Skip to main content
Download PDF
  • Research article
  • Open access
  • Published:

ZLL/AGO10 maintains shoot meristem stem cells during Arabidopsis embryogenesis by down-regulating ARF2-mediated auxin response

BMC Biology volume 13, Article number: 74 (2015) Cite this article

Abstract

Background

The shoot meristem gives rise to new organs throughout a plant’s life by the activity of pluripotent stem cells in the meristem center. Organ initiation at the periphery of the shoot meristem is triggered by the accumulation of the phytohormone auxin at the initiation site. Loss-of-function mutants of the ZWILLE/ARGONAUTE10/PINHEAD (ZLL/AGO10/PNH) gene terminate shoot meristem stem cells late in embryogenesis and can form a leaf or a leaf-like structure instead, indicating that AGO10 activity is required to maintain shoot meristem stem cells undifferentiated.

Results

Here, we addressed whether stem cell maintenance by AGO10 involves regulation of auxin. We found that in zll-1 mutants, auxin accumulation and expression of the response reporter DR5:GFP are elevated, and transcription of the Auxin Response Factor 2 (ARF2) gene is upregulated. Downregulation of ARF2 significantly restores stem cells in zll-1 mutants, whereas increased expression of ARF2 enhances differentiation of stem cells in zll-1 mutants. We further found that upregulation of the AGO10 effector gene REVOLUTA restores ARF2 expression and stem cell maintenance in zll-1 embryos.

Conclusions

Our results indicate that maintenance of shoot meristem stem cells by AGO10 involves negative regulation of auxin signaling and, via REV-mediated downregulation of ARF2 expression, auxin response.

Background

All above-ground plant organs originate from the shoot apical meristem, which is established during embryogenesis [1, 2]. Within the shoot meristem, the central zone contains three layers of slowly dividing pluripotent stem cells, which respectively give rise to the epidermis, subepidermal cells, and internal tissues. Stem cell daughters enter differentiation pathways in the surrounding peripheral zone, where lateral organs are initiated, and in the underlying rib zone, where the pith of the shoot is formed [3].

Several key regulators of stem cell maintenance have been identified in the past, including a feedback loop between stem cells and underlying niche cells, named the organizing center [4]; regulation of cytokinin synthesis and response [5]; and localized expression of miRNAs [6]. The ARGONAUTE10 (AGO10) gene is required for stem cell maintenance during embryogenesis and for initiation of axillary meristems during postembryonic development. Loss of AGO10 function in the Landsberg erecta (Ler) accession results in stem cells differentiating into a flat apex, leaf-like structures, or normal-appearing leaves [7, 8]. Expression of the stem cell marker CLAVATA 3 (CLV3) is correctly initiated at the transition embryo stage of the zll-1 mutant, but is discontinued at the bent-cotyledon embryo stage [9, 10]. AGO10 encodes a member of the AGO protein family that binds small RNAs and acts as effectors of RNA interference in plants and animals [11, 12]. In contrast to canonical AGO proteins, however, binding of miR165/166 to AGO10 does not result in degradation of the target mRNAs, encoding HDZIP III transcription factors, but in their increase. Therefore, a function of AGO10 as a decoy AGO protein, which limits loading of miR165/166 onto AGO1 and thus reduces degradation of HDZIP III mRNAs, has been proposed [13].

One of the earliest events in organ initiation by the shoot meristem is the accumulation of auxin via directional cell-to-cell transport [14–16]. Auxin can trigger the degradation of AUX/IAA repressor proteins and consequently the activation of AUXIN RESPONSE FACTORS (ARFs) transcription factors [17, 18]. The Arabidopsis genome contains 23 ARFs [19], specific subsets of which regulate a multitude of developmental processes [20–23]. The stem cell-containing central domain of the meristem appears relatively insensitive to auxin [24] and displays increased mechanical stiffness; these factors have been suggested to limit organ formation [25].

The initiation of differentiated organs in the place of the stem cells in zll mutants raises the question whether AGO10 might negatively regulate auxin function. To address this question, we analyzed the interplay between AGO10 and auxin during embryogenesis. Our results show that AGO10 downregulates both auxin signaling and auxin response, including expression of ARF2. Downregulation of ARF2 levels in zll-1 embryos via an artificial miRNA (amiR) recovers stem cell maintenance. Furthermore, increased REV activity in zll-1 restores ARF2 repression and stem cell maintenance. Together, these results provide a framework of how AGO10 maintains shoot meristem stem cells by negatively regulating auxin signaling.

Results

Auxin signaling and response are increased in zll-1 embryos

To address whether auxin regulation might be altered in zll-1 mutants, we first monitored auxin response with the pDR5:nlsGFP reporter (Fig. 1, Additional file 1: Figure S1, Additional file 2: Table S1). In wild-type embryogenesis, pDR5:GFP expression was detected from the globular stage onwards at the root pole and additionally from the heart stage onwards in the tips and developing vasculature of the cotyledons. In zll-1 embryos, pDR5:GFP expression levels were increased in all regions where expression was found in wild type. Additional expression was detected in the vasculature of the embryo axis of early heart to torpedo stage embryos and in the epidermis of cotyledonary tips of transition to heart stage embryos.

Fig. 1
figure 1

Auxin response is enhanced in zll-1 mutant embryos. Upper two lanes show overlays of DR5:GFP signal and differential interference contrast images. Images were taken at the same settings. In the bottom two lanes, the corresponding heat maps of DR5:GFP expression are shown. Rainbow gradient from blue (no expression) to red (high expression) is used. Scale bars: 15 μm, except for bent-cotyledon stage, 30 μm. Genotypes and embryo stages are indicated

Full size image

To investigate what causes the increased DR5:GFP response in zll-1, we first monitored expression of the tandem auxin signaling sensor R2D2 [26], where the pRPS5a:DII-n3xVenus (DII-Venus) signal is inversely correlated to auxin signaling and where the pRPS5a:mDII-ntdTomato (mDII-ntdTomato) signal acts as transcription control. In addition, a pCLV3:er-CFP transgene was used to monitor shoot meristem stem cells.

