Loss of Cep55 leads to preweaning lethality in mice

To investigate the physiological role of CEP55 during development, we generated a KO mouse model of Cep55 using the “KO-first” allele design wherein the targeted allele acts as a gene-trap to form a non-functional allele (S1A Fig). Correct targeting was validated independently by genotyping PCR alongside the Cep55 transcript and protein expression using RT-qPCR and immunoblotting analysis, respectively (S1B, S1C and S1D Fig). To generate the colony of Cep55^-/- mice, we intercrossed Cep55^+/- mice, with the expectation that approximately 25% of the offspring would be of a Cep55^-/- genotype according to Mendelian ratios. Interestingly, after genotyping more than 321 offspring from these breedings (postweaning), we did not obtain any viable Cep55^-/- mice, indicating that genetic loss of Cep55 led to embryonic or preweaning lethality (S1 Table). To define the time point of lethality, pregnant dams from Cep55^+/- intercrosses were euthanized at different stages of pregnancy, ranging from E11.5—E18.5, and embryos collected for phenotypic evaluation. Interestingly, we were able to obtain viable Cep55^-/- offspring at each gestational stage (E11.5 -E18.5) (S2 Table). Embryos collected at both E14.5 and E18.5 exhibited significant dwarfism, based on crown-rump length measurements, when compared to control (Cep55^+/+) embryos. Additionally, Cep55^-/- embryos exhibited an increased thickness of the neck and a flattened head (Fig 1A and 1B)). Notably, we found 1 KO pup (3.4%) out of 29 pups at P0; hence, we observed only a rare incidence of homozygous pups born. In previously published studies, homozygous Cep55^-/- mice were born at Mendelian ratio, although differences in timing and penetrance of postnatal lethality have also been reported [8–10], which will be further elaborated in the discussion section.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 1. Loss of Cep55 leads to preweaning lethality and microcephaly in mice.

(A) Comparison of size (length, mm) and morphology of E14.5 (left) and E18.5 (right) Cep55 ^+/+ and Cep55 ^-/- embryos. (B) Comparison of the crown-rump length (mm) of E14.5 (left, p< 0.0001) and E18.5 (right, p< 0.0001) Cep55^+/+ and Cep55 ^-/- embryos. Data represent the mean ± SD, n = 6–10 embryos per genotype. (C,E) Representative images of Cep55^+/+ (left) and Cep55^-/- (right) neocortices (Ncx, yellow box) showing relative size of the Ncx. The yellow two-sided arrow represents the thickness of the Ncx, green dashed line shows the brain area, white dashed line shows the ventricle area and the yellow box resembles the analysis area, (C) Representative images of Cep55^+/+ and Cep55^-/- mouse brains at E14.5, scale = 50μm. (D) Comparison of brain area of Cep55^+/+ and Cep55^-/- E14.5 embryonic brains (left, p< 0.0001), and quantification of brain cell density (DAPI count within 100μm² area of the neocortex) (Middle left, P< 0.0118) Quantification of the relative ventricle area (μm²; total area shown/total brain area) (Middle right, p< 0.0011), and Ncx thickness (right, p< 0.0001). (E) Representative images of Cep55^+/+ and Cep55^-/- mouse brains at E18.5, scale = 700μm. (F) Comparison of Cep55^+/+ and Cep55^-/- for left: total DAPI+ cell count in the Ncx, p< 0.0029; middle: relative ventricle area (μm²; total ventricular space/total brain area), p< 0.0001; and right: Ncx thickness, p< 0.0001. (G) Representative images of whole coronal section (left), boxed region at increased magnification (middle), and medial region/glial wedge (right) of E18.5 Cep55^+/+ (upper) and Cep55^-/- (lower) embryonic mouse brains. Images show staining for NeuN (neuronal nuclei, mature neurons, red) and GFAP (Glial fibrillary acidic protein, marks astrocytes and ependymal cells, green). Right panel (glial wedge) shows the population of mature radial glia. Corpus callosum dysgenesis in Cep55^-/- brain (lower right), the boxed area in this panel shows GFAP expression in a magnified zone of glial wedge. Scale = 600 μm (left), Scale = 100 μm (middle), Scale = 400μm (right). (H) Comparison of Cep55^+/+ and Cep55^-/- embryonic brain overall cell and neuron number per section (left, p< 0.0036), brain area (middle, p< 0.0020), and cell/neuron density (right, P> 0.02347 for DAPI and, P> 0.8632 for NeuN). N = 4 (I) Comparison of NeuN-positive neurons normalized to 100μm neocortical area (Ncx) in Cep55^+/+ and Cep55^-/- E18.5 embryonic brains (left, p< 0.0010) and percentage of NeuN-positive cells across whole brain section normalized to the total number of cells identified by DAPI fluorescence (right, p< 0.0001). Data represent mean ± SD across two regions from n = 4 independent embryos per genotype. (J) Quantification of GFAP-positive cells in the glial wedge of Cep55^+/+ and Cep55^-/- E18.5 embryonic brains (left, p< 0.0025) and GFAP-positive cells in the whole section (right, p< 0.0004). Data represent mean ± SD of four embryos, N = 4, average count of duplicate technical repeats, Student’s t-test, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001).

https://doi.org/10.1371/journal.pgen.1009334.g001

To determine if the loss of a single allele of Cep55 would cause phenotypic changes, we performed the histological examination of multiple organs from eight-week-old Cep55^+/- mice relative to Cep55^+/+ littermates. We observed no significant differences in the pathohistology or size of respective organs (S1E Fig) indicating that loss of a single allele of Cep55 does not impact physiological development. Additionally, the monitoring of both genotypes showed no significant differences in body weight for the first 20 weeks (S1F Fig). These data suggest that a single allele of Cep55 is largely sufficient to maintain physiological functions.

