made up approximately 2.17% of the C. aquatica HG genome (Table 3). The rDNA proportion was similar in the two genomes. The information of other repeat families was presented in the Additional file 2.
A novel centromeric satellite repeat was identified in C. aquaticaHG
It has been demonstrated that ten chromosomes in C. aquatica HG with less homology to C. lacryma-jobi harbor low copy number of centromeric repeat CentX and a large amount of centromeric retrotransposon CRC [7]. To identify possible new centromeric repeats in these ten chromosomes, we used an OsCenH3 antibody specific for the 30 centromeres in C. aquatica HG to perform ChIP-seq assay (Additional file 1: Figure S4). Quantitative ChIP PCR showed significant relative enrichment of CentX and CRC in the ChIPed DNA (Figure 2), suggesting that CentX and CRC might be associated with CenH3, the functional centromere marker. In the absence of a reference genome, we mapped ChIP-seq data to the clusters of the C. aquatica HG genome for cluster-based repeat identification. The result also showed the significant relative enrichment of CentX and CRC. Besides, we identified a novel CentX variant in C. aquatica HG. In contrast to the typical size of 153 bp for CentX, the monomer of this CentX variant had 102 bp and accounted for 1.21% of the total CentX in the ChIPed DNA. According to our whole genome sequencing data, this variant made up 0.45% of the total CentX and 0.003% of the C. aquatica HG genome. To test whether this variant is specifically located on the 10 chromosomes less homologous to the C. lacryma-jobi chromosomes, we conducted FISH using the sequence of the 102 bp CentX variant and the sequence of the 51 bp missing from the CentX variant but in the typical CentX as separate probes (Figure 3). Both of the 102 bp variant and the 51 bp fragment did not show a different distribution pattern compared with the typical CentX. The extremely faint signals from the two probes showed a similar intensity on the 10 chromosomes less homologous to C. lacryma-jobi chromosomes. These results indicate that the 102 bp variant may not be specific to the 10 chromosomes.
The karyotype of C. lacryma-jobi and C. aquaticaHG
We performed karyotyping analysis on C. lacryma-jobi and C. aquatica HG using the satellite repeats, 5S rDNA and 45S rDNA as probes (Figure 4). The signal of the centromeric satellite repeat CentX was large on the Chromosomes pair 2, strong on the chromosomes pairs 4, 5, 8 and 9, weak on the chromosomes pairs 1, 3, 7 and 10, and faint on the chromosomes pair 6. The 45S rDNA probe appeared as one large signal at the end of the short arm of the chromosome pair 1. The signal from the 5S rDNA was located at the peri-centromeric region of the long arm of the chromosome pair 4. It is generally agreed that, SatS3, SatS5, and SatS4 signals sequentially approach the telomere at the subtelomeric region. Thus, using these five repeat probes, we expected to identify the individual somatic chromosome in C. lacryma-jobi. The signal patterns on C. lacryma-jobi chromosomes were shown in Figure 4e. We prepared an ideogram displaying the position and fluorescence intensity of satellite repeats on C. lacryma-jobi chromosomes (Figure 4f). The relative length of each chromosome pair was listed in Additional file 1: Table S1.
We used a similar approach to determine the karyotype of C. aquatica HG (Figure 5). By using the CentX and C. lacryma-jobi genomic DNA probes, we found that 20 out of the 30 chromosomes of C. aquatica HG were highly homologous to the chromosomes of C. lacryma-jobi. We then further karyotyped these 20 chromosomes by sequential FISH using the following three probe cocktails: 1) 45S rDNA and 5S rDNA; 2) co-existing satellites SatS3, SatS4 and SatS5; 3) SatS1 and SatS2. Signals from the co-existing satellite probe cocktail showed not only different distribution patterns in C. aquatica HG compared with C. lacryma-jobi, but also a pronounced asymmetric distribution on each chromosome pair (SatS3, SatS4 and SatS5 signals were on Chr. 1, 1’ and 4, 4’). We confirmed this observation by FISH on pachytene chromosomes (Figure 6). Under the condition of enhanced visualization of chromosome pairing, SatS3 and SatS5 signals on the homologous chromosome pairs appeared as a pattern of contrasting presence on one chromosome and absence on the paired one, or large amount on one chromosome and small amount on the paired one (Figure 6).
Next, we numbered the remaining 10 chromosomes as A1 to A10 and stained them with the probe cocktails. The signal distribution patterns of the probes on A1-A10 chromosomes were quite different from the patterns on the other 20 chromosomes. A faint 5S rDNA signal appeared near the end of the long arm of Chr. A7. SatS5 was absent on chromosomes A5 and A6, and 45S rDNA signal was absent on all the 10 chromosomes, indicating a different origin of this set of chromosomes compared with the other 20 chromosomes. We made a putative ideograph displaying the position and fluorescence intensity of satellites on C. aquatica HG chromosomes (Figure 7). The relative length of chromosome pairs was listed in Additional file 1: Table S2.
Determination of the ploidy level of C. lacryma-jobi and C. aquaticaHG
Because certain Coix species have ten chromosomes [31], it is possible that C. lacryma-jobi is a tetraploid and C. aquatica HG is a hexaploid. According to previous reports, C. aquatica should be fertile and able to propagate by fertilization [32]. However, our karyotyping analysis revealed 10 chromosome pairs in C. lacryma-jobi and 10 paired plus 10 unpaired chromosomes in C. aquatica HG, implying the absence of any typical characteristics of a tetraploid or hexaploid genome (Figures 4 and 5). We then determined chromosome pairing during metaphase I in C. lacryma-jobi and C. aquatica HG using CentX and CRC probes. Consistent with the previous report [8], our cytogenetic analysis showed that all the examined C. lacryma-jobi meiotic cells had 10 bivalents, while except one cell with an ambiguous trivalent, the rest of the examined C. aquatica HG meiotic cells had 10 bivalents and 10 univalents (Table 4). We also analyzed pollen viability of the C. aquatica HG using I2-KI dying method, and found that the pollen grains were sterile (Additional file 1: Table S3). Thus, based on the fact that C. aquatica HG is reproduced by vegetative propagation [8] and our findings, we believed that the C. aquatica HG might be recently formed hybrid and C. lacryma-jobi is a diploidized paleotetraploid species.