In wild-type transition to torpedo stage embryos, expression of the pRPS5a:mDII-ntdTomato reporter was detectable in the cotyledons and at a lower level in the shoot apex and the basal part (Fig. 2). In bent-cotyledon stage embryos, the mDII-ntdTomato signal was close to background level in the majority of the analyzed embryos (Fig. 2 and Additional file 3: Table S2). This indicates that the pRPS5a driver is active in wild-type embryogenesis until the torpedo stage. Expression of the pRPS5a:DII-n3xVenus auxin signaling reporter was detectable in a similar pattern between the transition and the torpedo stages (Fig. 2 and Additional file 3: Table S2). As expected, no signal was detectable in bent-cotyledon stage embryos, where the driver is not active (Fig. 2).

Fig. 2
figure 2

Auxin signaling is elevated in zll-1 embryos. a Expression of the stem cell markers pCLV3:erCFP, pRPS5a:mDII-ntdTomato (ntdTomato), and pRPS5a:DII-n3xVenus (DII-Venus) in embryos at the indicated stages and genotypes. The erCFP signal was recorded with 1,000 ms exposure time, ntdTomato with 400 ms, and DII-Venus with 3,000 ms for all samples. The CFP signal is shown in blue, DII-Venus in yellow, and ntdTomato in red. Scale bars: 10 μm for transition to heart stages, 30 μm for torpedo and bent-cotyledon stages. b DII-Venus to ntdTomato signal ratios during embryogenesis. ***p <0.001; n.s. not significant

Full size image

In the zll-1 mutant, the expression of pRPS5a:mDII-ntdTomato did not show any detectable difference compared to wild type (Fig. 2), demonstrating that the pRPS5a driver works as in wild type. In contrast to wild type, however, the DII-Venus signal was not detectable in the majority of zll-1 embryos from transition to torpedo stages (Fig. 2 and Additional file 3: Table S2), indicating increased auxin signaling. We notice that this embryo-wide downregulation of the DII-Venus reporter in zll-1 embryos contrasted the localized upregulation of DR5:GFP expression (Fig. 1). This difference might be due to the reported higher sensitivity of DII-Venus compared to DR5 [27] and the different molecular requirements of the two auxin markers: DII-Venus relies on the presence of the TRANSPORT INHIBITOR RESPONSE1 (TIR1) F-box protein family and on the presence of auxin itself [28–30], and DR5 relies additionally on the presence of ARF transcription factors. One mechanistic interpretation of the different patterns of both reporters is that increased early signaling does not always result in ARF2-dependent transcriptional activities.

TIR1 and AUXIN SIGNALING F-BOX 1–3 (AFB1–3) auxin receptor mRNAs are targets of miR393 [31, 32], which has been found to preferentially bind to AGO1 [33] and thus could be sensitive to the levels of AGO10. Notably, we found that AFB1 mRNA levels were slightly increased compared to wild type in zll-1 torpedo stage embryos and TIR1 and AFB2 mRNA levels in zll-1 bent-cotyledon stage embryos (Fig. 3). Thus, the observed decrease in DII-Venus signal could be partially due to the increase of TIR/AFB expression.

Fig. 3
figure 3

Auxin biosynthesis and receptor gene expression is upregulated in zll-1 embryos. mRNA levels were determined by qRT-PCR of receptor genes (TIR1, AFB1–3) and biosynthesis genes (YUC1, YUC2) relative to the reference gene At4g26410 and standard deviations of three biological replicates are shown. Student’s t-test was used to calculate p-values. *p < 0.05, **p < 0.01

Full size image

In Arabidopsis, the main source of auxin is from tryptophan via two enzymatic steps, catalyzed by tryptophan amino transferases (TAA1, TAR1, and TAR2) [34, 35] and the YUCCA (YUC) family monooxygenases [36]. We found that the expression of YUC1 and YUC4 was weakly upregulated in the zll-1 mutant compared to wild type (Fig. 3), whereas TAA1 and TAR2 expression was not significantly changed (Additional file 4: Figure S2).

In summary, these results indicate that between transition and torpedo stages, zll-1 embryos display higher levels of auxin synthesis and signaling compared to wild type.

ARF2 levels in zll-1 mediate stem cell termination

We next asked whether increased auxin signaling might contribute to the shoot meristem defects in zll-1 mutants through ARF auxin effector genes. For an initial characterization we chose ARF2 as a TAS3-regulated ARF gene [37], and ARF6 as a miR167-regulated ARF gene [38], which are expressed during embryogenesis but not in the embryonic shoot apex [21]. Because no loss-of-function mutants were available in the Ler ecotype, we downregulated ARF2 and ARF6 mRNA levels via artificial miRNAs (amiR). Changing ARF6 expression had no effect on shoot meristem formation in wild type or in zll-1 (Additional files 5, 6, 7, and 8: Tables S3–S6) and was not further pursued.

Expression of p35S:amiR-ARF2 strongly reduced ARF2 mRNA levels detected by semi-quantitative reverse rranscriptase polymerase chain reaction (sqRT-PCR) in torpedo stage embryos (Fig. 4a), but did not have any effect on the shoot meristem development in wild type (not shown), in accordance with previous findings [23]. By contrast, in zll-1 bent-cotyledon stage embryos, p35S:amiR-ARF2 expression partially rescued stem cell maintenance as measured by the expression of the stem cell marker pCLV3:GFP-er (p < 0.001; Fig. 4b,c) and the presence of an active shoot meristem at the seedling stage (Additional file 9: Table S7).