Several recent reports have shown that CEP55 functional loss in humans leads to a range of congenital abnormalities, all with defective brain development [4–6]. Therefore, we next sought to examine the expression pattern of Cep55 using single-cell transcriptomic data of mouse neocortical development [11]. This analysis revealed that Cep55 expression levels are highest in the NPCs of E14 embryos (S1G Fig). Moreover, investigating human fetal brain data from Allen Brain Atlas revealed that expression of Cep55 peaks from weeks 8–10 of gestation, followed by a reduction after 16 weeks. Minimal detection was reported between weeks 27–35, but expression became detectable again three weeks prior to birth [12]. This expression pattern corresponds with the timing of human neurogenesis in the neocortex through neurogenic divisions and neuronal differentiation from radial glial cells (RGCs) [13]. To validate the expression of Cep55 during development, we performed β-galactosidase staining in the Cep55^+/- mice, as the targeted allele contains a LacZ reporter. In the isolated brain of mouse embryos, a gradient of expression of Cep55 in the neocortex was detected at E12.5, diminishing at E14.5 to become undetectable at E16.5 (S1H Fig). Collectively, our data suggest that Cep55 plays a critical role during neurogenesis.

Cep55 loss causes gross morphological defects in mouse embryos

Given the neurodevelopmental expression pattern of Cep55, we predicted that significant neural deficits would arise from Cep55 loss. To investigate this, we first performed hematoxylin and eosin (H&E) staining of sagittal and coronal sections from E18.5 Cep55^+/+, Cep55^+/- and Cep55^-/- mice. We observed no gross morphological differences in the lung, intestine or liver among the respective genotypes. However, we noted prominent abnormalities in the brain of Cep55^-/- embryos when compared to respective controls, which were characterized by a partial failure (hypoplasia) and disorder (dysplasia) of normal structural brain development. The cerebellum was hypoplastic, with marked thinning of the germinative external-granular layer (EGL), the secondary germinal zone that produces granule cell progenitors, and a diminution and disorganization of neurons (S2A Fig, right). In addition, the neuronal population of the olfactory bulb was disorganized and depleted (S2A Fig, left). Furthermore, coronal sectioning of the brain revealed neocortical depletion of neurons and ventricular dilatation, as well as smaller germinal regions in both dorsal and ventral telencephalon (S2B Fig). The neocortices of Cep55^-/- brains were hypoplastic and dysplastic, with diminished and disorganized neurons. In addition to apoptosis in the neocortex, there were also multifocal areas of cortical necrosis and parenchymal loss, with evidence of phagocytosis of affected neurons by macrophage-like cells (S2C Fig, upper). Numerous bi-nucleated neurons were also evident in the neocortex of Cep55^-/- mice (S2C Fig, lower). To measure this defect, we stained mature neurons with NeuN (RBFOX3) and quantified the number of bi-nucleated neurons in the neocortex of brain.The proportion of multinucleated neurons expressing NeuN in the cortical region of Cep55^-/- mice was increased compared to that of Cep55^+/+ (S2D and S2E Fig), a phenotype reminiscent of the described changes in human embryos with MARCH syndrome [6].

As cortical neurogenesis peaks at approximately E14.5 [14,15] and the highest expression of Cep55 was found at this embryonic stage (S1G Fig), we chose this gestational stage for characterizing the phenotypes and cellular behaviors in Cep55-deficient mice. Also, to better characterize the specific disruption to neural cells, we focused our investigation on the neocortex, a well-characterized region of the developing forebrain with prominent Cep55 expression. Strikingly, brain sizes of Cep55^-/- E14.5 embryos were found to be significantly smaller compared to that of Cep55^+/+ by measuring the brain area (Fig 1C and 1D). We also found a reduced number of cells in the neocortex of Cep55^-/- embryos. Furthermore, the size of the ventricle relative to the total brain area was larger and dilated in Cep55^-/- mice, consistent with our previous histopathological observations. We also observed that the thickness of the cortex was reduced in Cep55^-/- brains compared to Cep55 ^+/+ (Fig 1C and 1D). Similar to our observations at E14.5, we noted fewer cells (DAPI) in the cortex of Cep55^-/- embryos compared to Cep55 ^+/+ at E18.5 (Fig 1E and 1F). Consistently, the ventricles were larger and dilated in Cep55^-/- brains and cortex thickness was reduced (Fig 1E and 1F). Also, brain sizes of Cep55^-/- embryos at E18.5 were found to be significantly smaller compared to that of Cep55^+/+ (Fig 1G and 1H). Interestingly, this size reduction in Cep55^-/- brain area likely resulted from decreases in the number of both total cells (DAPI stained) and neurons (NeuN stained), since the density of the cells (cells/area) after normalization to total brain area was not significantly different between genotypes (Fig 1G and 1H).

To further investigate the reduction of cell populations, we stained brain sections for NeuN to mark mature neurons and glial fibrillary acidic protein (GFAP) to mark astrocytes. The mature neurons (NeuN-positive cells) were reduced in numbers in the neocortex in Cep55^-/- compared to that of Cep55^+/+ embryos, even after normalization to the total cell number as assessed by DAPI staining (Fig 1G and 1I). Interestingly, GFAP-positive cells in the neocortex were reduced in Cep55^-/- embryos when compared to Cep55^+/+ (Fig 1G and 1J), suggesting broader defects in the development of the central nervous system. In the cortical region, GFAP can be a marker of either astrocytes or the radial-glial-like neuronal stem cells and represents mature radial glia which can be seen in the medial region (e.g. glial wedge). We also observed a drastic reduction in GFAP-expressing cells at the cortical midline and in the neocortex in Cep55^-/- brains compared to that of Cep55^+/+. These cells are critical in facilitating the crossing of axons through the corpus callosum [16]. In line with the lack of GFAP-expressing cells, at the midline, we observed dysgenesis of the corpus callosum in mutant mice at this age (Fig 1G). Taken together, these data show that loss of Cep55 results in defective neuropathological phenotypes in mice.