Comparative analysis on the repeat sequence in Coix, Zea and Sorghum
We performed classification analysis of LTR for the C. lacryma-jobi and C. aquatica HG using plant Ty1/Copia clades including Tos17, SIRE1/Maximus, Tnt1, Angela, Tont1, Reina and Bianca [33]. As illustrated in Figure 8a, Coix Ty1/Copia elements were distributed in six clades except the Tos17 clade. The most abundant retroelements in Coix is the SIRE1/Maximus family members, which is also abundant in maize genome [34]. Our results show that all abundant Ty1/Copia families in Sorghum and Zea were also present in Coix, indicating a close relationship of these three genera.
Additionally, we analyzed seven well characterized Ty3/Gypsy clades including CRM, Hopscotch, Tekay, Galadriel, Athila, Ogre and Tat [33]. We found Tekay, CRM, Reina, Athila, and Tat in Coix (Figure 8b). Huck in Tekay has been shown to be one of the four most dominant retroelements in Zea mays, and a moderate-repetitive DNA in Sorghum bicolor[35]. Leviathan in Tat was found to be abundant in Sorghum bicolor, and moderately abundant in Zea mays with no recent activities [35]. We found that Huck shared one node with coix_CL100 (0.238%) and caqu_CL82 (0.361%), and Leviathan also shared one node with coix_CL18 (0.864%) and caqu_CL8 (1.11%), indicating that the divergence of Coix and Sorghum might be later than that of Sorghum and Zea.
We downloaded paired-end sequences of Zea mays (the inbred line B73), Zea luxurians, and Sorghum bicolor (the inbred line Tx378) from http://sra.dnanexus.com/, and combined all the sequences. We found that repetitive sequences account for 79% of the maize genome and 59.4% of the sorghum genome which is very similar to the previous reports [18, 19]. Distribution of major repeat families in the five species showed that the species-specific clusters occupied 2.18% of the C. aquatica HG genome and 8.62% of the sorghum genome, but were not detected in the other three species (Figure 9a). The co-existing clusters made up 22.98% of the C. aquatica HG genome, 26.16% of the Coix lacryma-jobi genome, 19.33% of the Zea mays genome, 21.22% in the Zea luxurians genome, and 13.58% of the Sorghum bicolor genome. Coix-Sorghum co-existing clusters accounted for 12.42% of the C. aquatica HG genome, 19.16% of the Coix lacryma-jobi genome, and 21.34% of the Sorghum bicolor genome. Only a few co-existing clusters were found in Zea and Sorghum. C. lacryma-jobi and Zea shared 43 clusters, however, these clusters only made up 0.04% of the C. lacryma-jobi genome. Thus, C. lacryma-jobi and C. aquatica HG shared more co-existing repeat families with Sorghum than with Zea. To confirm that Coix shared more repeat sequences with Sorghum than with Zea, we analyzed repeat sequences in C. lacryma-jobi, C. aquatica HG, maize, and sorghum using the RepeatMasker program (RepBase 20130422) and found that repeat sequences in Coix were more similar to those in sorghum than to those in maize (Figure 8b). Therefore, our results corroborate the previous phylogenetic speculation, which shows that Coix might be closer to Sorghum than to Zea[14, 36, 37].
Discussion
The dynamic nature of the repetitive sequences in Coix
Repetitive sequences play essential roles in genome structuring and evolution, and they usually expand disproportionally to genome enlargement [38]. In the grass family, repetitive DNA accounts for 40% of 466 Mb rice genome [39], 62% of 740 Mb sorghum genome [19], and 82% of 2300 Mb maize genome [18]. In general, the larger a genome size is, the larger is the portion of repeats in the genome. In this study, flow cytometry analysis showed that the genome size of C. lacryma-jobi and C. aquatica HG, were approximately 1665 Mb and 2335 Mb, respectively (Table 1). By using "cluster-based repeat identification" approach, we reanalyzed the repetitive DNA proportion in Zea mays and Sorghum bicolor genome as 79% and 59.4%, respectively, which is consistent with the previous reports [18, 19]. We found that Coix had a quite high percentage of repetitive DNA: 75.54% for C. lacryma-jobi and 72.88% for C. aquatica HG (Table 2). Notably, our results showed that C. aquatica HG with a larger genome than C. lacryma-jobi harbored less abundant repetitive DNA compared with C. lacryma-jobi. One possibility might be that C. aquatica HG may arise from the hybridization of C. lacryma-jobi with another relative with less repetitive DNA, indicating a more recent origin of this species. The genome size of C. aquatica HG is 1.4-fold of the C. lacryma-jobi genome (Table 2). We suspected that the C. aquatica HG genome might be still in the process of expanding after original genome fusion. The loss of two tandem repeats (SatS1 and SatS2) and the lower percentage of the co-existing satellites in C. lacryma-jobi suggested rapid evolution of this genome (Table 3, Figures 4 and 5). The second interpretation might be that the absence of chromosome recombination and rearrangement during meiosis decelerate genome reshuffling in the sterile C. aquatica HG. Thirdly, the extent and speed of transposable element expansion may somehow vary in these two species, resulting in the compositional differences of repetitive sequences in the two species [38].
Transposable elements are a major class of repetitive DNA driving genome expansion and speciation [40]. Many families or genera have specific types of transposable elements interspersed in heterochromatic and euchromatic regions [41]. C. lacryma-jobi and C. aquatica HG consist of typical repetitive DNA in Poaceae family [42]. In this study, the most abundant repetitive elements were Ty1/Copia and Ty3/Gypsy, comprising 68.68% of the C. lacryma-jobi genome and 63.68% of the C. aquatica HG genome (Table 2). Similar to differential enrichment of Ty1/Copia and Ty3/Gypsy retroelements in Musa acuminate genome [43], we found the proportion of Ty1/Copia was moderately higher than that of Ty3/Gypsy in C. lacryma-jobi (Table 2). However, Ty3/Gypsy retroelements were more abundant than Ty1/Copia retroelements in C. aquatica HG in our study, which is similar to Zea and Sorghum, Oryza sativa, Spirodela polyrhiza, Brachypodium distachyon, and Arabidopsis thaliana[44]. Inspection of Ty1/Copia and Ty3/Gypsy content of plant genomes in a phylogenetic context reveals no congruence in their content even in closely related species and highlights differences in success of genome occupation [45]. This obvious difference between these two species may be caused by differential amplification or removal of Ty1/Copia and Ty3/Gypsy elements in C. lacryma-jobi and C. aquatica HG.