Fig. 4
figure 4

Stem cell maintenance in zll-1 is restored by reduced ARF2 and increased REV levels. a sqRT-PCR shows that ARF2 transcript levels are strongly downregulated, whereas ARF3 and ARF4 transcripts are unchanged in two independent p35S:amiR-arf2 zll-1 lines compared to untransformed zll-1. b Expression of the shoot meristem stem cell marker pCLV3:GFP-er (green) is discontinued in zll-1 embryos at the bent-cotyledon stage, but recovered in zll-1 expressing p35S:amiR-arf2 and in zll-1 rev-10d double mutants. Scale bars: 20 μm. c Percentage of pCLV3:GFP-er expression levels in given genotypes during embryo development. n number of embryos analyzed. p-values were calculated by the Chi-square test: **p < 0.01, ***p < 0.001

Full size image

In the converse experiment, we upregulated ARF2 mRNA levels by expressing a TAS3-resistant pARF2:ARF2m transgene in order to avoid degradation of ARF2 mRNA via the TAS3 siRNA. In the zll-1 background, this resulted in a significant (p < 0.001) reduction of pCLV3:GFP-er expression in bent-cotyledon stage and mature embryos (Fig. 5a) and of shoot meristem maintenance (Fig. 5b, Additional file 10: Table S8). In addition, the severity of shoot meristem defects was enhanced (Fig. 5b, p < 0.001). By contrast, pARF2:ARF2m expression did not cause any obvious phenotypic change in the shoot apical meristem when expressed in the wild type (Fig. 5b). This suggests that ARF2 levels are not a limiting factor in shoot meristem maintenance in wild type, but are in zll-1, consistent with the increased auxin accumulation in zll-1.

Fig. 5
figure 5

zll-1 stem cell defects are enhanced by increased ARF2 levels. a pCLV3:GFP-er expression is decreased in zll-1 pARF2:mARF2 bent-cotyledon and mature embryos compared to zll-1. b The severity of shoot meristem defects is enhanced in 14-day-old seedling of zll-1 pARF2:mARF2 compared to zll-1. Genotypes and embryo stages are indicated. The Chi-square test was used to calculate p-values. ***p < 0.001; n number of analyzed embryos. Shoot meristem defects: empty apex differentiated stem cell, no organ formation; pin single filamentous structure; 1 L one central leaf; 2 L termination into two leaves; wt wild-type-like

Full size image

Together these results suggest that downregulation of ARF2 expression is required for shoot meristem stem cell maintenance during embryogenesis by AGO10 activity.

REVOLUTA mediates downregulation of ARF2 expression by AGO10

One possible reason why reduction of ARF2 activity suppresses shoot meristem termination in zll-1 embryos is that AGO10 negatively regulates ARF2 expression levels. Indeed, we found by qRT-PCR that ARF2 mRNA levels were 3–4-fold increased in zll-1 torpedo stage embryos compared to wild type, whereas ARF3 and ARF4 levels were not affected (p < 0.001; Fig. 6a, Additional file 11: Figure S3).

Fig. 6
figure 6

ARF2 expression is negatively regulated by AGO10 and REV. Quantitative real-time polymerase chain reaction experiments of three independent biological replicates with standard deviation. a ARF2 expression levels in torpedo stage embryos of the indicated genotypes relative to wild-type levels. b pARF2:ntdTomato expression (red) is upregulated in zll-1 heart to bent-cotyledon stage embryos compared to wild type (Ler) and this upregulation is suppressed by the rev-10d mutation. Scale bars: 15 μm for heart and torpedo stage embryos and 30 μm for bent-cotyledon stage embryos. c ARF2 expression levels in 5-day-old shoot apical meristems of the indicated genotypes and treatments. Bars represent the fold changes of ARF2 in response to dexamethasone relative to mock treatment and in response to dexamethasone (DEX) + cycloheximide (CH) relative to CH-control in wild type (Col) and the DEX-inducible 35S::GR-REVd line (GR-REV), respectively. Genotypes and treatments are indicated. Transcription levels are normalized to the reference gene At4g26410. Significance tested by Student’s t-test is indicated. *p < 0.05, **p < 0.01, ***p < 0.001; n.s. not significant

Full size image

Next we analyzed expression of the transcriptional reporter pARF2:nlstd-Tomato (pARF2:ntdTomato) during embryogenesis. In wild type, pARF2:ntdTomato was hardly detectable from heart to torpedo stages and was detected throughout the embryo at the bent-cotyledon stage (Fig. 6b, Additional file 12: Figure S4). By contrast, in zll-1 heart to bent-cotyledon stage embryos, pARF2:ntdTomato was uniformly expressed at higher levels compared to wild type (Fig. 6b, Additional file 12: Figure S4). We note that this expression pattern differs from the one reported in the Columbia accession [21], which could be due to different ARF2 expression levels in the Ler accession used in our experiments.

In summary, these data indicate that AGO10 is required to downregulate ARF2 transcription from heart to torpedo stages throughout the embryo.

AGO10 prevents accumulation of miR165/166 in the embryonic shoot meristem and thus promotes expression of their target HD-ZIP III genes [13]. We therefore asked whether HD-ZIP III activity might mediate repression of ARF2 transcription via AGO10. To this end we introgressed the miR-resistant rev-10d mutation [39], which as a single mutant does not display any shoot meristem defect (not shown), into the zll-1 mutant. This resulted in a significant rescue of shoot meristem formation in zll-1 embryos (p < 0.001; Additional file 13: Figure S5A), including the expression of the stem cell marker pCLV3:GFP-er (p < 0.001; Fig. 4b, Additional file 13: Figure S5B).

qRT-PCR studies demonstrated that the rev-10d mutation largely suppressed the upregulation of ARF2 mRNA levels in the zll-1 mutant (Fig. 6a, p < 0.001), and that inducible p35S:GR-REVd activity repressed ARF2 expression (Fig. 6c, p < 0.01). Addition of cycloheximide abolished the effect of REV on ARF2 mRNA (Fig. 6c), indicating that it is indirect. Likewise, rev-10d suppressed the expression levels of the ARF2 transcriptional reporter in zll-1 embryos (Additional file 12: Figure S4).

Taken together, this indicates that AGO10 represses ARF2 transcription in the embryonic shoot meristem through REV activity.