Cep55 regulates the fate of radial glial and intermediate progenitor cells

Having observed reduced numbers of neurons and astrocytes in the cortex of Cep55 mutant mice, we next sought to determine how Cep55 regulates NPCs differentiation and development during neurogenesis, with a focus on the different neuroepithelial layers of the neocortex during embryonic development. Neurogenesis in the developing neocortex occurs with the contribution of two types of NPCs: radial glial cells (RGCs) and intermediate progenitor cells (IPCs) [17]. The former divide at the ventricular zone (VZ; the apical surface), and express the homeodomain transcription factor, Pax6. The latter, which are derived from RGC and only produce neurons, divide within the basally located subventricular zone (SVZ) and express Tbr2, a T-domain transcription factor. The subsequent transition from IPCs to postmitotic projection neurons (PMN) in the cortical plate (CP) is marked by the onset of Tbr1 expression [17]. We investigated the different populations of progenitor cells within the nascent cortex, to determine how a deficit in cortical neuron number might arise in our mutants. We categorized RGCs as the Pax6⁺ Tbr2^– population, as some newborn Tbr2⁺ IPCs retain transient expression of Pax6 [18]. Immunostaining for Pax6, Tbr2, and Tbr1 at E14.5 revealed a reduction in the number of RGCs, IPCs, and post-mitotic neurons as a proportion of the total cortical cell number in Cep55^-/- mice compared to Cep55^+/+ controls (Fig 2A and 2B). Furthermore, we also observed a reduced population of neurons marked by Tuj-1, the neuron-specific class III β-tubulin, in Cep55^-/- neocortices compare to Cep55^+/+ (Fig 2C). Next, we investigated how Cep55 loss impacts mitosis, proliferation, and apoptosis of NPCs by staining for phosphohistone H3-S10 (pH3), Ki67, and TUNEL, as markers of these cellular processes respectively. We found a reduced proportion of pH3 positive-cells in Cep55^-/- mice, when the pH3-positive cell pool was normalized to the total number of cells. This is indicative of either mitotic defects or delayed mitosis/cytokinesis in the absence of Cep55 (Fig 2D). Consistently, the proliferation index at E14.5 was significantly reduced in Cep55^-/- animals (Fig 2E). Finally, we found high levels of apoptosis as marked by TUNEL staining in Cep55 ^-/- neocortices compared to controls at E14.5 when assessed as a percentage of total cell number (Fig 2F). Interestingly, western blot analysis of mouse embryonic brain (E14.5) extracts also showed upregulation of cleaved caspase-3 in Cep55^-/- brains consistent with our IHC results and histopathological observations (S2F Fig). Collectively, these data suggest that reductions in NPCs are due to elevated levels of cell death and reduced proliferation and indicate a role for Cep55 in the survival and viability of neural progenitor populations during neocortical development.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 2. Cep55 regulates cell fate of radial glial and intermediate progenitor cells, and neurons.

(A) Representative images of radial glial cells (RGC; Pax6+) at VZ, intermediate progenitor cells (IPC; Tbr2+) at SVZ and total cells (DAPI) at E14.5, scale = 15 μm (upper panel). Quantification of percentage of RGCs (Pax6+, p< 0.0016) and IPCs (Tbr2+, p< 0.0337) in Cep55^+/+ and Cep55^-/- neocortices (Ncx) at E14.5 (lower). (B) Representative images of IPCs (Tbr2+) at SVZ, post-mitotic neurons (Tbr1+) at CP and total cells (DAPI, gray) at E14.5, scale = 15 μm (upper), quantification of the percentage of post-mitotic-neurons (Tbr1+, p< 0.0005) in Cep55^+/+ and Cep55^-/- neocortices at E14.5 (lower). (C) Neuron-specific class III β-tubulin (Tuj1, p< 0.0037), relative intensity of Tuj1 staining quantified within a 100 μm² field of view. (D) Phosphohistone H3 (pH3; mitotic cells) in the VZ and SVZ, co-stained with Tbr2 to identify proliferating IPCs at E14.5, scale = 15 μm. Quantification of the percentage of total cells expressing pH3 to show the mitotic index in Vz, p< 0.0090; and SVZ, P< 0.0070. (E) Proliferating cells (Ki67+), IPCs (Tbr2+, green) delineating the SVZ, and total cells (DAPI) at E14.5, scale = 15 μm (upper), Comparison of the proportion of Ki67+ cells in Cep55^+/+ and Cep55^-/- neocortices to show proliferation index (lower, p< 0.0034). (F) Apoptotic cells (TUNEL) and total cells (DAPI) in the Ncx, at E14.5, scale = 15 μm (upper), comparison of proportion of apoptotic cells in Cep55^+/+ and Cep55^-/- neocortices to show apoptosis index (lower, p< 0.0019).