Satellite repeats are also a critical class of repetitive DNA in higher eukaryotes [46]. Long stretches of satellite repeats may reside in a special chromosomal locus as a hallmark, functional unit, or a driving force for genome revolution [47]. The centromere specific satellite repeats are particularly important for centromere formation, expansion, and function [48–50]. Consistent with their functional conservation, centromeric satellite repeats are broadly conserved in length, in spite of large variation in their DNA sequences [51]. The size of individual centromeric satellite repeat is 155, 165, 176, and 171 bp in maize, rice, Brassica, and human, respectively [52–55]. Very interestingly, we found 153 and 102 bp centromeric satellite repeats in Coix. The 153 bp satellite repeat is within the normal range of the length of centromeric satellite repeats, while the 102 bp repeat is the shortest centromeric satellite repeat reported in Poaceae thus far. Similarly, different satellite repeats are also detected in potato [56]. In-depth comparative sequence analysis of five homologous centromeres in two Solanum species indicates that centromeric satellite repeats may undergo boom-bust cycles before a favorable repeat is fixed in a population [57]. This may explain why the 153 bp and 102 bp repeats co-exist in the Coix centromere. Megabase-sized centromeric satellite repeats in large genomes may trace back to LTR retrotransposon [58, 59], although neocentromeres may function properly without satellite repeats during early stages of centromere evolution [60]. Given that C. aquatica HG is sterile and spreads by vegetative propagation, we believe that the evolution of its centromere may be reproductively suppressed. Therefore, the 102 bp variant may represent an evolutionary intermediate of centromeric repeat in Coix.
Ploidy level of C. lacryma-jobi and C. aquaticaHG
C. lacryma-jobi (2n = 20) and C. aquatica HG (2n = 30) are generally known as tetraploid and hexaploid species, respectively, because the diploid species within the Coix genus has been reported to contain 10 chromosomes in its somatic cells [31].The genus Sorghum has 25 species with 10, 20, 30, or 40 chromosomes, and these species are classified as diploid plants [61]. Ploidy level of C. lacryma-jobi and C. aquatica HG remains inconclusive. Karyotyping analysis has been shown to be able to provide direct evidence for homologous chromosome identification in polyploid species by visualizing characteristic chromosomal structures [62]. Taking advantage of a set of powerful satellite repeat markers, we found clear SatS3, SatS4 and SatS5 signal pairs on metaphase chromosomes in the C. lacryma-jobi karyotype, which represent the typical feature of diploid karyotypes. Furthermore, we found that 20 chromosomes displayed 10 perfect pairs in pachytene, which was consistent with the 10 bivalents during the meiosis I. Therefore, we speculated that C. lacryma-jobi might behave as a diploid species. However, our observation could not rule out the possibility that C. lacryma-jobi might be an ancient tetraploid species. During the evolution of many ancient tetraploid species, diploidization often occurs to restructure the genome [63, 64]. Thus, we suspected that the C. lacryma-jobi genome, as a tetraploid during its early evolution, might go through subsequent diploidization, similar to what has happened to maize.
In C. aquatica HG, GISH with C. lacryma-jobi genomic DNA has been shown to identify 20 homologous chromosomes [7]. In this study, the 20 chromosomes also had bright centromeric satellite (CentX) signals (Figure 4). Additionally, some chromosome pairs, such as chromosome 1 and 1’, and chromosomes 4 and 4’, showed asymmetric repeat signals of SatS1, SatS2, SatS3, SatS4 and SatS5 (Figure 4), suggesting that the 20 paired chromosomes may be derived from a recent hybridization of two dissimilar parents and that repeat sequence homogenization may be still an ongoing process [65]. We also found that the other 10 chromosomes have extremely faint signals of centromeric satellite repeats (Figure 5h) compared with the 20 paired chromosomes, and the signal patterns of other satellites on these 10 chromosomes were also different from those on the 20 paired chromosomes in C. aquatica HG or in the C. lacryma-jobi chromosomes (Figures 4,5,6,7). We found that during meiosis I, 30 chromosomes of C. aquatica HG formed ten bivalents and ten univalents (Table 4). In addition, pollen of C. aquatica HG was almost completely sterile (Additional file 1: Table S3). All these data suggested that the C. aquatica HG could be a recently formed hybrid between an octoploid cytotype (2n = 40) related to C. lacryma-jobi and a tetraploid cytotype (2n = 20) of a more distantly related Coix species (Additional file 1: Figure S5). Another possibility is that the hybrid plant might be formed by a diploid (2n = 20) and a different diploid (2n = 20) parent, consequently resulting in a numerically unreduced gamete, hence mimicking a partial autopolyploidization of the second nonhomologous genome.
The phylogenetic relationship of Zea, Sorghum and Coixwas corroborated by comparative repeat sequence analysis
Zea, Sorghum, and Coix are close relatives in Poaceae family, although they independently originated in Central America, Africa, and Southeast Asia, respectively [1]. Previous studies using chloroplast sequences indicate that Coix is evolutionarily closer to Sorghum than to Zea[14, 36], which has been further confirmed by comparative analysis of the bz orthologous region [37]. This argument, however, is still questionable due to the absence of evidence from nuclear genome. In our study, we compared all repeat elements of five species from Zea, Sorghum, and Coix. We found that the co-existing repeat families in Zea and Coix comprised only 16 clusters. However, the Sorghum and Coix shared 68 clusters. Zea and Sorghum only had 1 cluster in common (Figure 9a). These lines of evidence from nuclear DNA sequences also support a close evolutionary relationship between Coix and Sorghum and a relative distant evolutionary relationship between Zea and Sorghum.
We also identified the most abundant families of LTR-retrotransposon of Zea and Sorghum in the Coix genome, indicating that Coix, Zea and Sorghum may be closely related to one another. It has been shown that Ji and Opie are the most abundant Ty1/Copia-type retroelements in Zea mays, and their copies decrease in Sorghum bicolor and Coix[35]. Huck is an abundant Ty3/Gypsy type retroelement in Zea mays[66], but just a moderately repetitive element in Sorghum bicolor and Coix[35]. Additionally, Leviathan is moderately abundant in Coix and Sorghum bicolor genomes [35]. These results, together with those from repeat sequence comparison, suggest that the dynamics of the genome-wide repeat elements in Coix, Zea and Sorghum, to certain extent, might facilitate the clarification of the evolution relationship of these close species.