Discussion

During embryonic shoot meristem formation, the two basic functions of the meristem need to be established in spatially separated domains: stem cell maintenance in the meristem center, and organ initiation in the periphery [3, 40]. Several mutants of shoot meristem development result in an inactive stem cell pool, resulting in a terminated apex without the initiation of an organ [41–43]. By contrast, zll mutant embryos frequently form a leaf structure in place of the stem cell pool in the meristem center [8, 44]. This defect first becomes visible at the bent-cotyledon embryo stage when zll-1 embryos are unable to maintain expression of the shoot meristem stem cell marker CLV3 [10]. In this study, we have addressed the underlying mechanisms of this phenotype and analyzed the role of auxin and AGO10 interaction in stem cell maintenance.

AGO10 negatively regulates auxin signaling and response during embryogenesis

Our results provide several lines of evidence that increased auxin function in zll-1 contributes to the failure to maintain shoot meristem stem cells in the embryo, as detected by the loss of CLV3 expression and the ectopic organ formation in place of the stem cells. First, the perception capacities and auxin levels were elevated in the zll-1 mutant throughout the embryo. Second, reduction of ARF2 levels partially suppressed stem cell termination in zll-1, whereas increased ARF2 levels increased stem cell defects.

In protoplast transfection assays, ARF2 acts as transcriptional repressor of DR5:GUS [45], which would suggest that upregulation of DR5:GFP in zll-1 is not a direct response of elevated ARF2 levels and therefore other factors are probably involved. We consistently found that, in addition to ARF2, other components of auxin response, such as TIR1/AFB and YUC genes, were upregulated in zll-1 mutants, albeit at weaker levels.

How is the upregulation of ARF2 accomplished? Previous studies showed that AGO10 promotes expression of the transcription factor REV by blocking degradation of its mRNA via miR165/166 [13]. Our results show that, in turn, REV mediates downregulation of ARF2 by AGO10, because increased REV levels in the zll-1 mutant reduced ARF2 expression and suppressed stem cell defects in the zll-1 mutant. It is likely that ARF2 repression by REV is not direct, because repression did not take place when protein synthesis was blocked. Consistent with this notion, REV was not found to bind to ARF2 in a genome-wide map of REV binding sites [46]. Curiously, a previous study showed that overexpression of REV in seedlings directly activates expression of auxin biosynthesis genes of the tryptophan-dependent indole-3-pyruvic acid biosynthetic pathway, TAA1 and YUC5 [46]. In our studies, however, we found that YUC1 and YUC4 levels and possibly auxin accumulation were upregulated in zll-1 embryos, suggesting that AGO10 affects auxin synthesis by a mechanism independent of REV, or that REV acts differentially on auxin synthesis during embryo and seedling development.

These findings indicate that AGO10 is required to reduce auxin activity in the embryo and that this process is essential for maintaining shoot meristem stem cells [14, 47].

Genetic interaction studies and expression experiments indicate that AGO10 is required to potentiate WUS-mediated maintenance of CLV3 expression in the embryonic shoot meristem stem cells [10]. In contrast to WUS, which is confined to the developing shoot meristem region, AGO10 is expressed in a broader pattern, including the shoot meristem and the pro-vasculature [10]. However, localized expression of AGO10 in the vasculature is sufficient for shoot meristem development, suggesting that AGO10 can act non-cell autonomously. Consistent with the broad AGO10 expression pattern in embryos, we found enhanced auxin signaling and response and increased ARF expression throughout the zll-1 embryo. Because organ initiation in the shoot meristem requires the accumulation of auxin at the initiation site through directional transport from surrounding tissues [48], one interesting question to be answered in the future is whether stem cell loss in zll-1 embryos is the consequence of enhanced auxin activity inside or outside the shoot meristem.

Conclusion

In this study, we show that the ARGONAUTE family member AGO10 negatively regulates auxin signaling during embryogenesis. Consequently, the conversion of stem cells into an ectopic leaf-like organ in the zll-1 mutant appears to be due to upregulated auxin activity involving increased transcription of the auxin response factor ARF2.

Methods

Arabidopsis plants were grown as described previously [10]. The shoot apical meristem of Ler, zll-1, and transgenic lines was analyzed 14 days after germination. Plant transformation was done by the Agrobacterium-mediated floral dipping method [49].

Wild-type and 35S::GR-REVd seedlings were grown on Murashige and Skoog medium plates in long-day conditions at 22 °C for 4 days. Induction of GR-REVd was done as described previously [50].

Constructs

Primers for three artificial miRNAs of ARF2 were designed using the WDM3 online software and amiRNAs were amplified as described previously [51]. Specificity of amiR sequences for ARF2 was confirmed using BlastN. The artificial miRNAs were subcloned into the BamHI site of the pEG287 vector. The amiR-ARF2 with a 35S promoter upstream and a Nos-Terminator downstream were cloned in HindIII/EcoRI sites of a pGreenII binary vector. The promoter of ARF2 was amplified using forward primer 5′-ACTAACTTGATGAATGAAAGAGTCGCAGCG-3′ and reverse primer 5′-ACTAAGCTTACCTTCCGAAGCTCAGATCTGTTTC-3′, and cloned into the HindIII restriction site of a modified pGreenII vector containing a ligation-independent cloning (LIC) tail [52]. The ARF2 coding region was amplified using forward primer 5′-TAGTTGGAATAGGATTTCGTAGGATCCATGGCGAGTTCGGAGGTTTC-3′ and reverse primer 5′-AGTATGGAGTTGGATTTCGTTGGATCCTTAAGAGTTCCCAGCGCTG-3′, containing LIC tails.

The amplified ARF2 coding region containing LIC tails was cloned into a modified pGreenII vector containing a LIC tail as described previously [52]. To generate a TAS3-resistant ARF2 version, the ARF2 coding region was cloned into a pJet2.1 vector and mutated using the Stratagene site directed mutagenesis kit (cat. no. 200518, Stratagene, La Jolla, CA, USA) with forward primer 5′-GCAAGCGGACTTTCAAGGGTGCTCCAGGGACAGGAGTACTCGACCTTGAGGACGAAAC-3′ and reverse primer: 5′-GTTTCGTCCTCAAGGTCGAGTACTCCT GTCCCTGGAGCACCCTTGAAAGTCCGCTTGC-3′. The ARF2 transcription marker sequence was amplified with forward primer 5′-TAGTTGGAATAGGATTTCGTAGGATCCATGGCGAGTTCGGAGGTTTC-3′ and reverse primer 5′-AGTATGGAGTTGGATTTCGTTGGATCCTTAAGAGTTCCCAGCGCTG-3′, and subcloned into a modified pGreenII vector containing a LIC tail containing the ARF2 promoter.