https://doi.org/10.1371/journal.pgen.1009334.g002

Elevated apoptosis following CEP55 knockdown in human cortical organoids

We next investigated the effect of CEP55-loss in human cerebral brain organoids generated from embryonic pluripotent stem cells (HES3). Cerebral organoids mimic the unique and dynamic features of early human cortical development in culture, enabling detailed analysis of organ pathogenesis due to particular genetic deregulation or dysfunction [19]. We performed knock-down of CEP55 in differentiated HES3 organoid cultures using adenoviral GFP-tagged shRNA against CEP55 or a scrambled control (U6). Knockdown was performed after cerebral organoid induction to circumvent potential early apoptosis caused by CEP55 loss. Within 24–48 hours of adenoviral transduction, we observed a significantly increased level of the integrated virus as marked by GFP expression for control CMV-eGFP and sh-CEP55 (shRNA U6 scrambled control did not contain a GFP tag) (Fig 3A). The enlarged images illustrate the neuroepithelial structures (S2G Fig) and differentiation in brain organoids using specific markers to detect progenitor cells (PAX6, TBR2) and differentiated neurons (TBR1 and chicken ovalbumin upstream promoter transcription factor-interacting proteins 1; CTIP-1) (S2H Fig). Given the extent of apoptosis observed in our mouse model, we characterized the effect of CEP55 knock-down (Fig 3B) in the cerebral organoids at 24 hours post-infection. A significant reduction of PAX6-positive NPCs was observed within 24 hours of CEP55 shRNA transduction in organoids compared to control (Fig 3C and 3D). However, we did not find a significant difference in pH3 positive cells (Fig 3C and 3E). The reduced number of PAX6 cells in organoids transduced with CEP55 shRNA was likely caused by a dramatic increase in cell death (cleaved caspase 3) (Fig 3F and 3G). Consequently, we observed a significant decrease in TUJ1+ neurons in CEP55-knockdown organoids compared to controls (Fig 3F and 3H). Collectively, our findings of reduced RGC numbers due to apoptotic cell death in human cerebral organoids were consistent with the Cep55^-/- phenotype observed in mice.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 3. CEP55 knockdown induces cell death in neural progenitors of human cerebral organoid.

(A) Day 16 of human iPSC-derived cerebral brain organoids infected with U6 scrambled control (left), CMV GFP control (middle) and CEP55 knockdown (KD) (right) adenoviral shRNAs with GFP-tag. Expression levels of integrated viral GFP increased significantly between days 1 to 2 post-infection at a MOI of 10. shRNA U6 scrambled control did not contain a GFP tag. Upper panel: D0 (infection day) +1; lower panel: D0 +2, scale bars = 50μm, immunofluorescent labeling of cerebral organoids was done after 24 hours of shRNA infection. The brain organoid differentiations were repeated as 3 entirely separate differentiations, each containing 192 technical replicates towards all the described experiments. Each technical organoid replicate was also cultured independently for the described 18 days post induction. (B) Immunoblot shows knockdown of CEP55 in adenoviral shRNA against CEP55 transduced organoid compare to U6 scrambled control. Vinculin serves as the loading control. (C) Representative images of labeling for neural progenitor PAX6, mitotic marker pH3 and nuclear Hoechst showed a decrease in neural progenitor PAX6 in the CEP55 KD shRNA infected organoids compared to the U6 and GFP controls. (D-E) Quantified immunolabelled organoids (normalized to CMV GFP control) for (D) PAX6, p< 0.0045 (GFP) and, P< 0.0001 (shSCR) and (E) pHH3, p> 0.9804 (GFP) and, P> 0.999 (shSCR). (F) Representative images of labeling for neural-specific tubulin TUJ1, apoptotic marker cleaved caspase 3, and nuclear Hoechst showed a clear increase in cell death in the CEP55 KD samples compared to the controls. (G-H) Quantified immunolabelled organoids (normalized to CMV GFP control) for (G) Cleaved Caspase-3 in non Tuj1+ cells, p< 0.0100 (GFP) and P< 0.0027(shSCR); TUJ1/Caspase3 double positive cells by first identifying a TUJ1+ cell by the presence of a positively stained nucleus (Hoechst staining) and subsequently counting whether they were double positive for Caspase3, (H) Total Tuj1+ cells, p< 0.0157 (GFP) and p< 0.0362 (shSCR). For all calculations, data represented mean ± SD, the number of organoids indicated in figures. One-way ANOVA (Kruskal–Wallis test) performed; *p< 0.05, ** p < 0.01, scale = 50 μm.

https://doi.org/10.1371/journal.pgen.1009334.g003

Cep55^-/- mice exhibit cilial abnormalities

The findings presented above using mouse embryos and human cerebral organoids indicate a role for Cep55 in neural development. Notably, truncating nonsense mutations in CEP55 are associated with MKS-like syndrome, a lethal fetal ciliopathy [4,5]. Primary cilia (cilia, hereafter) perform important functions in neurodevelopment, are localized to and extend from RGCs into the lateral ventricle, and are also present in other NPCs and neuron populations [20]. Dysfunction of the ciliary axoneme, basal body, or cilia anchoring structures can all cause defects in cilia organization, leading to ciliopathies [21]. As such, we investigated the involvement of Cep55 in the regulation of ciliogenesis in the developing neocortex at E14.5 (S3A Fig) and E18.5 (Fig 4A and 4B). We performed immunostaining on embryonic mouse brain sections from Cep55^+/+ and Cep55^−/− mice using Arl13b (a marker of ciliary membranes), γ-tubulin (basal body), DAPI (DNA marker), and Cep55 to evaluate and compare their expression and localization. We observed fewer cilia in the VZ of Cep55^−/− brains at E14.5 and E18.5 compared to Cep55^+/+ brain. Our analysis revealed a decrease in both the number and the percentage of ciliated cells throughout the cortical layers at both E14.5 and E18.5, particularly in apical progenitors localized in the ventricle membrane of Cep55^−/− compared to Cep55^+/+ brains (Figs 4A, 4B and S3A). The decrease in ciliated cells was independent of the reduction in neural progenitor populations (Tbr2+ IPC and Pax6+ RGC) as ciliated cells were expressed as a ratio of cell numbers (S3B Fig). Given the important role of cilia during neurodevelopment, we further examined the potential role of Cep55 in regulation of ciliogenesis in an in vitro model.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 4. Cep55 is localized to basal body of cilia and regulates ciliogenesis.