Conclusions
In this study, we used low-coverage sequencing on Coix lacryma-jobi L. (2n = 20) and Coix aquatica Roxb. HG (2n = 30) to analyze repeat elements. We revealed the genome structure of these two species and large proportional difference of the same repetitive element between two genomes, indicating evolutionary divergence of these two species. The fine karyotyping analysis using satellites as markers and the chromosome pairing of meiotic metaphase I of these two species suggests that C. lacryma-jobi is likely a diploidized paleotetraploid species, and C. aquatica HG might be an early generation hybrid between Coix lacryma-jobi L. and a distantly related species. In addition, the genome-wide repeat sequence comparative analysis of Zea Mays, Zea luxurians, Sorghum bicolor, and Coix indicated that Coix seem to be closer to Sorghum than to Zea, which is consistent to previous report. Our results shed new light on the evolution and species differentiation in the Poaceae family.
Methods
Plant materials
C. lacryma-jobi cultivar BJ and C. aquatica HG were used in this study. The chromosome number and genomic features of C. lacryma-jobi and C. aquatica HG were listed in Table 1. BJ is the most important cultivar in north China, it is dry habitat, it’s leaf blades and sheaths are broad and glabrous, it’s false fruits is soft and pyriform. This phenotype is consistent to C. lacryma-jobi[15]. The 2n = 30 C. aquatica HG is the only C. aquatica in China, it was found in northwest of China [16]. It is perennial, aquatic, stoloniferous and rooting from the stolon node, but when grown under field conditions it becomes erect; It’s leaf blades and sheaths are narrow and glabrous, the false fruits is hard and pyriform. This phenotype is consistent to C. aquatica[15].
Genome size estimation
The 1C value of C. lacryma-jobi and C. aquatica HG was measured by flow cytometry with propidium iodide (PI) to stain DNA and Zea mays inbred line B73 as the reference plant. Fresh leaves were quickly cut with a sharp knife and treated with the lysis buffer (0.18% Tris, 0.74% Na2EDTA, 0.01% spermine, 5.8% KCl, 1.1% β-mercaptoethanol and 0.1% Triton X-100) for 10 minutes. The suspension was filtered with 30 μm nylon mesh, centrifuged at 800 rpm for 5 min. The supernatant was discarded and the pellet was then resuspended in PI (Propidium Iodide, 50 μg · mL-1). A flow cytometer (BD, FACSCalibur, USA) was used for the fluorescence measurement, with 10,000 particles measured per run and three runs performed per plant preparation. The genome size was calculated according to the formula: Genome sizeObject = (mean G1 nuclei fluorescence intensityObject/mean G1 nuclei fluorescence intensityStandard) Genome sizeStandard. The peak coefficient of variation percentages were all <5.5%.
DNA extraction and Solexa sequencing
DNA isolation was followed a standard cetyl trimethyl ammonium bromide (CTAB) extraction protocol [67]. DNA was diluted to a final concentration of 200–300 ng/μl for Illumina sequencing. One hundred bp paired-end reads were obtained from HiSeq2000 platform (BerryGenomics).
The sequences for Zea mays inbred line B73 SRR088692, Zea luxurians accession PI441933 SRR088692, and Sorghum bicolor inbred line Tx378 SRR561245 were downloaded from DNAnexus (http://sra.dnanexus.com/).
Data access
The genome sequencing data files associated with this study have been submitted to NCBI SRA with accession number SRP049558.
Data analysis
Sequencing data were preprocessed to remove low-quality reads, and then the unpaired reads were discarded. Repeat sequence assembly was performed using a graph-based clustering approach as described by Novak et al. [26] with the cluster size threshold for detailed analysis as 0.005%. Repeat type identification was done by sequence-similarity searches of assembled contigs against Repbase repeatmaskerlibrary using RepeatMasker [68], and by detection of conserved protein domains using RPS-Blast (Reversed Position Specific-Blast) [69]. Satellite monomer within contig sequences were identified using Tandem Repeats Finder [70]. Contigs corresponding to putative mitochondrial and plastid sequences were identified by NCBI blastn and the clusters were eliminated. The genome proportion of each cluster was calculated as the percentage of reads.
To determine the distribution of different repeats between C. lacryma-jobi and C. aquatica HG, a combined dataset comprising 68,187,510 reads and labeled reads with sample codes were built and the graph-based clustering analysis was performed as previous mentioned. To further analyze the pattern of repeats evolution between subtribe Maydeae and Sorghum, Sorghum bicolor inbred line BTX623, Zea mays inbred line B73 and Zea luxurians paired-end data were added to build another combined dataset comprising 15,000,000 reads with sample codes. Both datasets were analyzed as described above.
The whole raw data of C. lacryma-jobi and C. aquatica HG was masked with RepeatMasker [68] using maize and sorghum as reference genomes. The threshold of identity >70% and coverage >50% were used to screen the output. Then the total read number for each annotation was calculated. By comparing the whole and individual repeat family between these two annotations, the relationship of these genera was analyzed.
ChIP, ChIP-seq, and quantitative ChIP-PCR
Nuclei isolation was performed according to the published protocol [71]. ChIP was performed following standard protocols [72]. Both ChIPed DNA and mock DNA were used for Solexa sequencing (BerryGenomics). ChIP-qPCR was performed to confirm relative enrichment of specific sequences within anti-OsCENH3 precipitated DNA relative to the DNA sample prepared from pre-blood immunoprecipitation 45S rDNA and SatS3, localized at chromosome ends, were used as negative controls to normalize enrichment of each positive amplicon. Quantitative PCR data were analyzed as described previously [73].
Repeat Identification from the ChIP-seq dataset
To identify repeats associated with CenH3, a set of 2.5Â M 100Â bp paired-end ChIP-seq reads were mapped to the genomic Graph-based clusters using PatMan program [74], allowing for maximum of three mismatches including two gaps. Based on its best similarity detected among the genomic sequencing reads, each ChIP-seq read was mapped to a maximum of one cluster.
FISH, GISH, and immunostaining
Mitotic and meiotic chromosome preparation and FISH were performed following published protocols [75] with a minor modification. Root tips of C. lacryma-jobi and C. aquatica HG were harvested and immediately exposed to nitrous oxide at 2 atm for 2 hours, then fixed in a 3:1 solution of ethanol: glacial acetic acid. DNA probes for each satellite repeat and rDNA were amplified by PCR using C. lacryma-jobi and C. aquatica HG genomic DNA. Cloning of satellite repeats and rDNA were conducted using primers designed from extracted repeat clusters. The plasmids were labeled with either biotin-16-UTP, digoxigenin-11-dUTP (Roche Diagnostics), or Diethylaminocoumarin-5-dUTP (PerkinElmer) by standard nick translation. An oligonucleotide of (TTTAGGG)3 was labeled at the 5’-end with digoxigenin as a FISH probe to detect telomere repeat location. To determine localization of the CentX variant on C. aquatica HG chromosomes, FISH was performed with oligonucleotide AATTCAACTGCGAGTTTTTTCGTGCATCGGTGGGAAAAACGGCCCTCCCTCACGAGTTTT from the 102 bp CentX variant labeled at 5’-end with biotin and AAAACTCATGTTTGGTGGGTTTTTGGCACTTTCATTTCCG from the rest of the 51 bp labeled at 5’-end with digoxigenin. Chromosomes were counterstained with 4’, 6-diamidino-2-phenylindole (DAPI) in Vectashield antifade solution (Vector Laboratories).