Microscopy

Embryos were dissected from maternal tissues and mounted in 10 % glycerol. They were analyzed with a Zeiss AxioImager. A1 microscope (Carl Zeiss Microscopy, Jena, Germany) or a Zeiss LSM 700 confocal laser scanning microscope (Carl Zeiss MircoImaging GmbH, Göttingen, Germany). The images were processed using Adobe Photoshop Elements 2.0.

The integrated signal intensity of each embryo was measured in a median plane and calculated using the ROI tool of Image J software. Analysis of the measured data and drawing of bar plots were done using Microsoft Excel software.

Semi-quantitative PCR of ARF2, ARF3, and ARF4

To measure the efficiency of amiR-ARF2, RNA of zll-1 and zll-1amiR-ARF2 lines was extracted using a Qiagen RNeasy kit (Qiagen, Hilden, Germany). cDNA amplification was done with the Qiagen cDNA synthesis kit. Amplification of cDNA sequences were performed using forward primer 5′-TTCGATGCTTACCAGAGAAGGT-3′ and reverse primer 5′-TTGAGTCTGTCCCATTCATGTTG-3′ for ARF2; forward primer 5′- GATTCCAGAGGGTCTTGCAAGGTCAAGAAATTTTTCC −3′ and reverse primer 5′- CAACGCAGGGGACAGCCGTC-3′ for ARF3; and forward primer 5′-TCCCTCGGTTTCTCTCCCACACT-3′ and reverse primer 5′-AGCAAATTTCTTGACCTTGCAAGACCCTTGGAAACC-3′ for ARF4. As reference, ACT7 (At5g09810) was amplified with forward primer 5′-GGTGAGGATATTCAGCCACTTGTCTG-3′ and reverse primer 5′-TGTGAGATCCCGACCCGCAAGATC-3′ [53].

Quantitative PCR

Torpedo stage embryos were dissected out of the ovule, and RNA was extracted using the Qiagen RNeasy kit. cDNA was generated using the Invitrogen SuperScript III first-strand synthesis system for qPCR (cat. no. 11752–050; Life Technologies, Carlsbad, U.S.A).

qRT-PCRs were done using the Roche LightCycler 480 SYBR Green I kit (Cat. No. 04707516001; Roche Diagnostics GmbH, Mannhein, Germany), with forward primer 5′-TGCTGGTCCGCTTGTGACGG-3′ and reverse primer 5′-TGCCGCCTGGTTCGTCGAAG-3′ of ARF2; forward primer 5′-CACGGAGGTTCAGGCAGATGCA −3′ and reverse primer 5′-CAACGCAGGGGACAGCCGTC-3′ of ARF3; forward primer 5′-TCCCTCGGTTTCTCTCCCACACT-3′ and reverse primer 5′-ATGGGGTTTCCGGGTGGGGT-3′ of ARF4; forward primer 5′-CGAATATAACGCATATAACGCC-3′ and reverse primer 5′-CCATAAACATAGAGAGAGAGAGGTTC-3′ for TAA1; forward primer 5′-GCTCTTCACTGCTTCAAAGAGCAC-3′ and reverse primer 5′-TCTGTCTTTCACCAAAGCCCATCC-3′ for TAR2; forwards primer 5′-GAGAGACGAAATCAAGGGGT-3′ and reverse primer 5′-GAGGTAAAGACAAAACGAGAACTG-3′ for YUC1; and forward primer 5′-ATGGGCACTTGTAGAGAATCAG-3′ and reverse primer 5′-CGGACCAGGAACGAAGAT-3′ for YUC4. For TIR1, we used forwards primer 5′- TGAGGAAACTAGAGATAAGGGACTGC-3′ and reverse primer 5′- CACGGAACAAGAAGACATCCAAAGG-3′ for AFB1; forwards primer 5′-ACTTGTTGTCGGGCTGTGAGAG-3′ and reverse primer 5′-CTCTGGAGGATGTTCATCAATGACTTC-3′ for AFB2; forwards primer 5′-CAAGTATGAAACAATGCGATCCCTTTG-3′ and reverse primer 5′-TTCTTCCATCCGGTTATTATCATTCTCG-3′ for AFB3; and forwards primer 5′-AAGGAATGCTCTATGTGTTGAATGGATG-3′ and reverse primer 5′-AACCTTCTCTCTTTCATCTTCTTCATTCTG-3′. At4g26410 [54] was used as a reference gene, and amplified with forward primer 5′-GAGCTGAAGTGGCTTCCATGAC-3′ and reverse primer 5′-GGTCCGACATACCCATGATCC-3′.

Abbreviations

AFB1–3:

AUXIN SIGNALING F-BOX1 auxin receptor 1–3

AGO10:

ARGONAUTE 10

amiR:

artificial miRNA

ARF2:

AUXIN RESPONSE FACTOR 2

ARF2m:

mutated ARF2

CLV3:

CLAVATA 3

GFP:

green fluorescent protein

Ler :

Landsberg erecta

qRT-PCR:

quantitative reverse transcriptase polymerase chain reaction

REV:

REVOLUTA

TAA1:

TRYPTOPHAN AMINOTRANSFERASE OF ARABIDOPSIS 1

TAR1/2:

TRYPTOPHAN AMINOTRANSFERASE RELATED 1/2

TIR1:

TRANSPORT INHIBITOR RESPONSE1

YUC1–4:

YUCCA 1–4

ZLL:

ZWILLE

References

  1. Aichinger E, Kornet N, Friedrich T, Laux T. Plant stem cell niches. Annu Rev Plant Biol. 2012;63:615–36.

    Article  CAS  PubMed  Google Scholar 

  2. Barton MK, Poethig RS. Formation of the shoot apical meristem in Arabidopsis thaliana: an analysis of development in the wild type and in the shoot meristemless mutant. Development. 1993;119:823–31.