(A) Super-resolution microscopy of Cep55^+/+ and Cep55^-/- mouse neocortex at E18.5 immunostained for cilia (Arl13b), basal body (Ɣ-tubulin), and DAPI, scale = 10 μm. (B) Percent of cilia-positive cells in Ncx at E18.5, p< 0.0001. (C-H) Representative images showing cilia (Arl13b), basal body (Ɣ-tubulin), Cep55 (yellow), and DAPI (blue), Scale = 5 μm. (C) Representative image of cilia and basal body in control (upper) and CEP55 knockdown (lower) in SH-SY5Y cells. (D) Percentage of ciliated cells in Ctrl and CEP55 knockdown SH-SY5Y, p< 0.0001. (E) Cilia, basal body, and CEP55 staining in RPE-1 cells transfected with a control lentiviral vector (Ctrl) (upper), RPE-1 cells with lentiviral knockdown of CEP55 (lower). (F) Percentage of ciliated RPE-1 cells with or without CEP55 knockdown (upper, P< 0.0001), Scatter plot showing cilia length in control RPE-1 cells or with CEP55 knockdown (lower, p< 0.0211). (G) Representative image of cilia, basal body and Cep55 in Cep55^+/+ (Wt) MEFs (upper), Cep55^-/- (KO) MEFs (middle), Cep55^-/- MEFs with ectopic expression of Flag-CEP55 (Rescue) (lower). (H) Percentage of ciliated cells in Cep55^+/+, Cep55^-/- and Cep55^-/-, p< 0.0022; cells reconstituted with a human CEP55 construct (rescue, p< 0.0303). Data represent mean ± SD of 300 cells per genotype (left); scatter plot showing cilia length (μm) in Cep55^+/+, Cep55^-/-, p< 0.0001 and CEP55-reconstituted MEFs, p< 0.0101. Data were measured in duplicate across two independent experiments (right). For all calculations, one-way ANOVA (Kruskal–Wallis test) performed, *p < 0.05, **p< 0.01, ***p< 0.001, ****p< 0.0001).

https://doi.org/10.1371/journal.pgen.1009334.g004

Cep55 is localized to the ciliary basal body and regulates cilia growth

Finding the cilia defect in Cep55^-/- brains, we aimed to determine how Cep55 might regulate ciliogenesis and whether ciliary defects could be recapitulated in an in vitro system to facilitate mechanistic studies. We turned our attention to a cell line of neural origin, SH-SY5Y [22], and to the hTERT RPE-1 line, which has been routinely used to study cilia formation [23]. Ciliogenesis typically occurs in G₀ and G₁ and serum starvation is widely used to arrest cells in G1 to stimulate cilia formation. Examining the impact of CEP55 knockdown on cilia formation in serum starved SH-SY5Y and RPE-1 cells, we observed significantly decreased numbers of ciliated cells compared to the respective control; the latter also revealed a significant reduction in cilia length after CEP55 knockdown (Figs 4C, 4D, 4E, 4F, S3C and S3D). Finally, to facilitate rescue studies, we isolated mouse embryonic fibroblasts (MEFs) from Cep55^+/+ and Cep55^-/- mice (S3E Fig) to examine possible cilia defects and whether ectopic expression of CEP55 in Cep55^-/- MEFs can rescue the defects. We found that Cep55^-/- cells had a significantly reduced number of ciliated cells and shorter cilia when compared to Cep55^+/+ MEFs (Fig 4G and 4H). In addition, a slight increase was seen in the number of Cep55^-/- MEFs displaying multiple small cilia extending from the basal body (double cilia), alongside a significant proportion of cilia from Cep55^-/- MEFs exhibiting dissociation from the basal body (remnant cilia) (S3F Fig). Notably, most cells with multi-cilia had one nucleus; therefore, multi-cilia are unlikely to be due to failed cytokinesis. Furthermore, we observed that ectopic CEP55 expression in Cep55^-/- MEFs (S3G Fig) was able to restore cilia formation and length to levels comparable to Cep55^+/+ MEFs, confirming that defective ciliogenesis was a consequence of Cep55 loss (Fig 4G lower panel and 4H). Given an apparent role for Cep55 in ciliogenesis regulation, we next examined whether Cep55 co-localizes with the cilia axoneme or at the base of cilia by super-resolution microscopy. CEP55 (yellow) was imaged with Arl13b (cilia axoneme marked green) and γ-tubulin (a component of the basal body protein complex marked red) across a population of CEP55 expressing MEFs. Interestingly, we observed co-localization of CEP55 with gamma-tubulin at the base of cilia (S3H Fig). Together, these findings illustrate that Cep55 localizes at the base of cilia, possibly as a component of the basal body protein complex and is required for normal cilia formation.