Images were captured digitally using a Sensys CCD camera (QIMAGING, RETIGA-SRV, FAST 1394) attached to an Olympus BX61 epifluorescence microscope (Tokyo, Japan). Image-Pro plus 6.5 software (Media Cybernetics) was used to measure FISH signals and chromosome parameters. Images were adjusted with Adobe Photoshop 7.0. For karyotype construction, chromosomes in five metaphase cells in each species were measured. Sequential FISH was conducted following published protocol [76]. After first round of FISH and image capture, the slides were washed through a set of PBS (phosphate buffer saline) buffer and ethanol series before hybridized by the second set of probes.
Immunostaining was performed following published protocols [7]. Root tips harvested from plants were fixed in 4% (w/v) paraformaldehyde for 15 min at room temperature. The root tips were squashed on glass slides. The slides were incubated in a humid chamber at 37°C for overnight with primary antibodies against OsCENH3 diluted 1:500 in TNB buffer (0.1 M Tris–HCl, pH 7.5, 0.15 M NaCl, and 0.5% blocking reagent). The slides were incubated with Cy3-conjugated goat anti-rabbit antibody (1:1000) at 37°C for 1 h.
Pollen viability
To examine pollen viability, fresh pre-flowering panicles from C. aquatica HG were collected and stained with 1% iodine-potassium iodide and 1% acetocarmine solutions. More than 400 pollen grains were examined under the Olympus CX41 microscope. Stained pollen grains with a normal size were considered fertile. Small pollen grains with faint staining and empty pollen grains were considered sterile [77].
LTR retrotransposon family classification
Phylogenetic trees including representative Ty1/Copia and Ty3/Gypsy clades were reconstructed with reference sequences from the previously reported matrices [33]. For each LTR retrotransposon family, one contig covering the RT (reverse transcriptase) domain was used to represent the entire family for phylogenetic analysis. The representative contigs were selected as the most conserved considering their similarity scores with known elements obtained using RPS-BLAST and three alignment profiles: pfam07727, pfam00078 and cd01650. The amino acid sequence within the RT domain was extracted from alignment results of RT boundaries using a custom Python script. Phylogenetic trees were constructed using the Neighbor-joining method and bootstrapped with 100 replicates using the MEGA5.
Abbreviations
- FISH:
-
Fluorescent in situ hybridization
- GISH:
-
Genomic in situ hybridization
- Gb:
-
Giga base pairs
- Mb:
-
Mega base pairs
- bp:
-
Base pair
- RT:
-
Reverse transcriptase
- ChIP:
-
Chromatin immunoprecipitation.
References
Arora R: Job’s-tears (Coix lacryma-jobi)—a minor food and fodder crop of northeastern India. (Econ Bot. 1977, 31 (3): 358-366.
Ottoboni LM, Leite A, Targon MLN, Crozier A, Arruda P: Characterization of the storage protein in seed of Coix lacryma-jobi var. Adlay. J Agric Food Chem. 1990, 38 (3): 631-635. 10.1021/jf00093a010.
Woo J-H, Dapeng L, Orita H, Coulter J, Tully E, Kwon TK, Xu S, Gabrielson E: Coix seed extract, A commonly used treatment for cancer in china, inhibits NFκB and protein kinase C signaling. Cancer biology & therapy. 2007, 6 (12): 2005-2011. 10.4161/cbt.6.12.5168.
Kim SO, Yun SJ, Jung B, Lee EH, Hahm DH, Shim I, Lee HJ: Hypolipidemic effects of crude extract of adlay seed (Coix lachrymajobi var. mayuen) in obesity rat fed high fat diet: relations of TNF-alpha and leptin mRNA expressions and serum lipid levels. Life Sci. 2004, 75 (11): 1391-1404. 10.1016/j.lfs.2004.03.006.
Chung CP, Hsia SM, Lee MY, Chen HJ, Cheng F, Chan LC, Kuo YH, Lin YL, Chiang W: Gastroprotective activities of adlay (Coix lachryma-jobi L. var. ma-yuen Stapf) on the growth of the stomach cancer AGS cell line and indomethacin-induced gastric ulcers. J Agric Food Chem. 2011, 59 (11): 6025-6033. 10.1021/jf2009556.
Lu Y, Zhang B, Jia Z, Wu W, Lu Z: Hepatocellular carcinoma HepG2 cell apoptosis and caspase-8 and Bcl-2 expression induced by injectable seed extract of Coix lacryma-jobi. Hepatobiliary Pancreat Dis Int. 2011, 10 (3): 303-307. 10.1016/S1499-3872(11)60050-7.
Han Y, Wang G, Liu Z, Liu J, Yue W, Song R, Zhang X, Jin W: Divergence in centromere structure distinguishes related genomes in Coix lacryma-jobi and its wild relative. Chromosoma. 2010, 119 (1): 89-98. 10.1007/s00412-009-0239-z.
Han Y, Li D, Li Y, Xue Y, Hu Z, Song Y: Cytogenetic identification of a new hexaploid Coix aquatica Cyto-type. Acta Bot Sin. 2004, 46 (6): 724-729.
Venkateswarlu J, Rao PN: Apomictic maternal diploids in tetraploid Job's tears. Theor Appl Genet. 1975, 45 (6): 274-276. 10.1007/BF00831901.
Qin F, Li J, Li X, Corke H: AFLP and RFLP linkage map in Coix. Genet Resour Crop Ev. 2005, 52 (2): 209-214. 10.1007/s10722-003-1387-2.
Meng X, Huang B, Zhou L, He Y, Chen Q, Yuan Y, Xu Z, Song R: Construction of a Coix BAC library and isolation of the 22 kDa α-coixin gene cluster. Genome. 2010, 53 (9): 667-674. 10.1139/G10-045.