    Google Scholar 

  3. Bäurle I, Laux T. Apical meristems: the plant’s fountain of youth. Bioessays. 2003;25:961–70.

    Article  PubMed  Google Scholar 

  4. Schoof H, Lenhard M, Haecker A, Mayer KF, Jurgens G, Laux T. The stem cell population of Arabidopsis shoot meristems in maintained by a regulatory loop between the CLAVATA and WUSCHEL genes. Cell. 2000;100:635–44.

    Article  CAS  PubMed  Google Scholar 

  5. Hwang I, Sheen J, Muller B. Cytokinin signaling networks. Annu Rev Plant Biol. 2012;63:353–80.

    Article  CAS  PubMed  Google Scholar 

  6. Knauer S, Holt AL, Rubio-Somoza I, Tucker EJ, Hinze A, Pisch M, et al. A protodermal miR394 signal defines a region of stem cell competence in the Arabidopsis shoot meristem. Dev Cell. 2013;24:125–32.

    Article  CAS  PubMed  Google Scholar 

  7. Moussian B, Schoof H, Haecker A, Jurgens G, Laux T. Role of the ZWILLE gene in the regulation of central shoot meristem cell fate during Arabidopsis embryogenesis. EMBO J. 1998;17:1799–809.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  8. McConnell JR, Barton MK. Effects of mutations in the PINHEAD gene of Arabidopsis on the formation of shoot apical meristems. Dev Genet. 1995;16:358–66.

    Article  Google Scholar 

  9. Vaucheret H. Plant ARGONAUTES. Trends Plant Sci. 2008;13:350–8.

    Article  CAS  PubMed  Google Scholar 

  10. Tucker MR, Hinze A, Tucker EJ, Takada S, Jurgens G, Laux T. Vascular signalling mediated by ZWILLE potentiates WUSCHEL function during shoot meristem stem cell development in the Arabidopsis embryo. Development. 2008;135:2839–43.

    Article  CAS  PubMed  Google Scholar 

  11. Mallory AC, Elmayan T, Vaucheret H. MicroRNA maturation and action--the expanding roles of ARGONAUTEs. Curr Opin Plant Biol. 2008;11:560–6.

    Article  CAS  PubMed  Google Scholar 

  12. Mallory AC, Hinze A, Tucker MR, Bouche N, Gasciolli V, Elmayan T, et al. Redundant and specific roles of the ARGONAUTE proteins AGO1 and ZLL in development and small RNA-directed gene silencing. PLoS Genet. 2009;5:e1000646.

    Article  PubMed Central  PubMed  Google Scholar 

  13. Zhu H, Hu F, Wang R, Zhou X, Sze SH, Liou LW, et al. Arabidopsis Argonaute10 specifically sequesters miR166/165 to regulate shoot apical meristem development. Cell. 2011;145:242–56.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  14. Heisler MG, Ohno C, Das P, Sieber P, Reddy GV, Long JA, et al. Patterns of auxin transport and gene expression during primordium development revealed by live imaging of the Arabidopsis inflorescence meristem. Curr Biol. 2005;15:1899–911.

    Article  CAS  PubMed  Google Scholar 

  15. Zhao Z, Andersen SU, Ljung K, Dolezal K, Miotk A, Schultheiss SJ, et al. Hormonal control of the shoot stem-cell niche. Nature. 2010;465:1089–92.

    Article  CAS  PubMed  Google Scholar 

  16. Benkova E, Michniewicz M, Sauer M, Teichmann T, Seifertova D, Jürgens G, et al. Local, efflux-dependent auxin gradients as a common module for plant organ formation. Cell. 2003;115:591–602.

    Article  CAS  PubMed  Google Scholar 

  17. Gray WM, Estelle I. Function of the ubiquitin-proteasome pathway in auxin response. Trends Biochem Sci. 2000;25:133–8.

    Article  CAS  PubMed  Google Scholar 

  18. Gray WM, Kepinski S, Rouse D, Leyser O, Estelle M. Auxin regulates SCF(TIR1)-dependent degradation of AUX/IAA proteins. Nature. 2001;414:271–6.

    Article  CAS  PubMed  Google Scholar 

  19. Guilfoyle TJ, Hagen G. Auxin response factors. Curr Opin Plant Biol. 2007;10:453–60.

    Article  CAS  PubMed  Google Scholar 

  20. Lim PO, Lee IC, Kim J, Kim HJ, Ryu JS, Woo HR, et al. Auxin response factor 2 (ARF2) plays a major role in regulating auxin-mediated leaf longevity. J Exp Bot. 2010;61:1419–30.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  21. Rademacher EH, Moller B, Lokerse AS, Llavata-Peris CI, van den Berg W, Weijers D. A cellular expression map of the Arabidopsis AUXIN RESPONSE FACTOR gene family. Plant J. 2011;68:597–606.

    Article  CAS  PubMed  Google Scholar 

  22. Okushima Y, Mitina I, Quach HL, Theologis A. AUXIN RESPONSE FACTOR 2 (ARF2): a pleiotropic developmental regulator. Plant J. 2005;43:29–46.

    Article  CAS  PubMed  Google Scholar 

  23. Ellis CM, Nagpal P, Young JC, Hagen G, Guilfoyle TJ, Reed JW. AUXIN RESPONSE FACTOR1 and AUXIN RESPONSE FACTOR2 regulate senescence and floral organ abscission in Arabidopsis thaliana. Development. 2005;132:4563–74.

    Article  CAS  PubMed  Google Scholar 

  24. de Reuille PB, Bohn-Courseau I, Ljung K, Morin H, Carraro N, Godin C, et al. Computer simulations reveal properties of the cell-cell signaling network at the shoot apex in Arabidopsis. Proc Natl Acad Sci U S A. 2006;103:1627–32.

    Article  PubMed Central  PubMed  Google Scholar 

  25. Kierzkowski D, Nakayama N, Routier-Kierzkowska AL, Weber A, Bayer E, Schorderet M, et al. Elastic domains regulate growth and organogenesis in the plant shoot apical meristem. Science. 2012;335:1096–9.