Cep55^-/- MEFs exhibit multinucleation and cell cycle defects

Given that Cep55^-/- embryos are growth restricted in vivo, we next sought to recapitulate this phenomenon in vitro to determine if Cep55 loss causes proliferation defects in our mouse embryonic fibroblast (MEF) cell lines. We calculated cell doubling time and found significant growth defects in Cep55^-/- lines (S4A Fig) compared to Cep55^+/+, which was further revealed to be dose-dependent (S4B Fig), thus indicating in vivo growth restriction. Moreover, we were able to rescue this proliferation defect by ectopically expressed CEP55 in Cep55^-/- MEFs (S4C Fig). Overall, the in vitro proliferation deficiency in Cep55^-/- MEFs was consistent with the observed phenotype in neuronal progenitors, where decreased proliferation was detected with Ki67 (E14.5) by immunofluorescence. Furthermore, the multinucleation seen in MEFs (S4D and S4E Fig) was reminiscent of the neuronal phenotype. We next performed cell cycle analysis using propidium iodide (PI)-stained cells sorted by flow cytometry. FACS analysis revealed significant differences in the cell cycle profile of Cep55^+/+ and Cep55^-/- primary MEFs, where Cep55^-/- cells showed enrichment of cells in G2 and a reduction in G1 population (S4F and S4G Fig). To further examine cellular division, we performed live-cell imaging of Cep55^+/+ and Cep55^-/- cells transduced with mCherry-histone H2B by EVOS-FL time-lapse microscopy (S4H Fig). We found extended cell division (mitotic length) in Cep55^-/- compared to Cep55^+/+ lines (S4I Fig). As expected, the Cep55^-/- cells showed defective cytokinesis, taking longer to divide effectively with 17% remaining multinucleated (S4J Fig). For further characterization of additional mitotic defects, we performed high-resolution time-lapse microscopy of mCherry-histone H2B cells using confocal microscopy to quantitate mitotic defects including anaphase bridge formation, lagging chromosomes, and mitotic slippage. Although there was a trend towards an increased proportion of anaphase bridges during mitosis in Cep55^-/- MEFs compared to control, this was not statistically significant (S4K Fig). Moreover, we did not observe any changes in lagging chromosomes or slippage (S4K Fig). Together, these results illustrate that Cep55 is important to support normal cell growth and division in particular cytokinesis in MEFs.

Cep55 regulates Gsk3β, downstream of the Akt pathway

CEP55 has previously been shown to regulate PI3K/AKT signaling pathway in cancer cells [2,3]. As such, we next performed signaling analysis of Akt and its downstream targets in E14.5 mouse brains as well as in MEFs by immunoblotting. The loss of Cep55 culminated in decreased phosphorylation of Akt (pS473-Akt) in both Cep55^-/- brain tissue and MEFs (Fig 5A and 5B). Akt controls steady-state levels of Gsk3β through phosphorylation of residue Serine 9 (pS9-Gsk3β). Inactive AKT is known to result in decreased pS9-GSK3β levels, which leads to GSK3β activation with pro-apoptotic functions [24]. In line with this, we observed that Cep55 loss led to the inactivation of Akt (decreased pS473-Akt) and activation of Gsk3β (decreased levels of pS9-Gsk3β) (Fig 5A and 5B). Importantly, we were able to rescue the phosphorylation of Akt and Gsk3β by ectopic expression of CEP55 in Cep55^-/- MEFs, confirming the specificity of the observed signal transduction effects (Fig 5C). Activated Gsk3β has been shown to inhibit downstream targets involved in proliferation such as β-catenin and Myc. We observed a decrease in β-catenin levels in E14.5 Cep55^-/- brains (Fig 5A). Similarly, we observed reduced β-catenin and non-phospho β-catenin levels in Cep55^-/- MEFs (Fig 5B). GSK3β can also destabilize MYC by phosphorylation on Threonine 58 [25]. Accordingly, we observed an increase in pT58-Myc levels and a concomitant decrease in total Myc levels in Cep55^-/- MEFs as well as a trend towards decreased total Myc levels in E14.5 brains when compared to Cep55^+/+ controls (Fig 5A and 5B). Additionally, we performed IHC staining of total β-catenin and N-Myc on E14.5 brain sections from Cep55^-/- and Cep55^+/+ embryos. These results revealed a significant decline of membranous and cytoplasmic β-catenin in Cep55^-/- in the VZ compared to Cep55^+/+ in E14.5 brain, consistent with immunoblot analysis in the embryonic brain at this time-point (Fig 5D). Similarly, IHC on E14.5 brain sections revealed a significant reduction in N-Myc expression in Cep55^-/- NPCs compared to Cep55^+/+ controls (Fig 5E). Notably, Cep55 loss resulted in a reduction in transcript levels of Myc in both brain samples and MEFs, consistent with reported transcriptional regulation of Myc by the Wnt/β-catenin pathway (S5A and S5B Fig). Additionally, N-Myc (a member of the Myc family regulating neural cells) was shown to be reduced in E14.5 Cep55^-/- brain tissue (S5A Fig). Together, we conclude that Cep55 loss potentially inhibits proliferation and survival in an Akt-dependent manner.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 5. Cep55 regulates GSK3β, β-Catenin and Myc downstream of the Akt pathway.

(A-C) Representative image of immunoblot (WB) analysis with indicated antibodies. Numbers at the bottom of each WB lane represent the relative quantification of band intensities normalized to the signal of each loading control. β actin or vinculin served as a loading control. Immunoblot performed to compare (A) Cep55^+/+ and Cep55^-/- mouse embryonic brain at E14.5. (B) Cep55^+/+ and Cep55^-/- MEFs. (C) Cep55^+/+ (Wt), Cep55^-/- (KO) and Cep55^-/- MEFs with ectopic expression of CEP55 (Rescue) with indicated antibodies. (D) Representative images of Cep55+/+ (left) and Cep55-/- (right) neocortices stained for β-catenin and nuclei (DAPI) in a 100 μm-width box. Bar chart shows the relative intensity of β-catenin signals for Cep55+/+ and Cep55-/- neocortices, p< 0.0001; Scale = 50 μm. (E) Representative images of Cep55+/+ (left) and Cep55-/- (right) neocortices stained for N-Myc (red), Tbr2 positive cells and nuclei (DAPI) in a 100 μm-width box. Bar chart shows the percent of N-Myc positive cells, p< 0.0232, scale = 15μm (Mean ± SD of four embryos duplicate technical repeats, Student’s t-test, *p< 0.05, **p< 0.01, ***p< 0.001, ****p< 0.0001).