Ottoboni LM, Leite A, Yunes JA, Targon ML, de Souza Filho GA, Arruda P: Sequence analysis of 22Â kDa-like alpha-coixin genes and their comparison with homologous zein and kafirin genes reveals highly conserved protein structure and regulatory elements. Plant Mol Biol. 1993, 21 (5): 765-778. 10.1007/BF00027110.
Song R, Messing J: Contiguous genomic DNA sequence comprising the 19-kD zein gene family from maize. Plant Physiol. 2002, 130 (4): 1626-1635. 10.1104/pp.012179.
Kellogg EA, Watson L: Phylogenetic studies of a large data set. I. Bambusoideae, Andropogonodae, and Pooideae (Gramineae). Bot Rev. 1993, 59 (4): 273-343. 10.1007/BF02857419.
Rao PN, Nirmala A: Chromosomal basis of evolution in the genus Coix L. (Maydeae): a critical appraisal. Nucleus. 2011, 53 (1–2): 13-24.
Lu P, Zuo Z: Detection and identification of Coix aquatica species in Guangxi. J Guangxi Agric Sci. 1996, 1: 18-20.
Kumar A, Bennetzen JL: Plant retrotransposons. Annu Rev Genet. 1999, 33 (1): 479-532. 10.1146/annurev.genet.33.1.479.
Schnable PS, Ware D, Fulton RS, Stein JC, Wei F, Pasternak S, Liang C, Zhang J, Fulton L, Graves TA, Minx P, Reily AD, Courtney L, Kruchowski SS, Tomlinson C, Strong C, Delehaunty K, Fronick C, Courtney B, Rock SM, Belter E, Du F, Kim K, Abbott RM, Cotton M, Levy A, Marchetto P, Ochoa K, Jackson SM, Gillam B, et al: The B73 maize genome: complexity, diversity, and dynamics. Science. 2009, 326 (5956): 1112-1115. 10.1126/science.1178534.
Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Narechania A, Otillar RP, Penning BW, Salamov AA, Wang Y, Zhang L, Carpita NC, et al: The Sorghum bicolor genome and the diversification of grasses. Nature. 2009, 457 (7229): 551-556. 10.1038/nature07723.
Wolfgruber TK, Sharma A, Schneider KL, Albert PS, Koo D-H, Shi J, Gao Z, Han F, Lee H, Xu R: Maize centromere structure and evolution: sequence analysis of centromeres 2 and 5 reveals dynamic loci shaped primarily by retrotransposons. PLoS Genet. 2009, 5 (11): e1000743-10.1371/journal.pgen.1000743.
Ganal M, Riede I, Hemleben V: Organization and sequence analysis of two related satellite DNAs in cucumber (Cucumis sativus L.). J Mol Evol. 1986, 23 (1): 23-30. 10.1007/BF02100995.
Sharma S, Raina SN: Organization and evolution of highly repeated satellite DNA sequences in plant chromosomes. Cytogenet Genome Res. 2005, 109 (1–3): 15-26.
Albert PS, Gao Z, Danilova TV, Birchler JA: Diversity of chromosomal karyotypes in maize and its relatives. Cytogenet Genome Res. 2010, 129 (1–3): 6-16.
Kato A, Lamb JC, Birchler JA: Chromosome painting using repetitive DNA sequences as probes for somatic chromosome identification in maize. Proc Natl Acad Sci USA. 2004, 101 (37): 13554-13559. 10.1073/pnas.0403659101.
Bennett MD, Leitch IJ: Nuclear DNA Amounts in Angiosperms. Ann Bot. 1995, 76 (2): 113-176. 10.1006/anbo.1995.1085.
Novak P, Neumann P, Macas J: Graph-based clustering and characterization of repetitive sequences in next-generation sequencing data. BMC Bioinformatics. 2010, 11: 378-10.1186/1471-2105-11-378.
Wicker T, Sabot F, Hua-Van A, Bennetzen JL, Capy P, Chalhoub B, Flavell A, Leroy P, Morgante M, Panaud O: A unified classification system for eukaryotic transposable elements. Nat Rev Genet. 2007, 8 (12): 973-982. 10.1038/nrg2165.
Renny-Byfield S, Kovarik A, Kelly LJ, Macas J, Novak P, Chase MW, Nichols RA, Pancholi MR, Grandbastien MA, Leitch AR: Diploidization and genome size change in allopolyploids is associated with differential dynamics of low- and high-copy sequences. Plant J. 2013, 74 (5): 829-839. 10.1111/tpj.12168.
Renny-Byfield S, Chester M, Kovarik A, Le Comber SC, Grandbastien MA, Deloger M, Nichols RA, Macas J, Novak P, Chase MW, Leitch AR: Next generation sequencing reveals genome downsizing in allotetraploid Nicotiana tabacum, predominantly through the elimination of paternally derived repetitive DNAs. Mol Biol Evol. 2011, 28 (10): 2843-2854. 10.1093/molbev/msr112.
Ozkan H, Levy AA, Feldman M: Allopolyploidy-induced rapid genome evolution in the wheat (Aegilops–Triticum) group. Plant Cell. 2001, 13 (8): 1735-1747. 10.1105/tpc.13.8.1735.
Koul A: Heterochromatin and non-homologous chromosome associations in Coix aquatica. Chromosoma. 1964, 15 (3): 243-245. 10.1007/BF00321509.
Sapre A, Deshpande D: Isolation of a series of chromosomal variants (2n = 10 to 21) from an open-pollinated population of interspecific hybrids between Coix gigantea and Coix aquatica (Poaceae). Genetica. 1987, 74 (1): 61-68. 10.1007/BF00055095.
Piednoel M, Carrete-Vega G, Renner SS: Characterization of the LTR retrotransposon repertoire of a plant clade of six diploid and one tetraploid species. Plant J. 2013, 75 (4): 699-709. 10.1111/tpj.12233.
Bousios A, Kourmpetis YA, Pavlidis P, Minga E, Tsaftaris A, Darzentas N: The turbulent life of Sirevirus retrotransposons and the evolution of the maize genome: more than ten thousand elements tell the story. Plant J. 2012, 69 (3): 475-488. 10.1111/j.1365-313X.2011.04806.x.
Estep MC, DeBarry JD, Bennetzen JL: The dynamics of LTR retrotransposon accumulation across 25 million years of panicoid grass evolution. Heredity (Edinb). 2013, 110 (2): 194-204. 10.1038/hdy.2012.99.
Leseberg CH, Duvall MR: The complete chloroplast genome of Coix lacryma-jobi and a comparative molecular evolutionary analysis of plastomes in cereals. J Mol Evol. 2009, 69 (4): 311-318. 10.1007/s00239-009-9275-9.
