- Research note
- Open access
- Published:
Retrofitting the BAC cloning vector pBeloBAC11 by the insertion of a mutant loxP site
BMC Research Notes volume 10, Article number: 344 (2017)
Abstract
Objective
Human genomic libraries constructed in bacterial artificial chromosome vectors were utilized to make physical maps of all 23-chromosome pairs and as the templates for DNA sequencing to aid in the completion of the Human Genome Project. The goal of this study was to modify the BAC vector pBeloBAC11 so that genomic inserts contained in this vector could be subjected to bidirectional transposon-mediated nested deletions from the wild-type and mutant loxP sites present.
Results
An oligonucleotide containing a mutant loxP 2272 site and a XhoI restriction enzyme sequence was designed and inserted at the SfiI restriction site located approximately 200 basepairs upstream of the lacZ gene in pBeloBAC11. Clones containing the desired insert were identified by XhoI restriction digests since an additional band was generated. This transposon-mediated deletion technology allows researchers to identify the boundaries of cis-acting elements and genes.
Introduction
Bacterial artificial chromosome (BAC) and P1 artificial chromosome (PAC) vectors were used to generate human genomic libraries for the Human Genome Project (HGP) since they could accommodate inserts up to 300 kilobases (kb) and did not generate chimeric clones [1, 2]. Since the PAC vectors were derived from the plasmid pAd10sacBII, they all contained a loxP site that is part of the bacteriophage P1 genome [3, 4].
A mini-Tn10 transposon plasmid containing a loxP site was developed to retrofit P1 clones to generate nested deletions [5]. We then used this technology to demonstrate that large nested deletions could be generated in both PAC and BAC clones [6]. A study by Lee and Saito [7] investigated the role that each nucleotide in this 34-bp sequence plays in the recombination process. They identified two double-base substitutions in the 8-bp spacer region (5171 and 2272) that efficiently recombined with an identical mutant but not with the other mutant or the wild-type loxP site.
The goal of this study was to modify the BAC cloning vector pBeloBac11 to make it more versatile for a variety of studies. Oligonucleotides containing the 2272 version of the mutant loxP site and an internal XhoI restriction sequence were designed and ligated into the SfiI site of this BAC vector. Researchers can transform transposon plasmids carrying either a wild type or mutant loxP site into the E. coli cells containing any BAC clone of interest created in pBeloBac11 to generate transposon-mediated nested deletions from both ends of the genomic DNA.
Main text
Methods
The following oligonucleotides were synthesized and gel purified (Sigma-Genosis): 5′CTCGAGATAACTTCGTATAAAGTATCCTATACGAAGTTATCCC3′ and 5′ATAAACTTCGTATAGGATACTTTATACGAAGTTATCTCGAGGGG3′. Each oligonucleotide was dissolved in 10 mM Tris–Cl, 1 mM EDTA, pH 8.0 (TE) at a final concentration of 1 μg/ml and incubated at 4 °C overnight. The oligonucleotides were combined in the presence of 50 mM NaCl and heated to 80 °C for 5 min and then slowly cooled to room temperature.
A 500-fold molar excess of the double-stranded oligonucleotide was incubated with pBeloBac11 DNA that had been digested with SfiI for 2 h at 37 °C (New England BioLabs) in the presence of 1 U of T4 DNA ligase (Invitrogen) at 15 °C overnight. The ligation reaction was heat inactivated at 70 °C for 15 min and then spot dialyzed against 0.5X TE for 1 h. Two μl aliquots of the ligation reaction were mixed with 25 μl of electrocompetent DH10B cells (Invitrogen), placed into a 1 cm gap cuvette (BTX) and electroporated at 2.5 kV and 129 Ohms using the BTX Electro Cell Manipulator 600. The cells were allowed to recover in 1 ml SOC media (Invitrogen) at 37 °C and 225 rpm for 1 h and then 100 μl aliquots were spread onto LB + 34 μg/ml CM (Sigma) plates. Individual colonies were grown overnight in 2.5 ml of LB + CM media and DNA was generated using an alkaline lysis miniprep procedure [8]. The DNA samples were digested with 10 U of XhoI for 2 h at 37 °C (New England BioLabs) and electrophoresed in a 0.8% agarose gel in 0.5X TBE.
Results
Since the BAC cloning vector pBeloBAc11 was commercially available from New England BioLabs, I decided to modify this plasmid to increase its utility for genomics studies. Two complementary oligonucleotides containing the 2272 version of the mutant loxP site were designed and synthesized. I also incorporated a XhoI restriction site at the 5′ end of the CTCGAGATAACTTCGTATAAAGTATCCTATACGAAGTTATCCC oligonucleotide and the 3′ end of the complimentary oligonucleotide to allow for identification of successful insertion of the mutant loxP site into pBeloBac11, which contains a single XhoI site (Fig. 1). Then the oligonucleotides were combined and heated to 80 °C and allowed to slowly cool to room temperature so that annealing would occur.