https://doi.org/10.1371/journal.pgen.1009334.g005

Activation of PI3K/AKT signaling pathway rescues the proliferation and cilia defects induced by Cep55-loss

Next, we sought to evaluate whether the reconstitution of Akt signaling or its downstream regulators would be sufficient to rescue the proliferation and ciliogenesis defects in Cep55^-/- MEFs. To investigate this, we first, utilized a myristoylated form of AKT1 (myrAKT) previously described to be constitutively-active [26]. Cep55^-/- MEFs were transduced with retrovirus to express myr-AKT or an empty vector (EV) control (S5C Fig) and assessed for proliferation. Incucyte analysis revealed that myr-Akt was able to markedly increase the proliferative rate of Cep55^-/- MEFs when compared to EV-transduced cells (Fig 6A). We also sought to determine if we could rescue the proliferation and ciliogenesis defects using an inhibitor of activated GSK3β. The universal GSK3β inhibitor, CHIR99021, at low dosages (0.1 μM and 1 μM) was able to partially increase proliferation in Cep55^-/- MEFs (Fig 6B), possibly through the inhibition of active GSK3β as per previous reports [27]. In contrast, in Cep55^+/+ lines (similar to CEP55 rescued lines where Gsk3β is inactivated by Akt activity); Gsk3β inhibition can hinder proliferation in a dose-dependent manner (S5D Fig). Our findings demonstrate that Cep55, through activation of Akt and inhibition of Gsk3β, can regulate proliferation.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 6. Myr-AKT and downstream effectors can rescue Cep55 loss.

Proliferation assay showing the growth of Cep55^-/- (KO) MEF (A) Transiently transfected with EV (turquoise blue) or myr-AKT (purple) and (B) treated with indicated doses of GSK3β inhibitor, CHIR99021 (untreated: red, 0.1 μM inhibitor: green, 1 μM inhibitor: blue). Mean ± SD, the average of 2 biological repeats and 3 independent experiments Student’s t-test, ****p< 0.0001. (C) Representative images of Cep55^-/- (KO) MEFs reconstituted with EV-mCherry (left) or myrAKT-mCherry (right) immunostained for cilia (Arl13b), basal body (Ɣ-tubulin) and nuclei (DAPI). The lower panel shows merged images with magnification of the boxed area. Scale = 12 μm. Left: Percentage of ciliated cells in Cep55^+/+ (Wt) and Cep55^-/- (KO) MEFs transfected with EV or myr-Akt. Mean ± SD, n = 100 cells from 3 independent experiments Student’s t-test, *p< 0.05). (D) Representative image U6 (shSCR Ctrl) and CEP55 KD human brain organoids immunostained for cilia (ARL13b), basal body (Ɣ-tubulin) and nuclei (DAPI), Scale = 10 μm. (E-G) Comparison of U6 (shSCR Ctrl) and CEP55 KD untreated (DMSO) and treated with 3 μM GSK3β inhibitor, CHIR99021 for (E) Ciliated cell counts, p< 0.0010 (F) The size of organoids (area) p< 0.0380 for control, p< 0.0001 for shCEP55 (G) The percent of cleaved Caspase 3 in PAX6 negative cells, p< 0.5767 for control, p< 0.0104 for shCEP55. Data were measured across two independent experiments. n = 6 organoids. Mean ± SD, one-way ANOVA (Kruskal–Wallis test) performed, **p< 0.01).

https://doi.org/10.1371/journal.pgen.1009334.g006

Next, we examined whether myrAKT expression was sufficient to rescue the defects in cilia formation. Strikingly, we observed that myrAKT expression in Cep55^-/- MEFs, but not EV expression, restored the percentage of ciliated cells to levels more comparable to Cep55^+/+ MEFs (Fig 6C). Regarding ciliogenesis, inhibition of Gsk3β in Cep55^-/- MEFs did not affect cilia formation significantly (S5E Fig). Our analysis of cilia in CEP55 KD organoids revealed that CEP55 loss perturbed ciliogenesis (Fig 6D). However, consistent with our MEF data, we were unable to rescue this phenotype with GSK3β inhibitor (Fig 6D and 6E). This is consistent with a previous study that showed that GSK3β inhibition alone does not modulate ciliogenesis but combined inactivation of Von Hippel-Lindau (VHL) and GSK3β leads to loss of cilia formation and maintenance [28] suggesting that GSK3β acts redundantly with VHL to regulate ciliogenesis. Strikingly, GSK3β inhibition can rescue the size of human organoids. CEP55 loss in organoids led to size (area) decrease compared to control, consistent with microcephaly seen in CEP55-null human patients and mouse model (Fig 6F). While the CHIR99021 (GSK3β inhibitor) treatment had no significant effect on the size of control organoids, it led to a significant increase in the size of CEP55 KD organoids (Fig 6F). The mechanism of this rescue is through the reduction of apoptotic cells as marked by cleaved caspase 3 (Fig 6G). Taken together, our findings demonstrate that CEP55 regulates cell survival in an AKT-dependent manner (Fig 7). Nevertheless, CEP55-dependent regulation of ciliogenesis might occur through an AKT downstream effector(s) independent from GSK3β. Overall, the phenotype in brain organoids and related apoptosis can be rescued through GSK3β inhibition.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 7. Graphical abstract.