Wang Q, Dooner HK: Dynamic evolution of bz orthologous regions in the Andropogoneae and other grasses. Plant J. 2012, 72 (2): 212-221. 10.1111/j.1365-313X.2012.05059.x.
Kidwell MG: Transposable elements and the evolution of genome size in eukaryotes. Genetica. 2002, 115 (1): 49-63. 10.1023/A:1016072014259.
Yu J, Hu S, Wang J, Wong GK, Li S, Liu B, Deng Y, Dai L, Zhou Y, Zhang X, Cao M, Liu J, Sun J, Tang J, Chen Y, Huang X, Lin W, Ye C, Tong W, Cong L, Geng J, Han Y, Li L, Li W, Hu G, Huang X, Li W, Li J, Liu Z, Li L, et al: A draft sequence of the rice genome (Oryza sativa L. ssp. indica). Science. 2002, 296 (5565): 79-92. 10.1126/science.1068037.
Fedoroff N: Transposons and genome evolution in plants. Proc Natl Acad Sci U S A. 2000, 97 (13): 7002-7007. 10.1073/pnas.97.13.7002.
Baucom RS, Estill JC, Chaparro C, Upshaw N, Jogi A, Deragon J-M, Westerman RP, SanMiguel PJ, Bennetzen JL: Exceptional diversity, non-random distribution, and rapid evolution of retroelements in the B73 maize genome. PLoS Genet. 2009, 5 (11): e1000732-10.1371/journal.pgen.1000732.
Ouyang S, Buell CR: The TIGR Plant Repeat Databases: a collective resource for the identification of repetitive sequences in plants. Nucleic Acids Res. 2004, 32 (suppl 1): D360-D363.
Hřibová E, Neumann P, Matsumoto T, Roux N, Macas J, Doležel J: Repetitive part of the banana (Musa acuminata) genome investigated by low-depth 454 sequencing. BMC Plant Biol. 2010, 10 (1): 204-10.1186/1471-2229-10-204.
Wang W, Haberer G, Gundlach H, Glasser C, Nussbaumer T, Luo MC, Lomsadze A, Borodovsky M, Kerstetter RA, Shanklin J, Byrant DW, Mockler TC, Appenroth KJ, Grimwood J, Jenkins J, Chow J, Choi C, Adam C, Cao XH, Fuchs J, Schubert I, Rokhsar D, Schmutz J, Michael TP, Mayer KF, Messing J: The Spirodela polyrhiza genome reveals insights into its neotenous reduction fast growth and aquatic lifestyle. Nat Commun. 2014, 5: 3311-
Vitte C, Fustier MA, Alix K, Tenaillon MI: The bright side of transposons in crop evolution. Brief Funct Genomics. 2014, 13 (4): 276-295. 10.1093/bfgp/elu002.
Shapiro JA, Sternberg R: Why repetitive DNA is essential to genome function. Biol Rev. 2005, 80 (2): 227-250.
Plohl M, Luchetti A, Meštrović N, Mantovani B: Satellite DNAs between selfishness and functionality: structure, genomics and evolution of tandem repeats in centromeric (hetero) chromatin. Gene. 2008, 409 (1): 72-82.
Harrington JJ, Van Bokkelen G, Mays RW, Gustashaw K, Willard HF: Formation of de novo centromeres and construction of first-generation human artificial microchromosomes. Nat Genet. 1997, 15 (4): 345-355. 10.1038/ng0497-345.
Jin W, Melo JR, Nagaki K, Talbert PB, Henikoff S, Dawe RK, Jiang J: Maize centromeres: organization and functional adaptation in the genetic background of oat. Plant Cell. 2004, 16 (3): 571-581. 10.1105/tpc.018937.
Wu J, Yamagata H, Hayashi-Tsugane M, Hijishita S, Fujisawa M, Shibata M, Ito Y, Nakamura M, Sakaguchi M, Yoshihara R, Kobayashi H, Ito K, Karasawa W, Yamamoto M, Saji S, Katagiri S, Kanamori H, Namiki N, Katayose Y, Matsumoto T, Sasaki T: Composition and structure of the centromeric region of rice chromosome 8. Plant Cell. 2004, 16 (4): 967-976. 10.1105/tpc.019273.
Henikoff S, Ahmad K, Malik HS: The centromere paradox: stable inheritance with rapidly evolving DNA. Science. 2001, 293 (5532): 1098-1102. 10.1126/science.1062939.
Zhang W, Yi C, Bao W, Liu B, Cui J, Yu H, Cao X, Gu M, Liu M, Cheng Z: The transcribed 165-bp CentO satellite is the major functional centromeric element in the wild rice species Oryza punctata. Plant Physiol. 2005, 139 (1): 306-315. 10.1104/pp.105.064147.
Cheng Z, Dong F, Langdon T, Ouyang S, Buell CR, Gu M, Blattner FR, Jiang J: Functional rice centromeres are marked by a satellite repeat and a centromere-specific retrotransposon. Plant Cell. 2002, 14 (8): 1691-1704. 10.1105/tpc.003079.
Lim K-B, De Jong H, Yang T-J, Park J-Y, Kwon S-J, Kim JS, Lim M-H, Kim JA, Jin M, Jin Y-M: Characterization of rDNAs and tandem repeats in the heterochromatin of Brassica rapa. Mol Cells. 2005, 19 (3): 436-444.
Masumoto H, Masukata H, Muro Y, Nozaki N, Okazaki T: A human centromere antigen (CENP-B) interacts with a short specific sequence in alphoid DNA, a human centromeric satellite. J Cell Biol. 1989, 109 (5): 1963-1973. 10.1083/jcb.109.5.1963.
Gong Z, Wu Y, Koblizkova A, Torres GA, Wang K, Iovene M, Neumann P, Zhang W, Novak P, Buell CR, Macas J, Jiang J: Repeatless and repeat-based centromeres in potato: implications for centromere evolution. Plant Cell. 2012, 24 (9): 3559-3574. 10.1105/tpc.112.100511.
Zhang H, Koblizkova A, Wang K, Gong Z, Oliveira L, Torres GA, Wu Y, Zhang W, Novak P, Buell CR, Macas J, Jiang J: Boom-Bust Turnovers of Megabase-Sized Centromeric DNA in Solanum Species: Rapid Evolution of DNA Sequences Associated with Centromeres. Plant Cell. 2014, 26 (4): 1436-1447. 10.1105/tpc.114.123877.