    Article  CAS  PubMed  Google Scholar 

  26. Liao CY, Smet W, Brunoud G, Yoshida S, Vernoux T, Weijers D. Reporters for sensitive and quantitative measurement of auxin response. Nat Methods. 2015;12:207–10.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  27. Brunoud G, Wells DM, Oliva M, Larrieu A, Mirabet V, Burrow AH, et al. A novel sensor to map auxin response and distribution at high spatio-temporal resolution. Nature. 2012;482:103–6.

    Article  CAS  PubMed  Google Scholar 

  28. Kepinski S, Leyser O. The Arabidopsis F-box protein TIR1 is an auxin receptor. Nature. 2005;435:446–51.

    Article  CAS  PubMed  Google Scholar 

  29. Dharmasiri N, Dharmasiri S, Estelle M. The F-box protein TIR1 is an auxin receptor. Nature. 2005;435:441–5.

    Article  CAS  PubMed  Google Scholar 

  30. Dharmasiri N, Dharmasiri S, Weijers D, Lechner E, Yamada M, Hobbie L, et al. Plant development is regulated by a family of auxin receptor F box proteins. Dev Cell. 2005;9:109–19.

    Article  CAS  PubMed  Google Scholar 

  31. Si-Ammour A, Windels D, Arn-Bouldoires E, Kutter C, Ailhas J, Meins Jr F, et al. miR393 and secondary siRNAs regulate expression of the TIR1/AFB2 auxin receptor clade and auxin-related development of Arabidopsis leaves. Plant Physiol. 2011;157:683–91.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  32. Navarro L, Dunoyer P, Jay F, Arnold B, Dharmasiri N, Estelle M, et al. A plant miRNA contributes to antibacterial resistance by repressing auxin signaling. Science. 2006;312:436–9.

    Article  CAS  PubMed  Google Scholar 

  33. Mi S, Cai T, Hu Y, Chen Y, Hodges E, Ni F, et al. Sorting of small RNAs into Arabidopsis argonaute complexes is directed by the 5′ terminal nucleotide. Cell. 2008;133:116–27.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  34. Mashiguchi K, Tanaka K, Sakai T, Sugawara S, Kawaide H, Natsume M, et al. The main auxin biosynthesis pathway in Arabidopsis. Proc Natl Acad Sci U S A. 2011;108:18512–7.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  35. Stepanova AN, Robertson-Hoyt J, Yun J, Benavente LM, Xie DY, Dolezal K, et al. TAA1-mediated auxin biosynthesis is essential for hormone crosstalk and plant development. Cell. 2008;133:177–91.

    Article  CAS  PubMed  Google Scholar 

  36. Cheng Y, Dai X, Zhao Y. Auxin synthesized by the YUCCA flavin monooxygenases is essential for embryogenesis and leaf formation in Arabidopsis. Plant Cell. 2007;19:2430–9.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  37. Williams L, Carles CC, Osmont KS, Fletcher JC. A database analysis method identifies an endogenous trans-acting short-interfering RNA that targets the Arabidopsis ARF2, ARF3, and ARF4 genes. Proc Natl Acad Sci U S A. 2005;102:9703–8.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  38. Wu MF, Tian Q, Reed JW. Arabidopsis microRNA167 controls patterns of ARF6 and ARF8 expression, and regulates both female and male reproduction. Development. 2006;133:4211–8.

    Article  CAS  PubMed  Google Scholar 

  39. Emery JF, Floyd SK, Alvarez J, Eshed Y, Hawker NP, Izhaki A, et al. Radial patterning of Arabidopsis shoots by class III HD-ZIP and KANADI genes. Curr Biol. 2003;13:1768–74.

    Article  CAS  PubMed  Google Scholar 

  40. Tucker MR, Laux T. Connecting the paths in plant stem cell regulation. Trends Cell Biol. 2007;17:403–10.

    Article  CAS  PubMed  Google Scholar 

  41. Laux T, Mayer KF, Berger J, Jurgens G. The WUSCHEL gene is required for shoot and floral meristem integrity in Arabidopsis. Development. 1996;122:87–96.

    CAS  PubMed  Google Scholar 

  42. Wurschum T, Gross-Hardt R, Laux T. APETALA2 regulates the stem cell niche in the arabidopsis shoot meristem. Plant Cell. 2006;18:295–307.

    Article  PubMed Central  PubMed  Google Scholar 

  43. Long JA, Moan EI, Medford JI, Barton MK. A member of the KNOTTED class of homeodomain proteins encoded by the STM gene of Arabidopsis. Nature. 1996;379:66–9.

    Article  CAS  PubMed  Google Scholar 

  44. Moussian B, Haecker A, Laux T. ZWILLE buffers meristem stability in Arabidopsis thaliana. Dev Genes Evol. 2003;213:534–40.

    Article  CAS  PubMed  Google Scholar 

  45. Tiwari SB, Hagen G, Guilfoyle T. The roles of auxin response factor domains in auxin-responsive transcription. Plant Cell. 2003;15:533–43.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  46. Brandt R, Salla-Martret M, Bou-Torrent J, Musielak T, Stahl M, Lanz C, et al. Genome-wide binding-site analysis of REVOLUTA reveals a link between leaf patterning and light-mediated growth responses. Plant J. 2012;72:31–42.

    Article  CAS  PubMed  Google Scholar 

  47. Yadav RK, Tavakkoli M, Reddy GV. WUSCHEL mediates stem cell homeostasis by regulating stem cell number and patterns of cell division and differentiation of stem cell progenitors. Development. 2010;137:3581–9.