A 500-fold molar excess of the double stranded oligonucleotide was ligated to SfiI-digested pBeloBac11 and the ligations were electroporated into DH10B cells and spread onto LB + chloramphenicol (CM) plates. I obtained miniprep DNA from several transformants, digested them with XhoI and analyzed the clones by agarose gel electrophoresis. The desired clone would generate two bands of 5.8 and 1.7 kb, while the religated vector would generate a single band of 7.5 kb. I identified several clones with the desired mutant loxP site; one of these transformants is shown (Fig. 2, lane 4). This newly created pBeloBac11-loxP* vector is illustrated (Fig. 3).
Discussion
XhoI digests of the transformants resulting from the ligation of the mutant loxP oligonucleotide to pBeloBac11 demonstrated that the modified vector was generated. Nested deletions emanating from the mutant loxP site of the BAC clones from the pilot genomic library that was constructed in this study can be generated using the mini-transposon system that we employed earlier (Fig. 3) [6]. First, the mini-transposon vector containing the mutant loxP site must be transformed into the BAC clone of interest. Upon addition of IPTG, the mini-Tn10 transposon cassette will randomly integrate into the BAC clone. When these cells are infected with a lytic strain of the bacteriophage P1, then deletions will occur between the two mutant loxP sites as long as they are in the same orientation (Fig. 4) [5]. Alternatively, existing BAC clones can be digested with NotI to liberate the genomic DNA. Then the desired fragment could be ligated into NotI-digested pBeloBac11-loxP*. Deletions emanating from the wild-type loxP site can be generated using the transposon plasmid pTnPGKpuro/loxP-EBV; this would also modify the BAC clone so that it also can be propagated in mammalian cells since it would contain the Epstein Barr Virus (EBV) latent origin of replication oriP and the trans-activating gene EBNA-1 [9]. Utilization of this technology will allow researchers to identify both boundaries of cis-acting elements and genes.
Limitations
-
pBeloBAC11 loxP* cannot be propagated in mammalian cells.
References
Shizuya H, Birren B, Kim U, Mancino V, Slepak T, Tachiri Y, Simon M. Cloning and stable maintenance of 300-kilobase-pair fragments of human DNA in Escherichia coli using an F-factor-based vector. Proc Natl Acad Sci USA. 1992;89:8794–7.
Ioannou PA, Amemiya CT, Garnes J, Kroisel PM, Shizuya H, Chen C, Batzer MA, de Jong PJ. A new bacteriophage P1-derived vector for the propagation of large human DNA fragments. Nat Genet. 1994;6:84–9.
Pierce JC, Sauer B, Sternberg N. A positive selection vector for cloning high molecular weight DNA by the bacteriophage P1 system: improved cloning efficiency. Proc Natl Acad Sci USA. 1992;89:2056–60.
Shizuya H, Kouros-Mehr H. The development and applications of the bacterial artificial chromosome system. J Med. 2001;50:26–30.
Chatterjee PK, Sternberg N. Retrofitting high molecular weight DNA cloned in P1: introduction of reporter genes, markers selectable in mammalian cells and generation of nested deletions. Genet Anal. 1996;13:33–42.
Chatterjee PK, Coren JS. Isolating large nested deletions in bacterial and P1 artificial chromosomes by in vivo P1 packaging of products of Cre-catalysed recombination between the endogenous and a transposed loxP site. Nucleic Acids Res. 1997;25:2205–12.
Lee G, Saito I. Role of nucleotide sequences of loxP spacer region in Cre-mediated recombination. Gene. 1988;216:55–65.
Birnboim HC, Doly J. A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res. 1979;7:1513–23.
Coren JS, Sternberg N. Construction of a PAC vector system for the propagation of genomic DNA in bacterial and mammalian cells and subsequent generation of nested deletions in individual library members. Gene. 2001;264:11–8.
Acknowledgements
Not applicable.
Competing interests
The author declares that he has no competing interests.
Availability of data and materials
pBeloBac11-loxP* is available at Addgene (ID# 60342).
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Author information
Authors and Affiliations
Corresponding author
Rights and permissions
Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.
About this article
Cite this article
Coren, J.S. Retrofitting the BAC cloning vector pBeloBAC11 by the insertion of a mutant loxP site. BMC Res Notes 10, 344 (2017). https://0-doi-org.brum.beds.ac.uk/10.1186/s13104-017-2631-8
Received:
Accepted:
Published:
DOI: https://0-doi-org.brum.beds.ac.uk/10.1186/s13104-017-2631-8