Tek AL, Song J, Macas J, Jiang J: Sobo, a recently amplified satellite repeat of potato, and its implications for the origin of tandemly repeated sequences. Genetics. 2005, 170 (3): 1231-1238. 10.1534/genetics.105.041087.
Sharma A, Wolfgruber TK, Presting GG: Tandem repeats derived from centromeric retrotransposons. BMC Genomics. 2013, 14 (1): 142-10.1186/1471-2164-14-142.
Zhang B, Lv Z, Pang J, Liu Y, Guo X, Fu S, Li J, Dong Q, Wu HJ, Gao Z, Wang XJ, Han F: Formation of a functional maize centromere after loss of centromeric sequences and gain of ectopic sequences. Plant Cell. 2013, 25 (6): 1979-1989. 10.1105/tpc.113.110015.
Price HJ, Dillon SL, Hodnett G, Rooney WL, Ross L, Johnston JS: Genome evolution in the genus Sorghum (Poaceae). Ann Bot. 2005, 95 (1): 219-227. 10.1093/aob/mci015.
Xiong Z, Pires JC: Karyotype and identification of all homoeologous chromosomes of allopolyploid Brassica napus and its diploid progenitors. Genetics. 2011, 187 (1): 37-49. 10.1534/genetics.110.122473.
Clarkson JJ, Lim KY, Kovarik A, Chase MW, Knapp S, Leitch AR: Long-term genome diploidization in allopolyploid Nicotiana section Repandae (Solanaceae). New Phytol. 2005, 168 (1): 241-252. 10.1111/j.1469-8137.2005.01480.x.
Mandakova T, Joly S, Krzywinski M, Mummenhoff K, Lysak MA: Fast diploidization in close mesopolyploid relatives of Arabidopsis. Plant Cell. 2010, 22 (7): 2277-2290. 10.1105/tpc.110.074526.
Lim KY, Soltis DE, Soltis PS, Tate J, Matyasek R, Srubarova H, Kovarik A, Pires JC, Xiong Z, Leitch AR: Rapid chromosome evolution in recently formed polyploids in Tragopogon (Asteraceae). PLoS One. 2008, 3 (10): e3353-10.1371/journal.pone.0003353.
Meyers BC, Tingey SV, Morgante M: Abundance, distribution, and transcriptional activity of repetitive elements in the maize genome. Genome Res. 2001, 11 (10): 1660-1676. 10.1101/gr.188201.
Doyle JJ: A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem bull. 1987, 19: 11-15.
Smit AF, Hubley R, Green P: RepeatMasker Open-3.0. 1996-2010, http://www.repeatmasker.org,
Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ: Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 1997, 25 (17): 3389-3402. 10.1093/nar/25.17.3389.
Benson G: Tandem repeats finder: a program to analyze DNA sequences. Nucleic Acids Res. 1999, 27 (2): 573-10.1093/nar/27.2.573.
Zhang W, Wu Y, Schnable JC, Zeng Z, Freeling M, Crawford GE, Jiang J: High-resolution mapping of open chromatin in the rice genome. Genome Res. 2012, 22 (1): 151-162. 10.1101/gr.131342.111.
Nagaki K, Talbert PB, Zhong CX, Dawe RK, Henikoff S, Jiang J: Chromatin immunoprecipitation reveals that the 180-bp satellite repeat is the key functional DNA element of Arabidopsis thaliana centromeres. Genetics. 2003, 163 (3): 1221-1225.
Wang G, He Q, Liu F, Cheng Z, Talbert PB, Jin W: Characterization of CENH3 proteins and centromere-associated DNA sequences in diploid and allotetraploid Brassica species. Chromosoma. 2011, 120 (4): 353-365. 10.1007/s00412-011-0315-z.
Prufer K, Stenzel U, Dannemann M, Green RE, Lachmann M, Kelso J: PatMaN: rapid alignment of short sequences to large databases. Bioinformatics. 2008, 24 (13): 1530-1531. 10.1093/bioinformatics/btn223.
Zhao X, Lu J, Zhang Z, Hu J, Huang S, Jin W: Comparison of the distribution of the repetitive DNA sequences in three variants of Cucumis sativus reveals their phylogenetic relationships. J Genet Genomics. 2011, 38 (1): 39-45. 10.1016/j.jcg.2010.12.005.
Liu C, Liu J, Li H, Zhang Z, Han Y, Huang S, Jin W: Karyotyping in melon (Cucumis melo L.) by cross-species fosmid fluorescence in situ hybridization. Cytogenet Genome Res. 2010, 129 (1–3): 241-249.
Kubo T, Yoshimura A, Kurata N: Hybrid male sterility in rice is due to epistatic interactions with a pollen killer locus. Genetics. 2011, 189 (3): 1083-1092. 10.1534/genetics.111.132035.
Acknowledgements
We thank Professor Jiming Jiang in the Department of Horticulture of University of Wisconsin for his critical read of the manuscript. We also thank Dr. Yingping Jiao for her help on bioinformatics analysis. This work was supported by grants from the Ministry of Science and Technology (2012AA10A305 and 2011CB944600) and the National Natural Science Foundation of China (31171563).
Author information
Authors and Affiliations
Corresponding author
Additional information
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
ZC carried out molecular, cytogenetic and bioinformatic studies and drafted the manuscript. HL performed the Quantitative ChIP-PCR, participated in the cytogenetic studies and provided helpful discussions. QH participated in the ChIP assay and provided helpful discussions. MP helped to maintain the experiment materials. JC prepared the sequencing library for ChIP-DNA. XL and JL helped to draft the manuscript and provided critical comments. WJ designed the experiment and revised the manuscript. All authors read and approved the final manuscript.
Zexi Cai, Huijun Liu contributed equally to this work.
Authors’ original submitted files for images
Below are the links to the authors’ original submitted files for images.
Rights and permissions
Open Access  This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made.
The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder.
To view a copy of this licence, visit https://creativecommons.org/licenses/by/4.0/.
The Creative Commons Public Domain Dedication waiver (https://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
About this article
Cite this article
Cai, Z., Liu, H., He, Q. et al. Differential genome evolution and speciation of Coix lacryma-jobi L. and Coix aquatica Roxb. hybrid guangxi revealed by repetitive sequence analysis and fine karyotyping. BMC Genomics 15, 1025 (2014). https://0-doi-org.brum.beds.ac.uk/10.1186/1471-2164-15-1025
Received:
Accepted:
Published:
DOI: https://0-doi-org.brum.beds.ac.uk/10.1186/1471-2164-15-1025