    Article  CAS  PubMed  Google Scholar 

  48. Vernoux T, Besnard F, Traas J. Auxin at the shoot apical meristem. Cold Spring Harb Perspect Biol. 2010;2:a001487.

    Article  PubMed Central  PubMed  Google Scholar 

  49. Clough SJ, Bent AF. Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 1998;16:735–43.

    Article  CAS  PubMed  Google Scholar 

  50. Wenkel S, Emery J, Hou BH, Evans MM, Barton MK. A feedback regulatory module formed by LITTLE ZIPPER and HD-ZIPIII genes. Plant Cell. 2007;19:3379–90.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  51. Schwab R, Ossowski S, Riester M, Warthmann N, Weigel D. Highly specific gene silencing by artificial microRNAs in Arabidopsis. Plant Cell. 2006;18:1121–33.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  52. Aslanidis C, de Jong PJ. Ligation-independent cloning of PCR products (LIC-PCR). Nucleic Acids Res. 1990;18:6069–74.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  53. Hardtke CS, Ckurshumova W, Vidaurre DP, Singh SA, Stamatiou G, Tiwari SB, et al. Overlapping and non-redundant functions of the Arabidopsis auxin response factors MONOPTEROS and NONPHOTOTROPIC HYPOCOTYL 4. Development. 2004;131:1089–100.

    Article  CAS  PubMed  Google Scholar 

  54. Czechowski T, Stitt M, Altmann T, Udvardi MK, Scheible WR. Genome-wide identification and testing of superior reference genes for transcript normalization in Arabidopsis. Plant Physiol. 2005;139:5–17.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

Download references

Acknowledgements

We thank Edwin Groot for proofreading the manuscript. We gratefully acknowledge funding by the Deutsche Forschungsgemeinschaft (individual grants and ERA-CAP), and co-funding by the EU through the INTERREG IV Upper Rhine Project 692 A17 to TL.

Author information

Authors and Affiliations

  1. BIOSS Centre for Biological Signaling Studies, Faculty of Biology, Albert-Ludwigs-Universität, 79104, Freiburg, Germany

    Farshad Roodbarkelari, Fei Du, Elisabeth Truernit & Thomas Laux

  2. Present address: ETH Zürich LFW E 51, Universitätstr. 2, 8092, Zürich, Switzerland

    Elisabeth Truernit

Authors
  1. Farshad Roodbarkelari
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Fei Du
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Elisabeth Truernit
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Thomas Laux
    View author publications

    You can also search for this author in PubMed Google Scholar

Corresponding author

Correspondence to Thomas Laux.

Additional information

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

FR performed all experiments, ET prepared the pDR5:GFP lines in zll-1 and Ler backgrounds, FD prepared the amiRNA constructs and TL supervised the project. All authors read and approved the final manuscript.

Additional files

Additional file 1: Figure S1.

DR5:GFP signal is upregulated in zll-1 embryos. Integrated fluorescence intensity of DR5:GFP signal of whole embryos at the indicated stages. n numbers of embryos analyzed, n.s. not significant; ***p < 0.001. (PPT 107 kb)

Additional file 2: Table S1.

Increased auxin response in the zll-1 mutant. (DOC 51 kb)

Additional file 3: Table S2.

DII-Venus levels are reduced in zll-1 mutants. (DOC 65 kb)

Additional file 4: Figure S2.

Transcript levels of auxin biosynthesis genes TAA1 and TAR2. TAA1 (A) and TAR2 (B) transcript levels are not significantly altered between zll-1 and Ler wild-type embryos. qRT-PCR transcript levels relative to reference gene At4g26410 and standard deviation of three biological replicates are shown. Student’s t-test was used to calculate p-values. (PPT 112 kb)

Additional file 5: Table S3.

Increased ARF6 expression does not affect shoot apical meristem development in zll-1. (DOC 43 kb)

Additional file 6: Table S4.

Increased ARF6 expression does not affect shoot apical meristem development of wild type. (DOC 43 kb)

Additional file 7: Table S5.

Reduction of ARF6 expression does not affect zll-1 shoot apical meristem development. (DOC 52 kb)

Additional file 8: Table S6.

Reduced ARF6 expression does not affect shoot apical meristem development in wild-type background. (DOC 53 kb)

Additional file 9: Table S7.

Reduced ARF2 expression partially suppresses zll-1 shoot apical meristem defects. (DOC 42 kb)

Additional file 10: Table S8.

Increased ARF2 expression enhances the frequency of shoot meristem termination in zll-1. (DOC 48 kb)

Additional file 11: Figure S3.

Expression of ARF2 but not ARF3 and ARF4 is negatively regulated by AGO10 and REV. ARF mRNA levels in torpedo stage embryos of the indicated genotypes relative to wild type. Transcription levels are normalized to the reference gene At4g26410. Significance tested by Student’s t-test is indicated. **p < 0.01, ***p < 0.001. All other comparisons did not show a significant difference. (PPT 123 kb)

Additional file 12: Figure S4.

Upregulation of pARF2:ntdTomato expression in zll-1 embryo is suppressed by rev-10d. Percentages of pARF2:ntdTomato signal strength in zll-1 embryos of the indicated genotypes are shown. Chi-square test was used to calculate p-values. **p < 0.01, ***p < 0.001. n number of analyzed embryos. (PPT 120 kb)

Additional file 13: Figure S5.

Shoot meristem development is partially restored in zll-1 by rev10-d. (A) The severity of shoot meristem defects in zll-1 is alleviated by the gain-of-function mutation rev-10d. (B) Decreased pCLV3:GFP-er expression levels in zll-1 bent-cotyledon and mature embryos are partially suppressed by rev-10d. Genotypes and embryo stages are indicated. Chi-square test was used to calculate p-values. ***p < 0.001. n number of analyzed embryos. Shoot meristem defects: empty apex differentiated stem cell, no organ formation; pin single filamentous structure; 1 L one central leaf; 2 L termination into two leaves; wt wild-type-like. (PPT 162 kb)

Rights and permissions

Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Roodbarkelari, F., Du, F., Truernit, E. et al. ZLL/AGO10 maintains shoot meristem stem cells during Arabidopsis embryogenesis by down-regulating ARF2-mediated auxin response. BMC Biol 13, 74 (2015). https://0-doi-org.brum.beds.ac.uk/10.1186/s12915-015-0180-y

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://0-doi-org.brum.beds.ac.uk/10.1186/s12915-015-0180-y

Keywords

BMC Biology

ISSN: 1741-7007

Contact us