Proposed model of Cep55-dependent regulation of RGC proliferation or apoptosis through PI3K/Akt and the downstream targets Gsk3β, β-Catenin and Myc. CEP55 is known to bind the catalytic subunit of PI3K (p110) and promotes downstream phosphorylation of AKT (S473). The active AKT inactivates GSK3β by phosphorylating it on S9. However, in Cep55 KO cells, downregulation of Akt phosphorylation leads to upregulation active Gsk3β (Y216) and consequent cell death which can be rescued by Gsk3β inhibition. Ciliogenesis is regulated in an Akt-dependent manner and independent of Gsk3β.

https://doi.org/10.1371/journal.pgen.1009334.g007

Ethics statement

This research was carried out in strict accordance with the Australian Code for the care and use of animals for scientific purposes. All protocols were approved by the QIMR Berghofer Medical Research Institute Animal Ethics Committee (ethics number A0707-606M).

Generation of constitutive Cep55 knockout mice

Cep55 floxed ES cells were purchased from the International Knockout Mouse Consortium (Exon 6 of Cep55 was trapped, IKMC Project ID:93490) and heterozygous Cep55 targeted mice were generated by the Australian Phenomics Network (APN) facility, where the targeted allele acts as a gene-trap to form a non-functional (KO) allele. The knockout-first allele used in the targeting strategy is amenable to the generation of a floxed allele via FLP recombinase breeding, allowing the generation of conditional knockout mice. Mice were housed at the QIMR Berghofer Medical Research Animal Facility in OptiMICE caging (Centennial, Colorado, USA) at 25°C with a 12-hour light-dark cycle. All experimental animals were maintained on a C57BL/6J strain.

Genotype analysis

Genotyping was performed using genomic DNA extracted from mouse ear using the QuickExtract DNA Extraction Solution (Lucigen, USA) according to the manufacturer’s protocol. Wild-type and Cep55 transgenic alleles were genotyped using a 3-primer PCR with a common forward primer (P1) and two different reverse primers (P2 and P3) to differentiate between different allele forms. Primer sequences were as follows: Cep55 P1(TGGGTCTTTAACTCATGGTC), Cep55 P2 (AGGAGTGAAAAGTCCTCACA), Cep55 P3(GTACCGCGTCGAGAAGTT).

Quantitative reverse transcription PCR

Quantitative reverse transcription PCR (RT-qPCR) was performed using cDNA as the template with gene-specific primers as outlined below. The reverse Transcription obtained using the SuperScript First-Strand Synthesis System. A control reaction was performed without reverse transcriptase to ensure no genomic DNA had contaminated the samples, as well as a no-template DNA control. The RT-qPCR was performed in 96-well plate format using a SYBR Green master-mix (Roche Applied Science, Basel, Switzerland) with a CFX96 Touch Real-Time PCR Detection System (Bio-Rad Laboratories, US). The total volume of each reaction was 8 μL including 4 μL of Sybr green, 1 μL of each primer (1 picomole of each), 1 μL of cDNA (10ng) and 2 μL of sterile water. The specificity of RT qPCR amplification was examined by checking the melting curves and running each sample on a 2% agarose gel. The results were analyzed by the ΔΔCt method. Actin was used as a housekeeping gene.

RT qPCR primers

Myc (CGGACACACAACGTCTTGGAA / AGGATGTAGGCGGTGGCTTTT),

Mycn (CCTCCGGAGAGGATACCTTG / TCTCTACGGTGACCACATCG),

Cep55 (AAGGCAGAAGCAGACTCTTGGAGA / GTGGCGGACAGCTGGTTTTTCA and

TCGAGCTGGAAAAGAGAACAG / TGCTTCTCCACTTGAAGATAACC)

Organ/embryo isolation

Mouse organs were isolated using the Nikon SMZ45 stereo dissecting microscope (Nikon Inc, Tokyo, Japan). The isolated organs were washed in ice-cold Phosphate Buffered Saline (PBS). For protein or mRNA extraction, the samples were snap-frozen on dry ice. For histology staining, tissues were fixed in either the Bouin solution (pathology investigation) or 4% PFA (immunohistochemical staining) for 24–48 hours.

MEF establishment

MEFs were isolated from E13.5 embryos from Cep55^+/− inter-crosses for the constitutive MEF. Embryos were dissected into ice-cold sterile PBS, followed by removal of the internal viscera and head for genotyping. The remaining tissue was incubated in trypsin-EDTA (Sigma Aldrich, St Louis, USA) and disaggregated by mechanical shearing using a sterile scalpel blade. The dispersed tissues were further homogenized by trituration and transferred into 25cm² flasks (Corning) and allowed to adhere overnight. Primary MEFs were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM) (Life Technologies, Carlsbad, CA, USA) containing 20% Fetal Bovine Serum (SAFC Biosciences, Lenexa, USA) 1% penicillin-streptomycin (Life Technologies) and 1% Amphotericin B. Primary MEFs prior to passage 5 were used for experiments as indicated. Retroviral SV40 transfection was used for the immortalization of MEFs.

Cell culture

Mouse embryonic fibroblasts (MEFs) were generated as per extended methods. Retinal Pigment Epithelium (RPE-1) cells were obtained from the Diamantina Institute, UQ. Human neuroblastoma (SH-SY5Y) cell line was cultured in a 1:1 mix of DMEM and F-12 supplemented with NEAA (1%, non-essential amino acids), FCS (10%) and pen/strep (100 U/ml). Pluripotent stem cell line HES3 (WiCell) was maintained in mTeSR1 media (StemCell Technologies) and passaged every 4 days using ReLeSRTM as per manufacturer’s instructions (StemCell Technologies) and reseeded at 12,000 cells per cm² onto T25 cell culture flasks coated with Matrigel (Corning). All the cell lines were routinely tested for Mycoplasma infection by Scientific Services at QIMR Berghofer Medical Research Institute.

Cerebral brain organoid differentiation

Cerebral brain organoids were generated from single-cell dissociated HES3 pluripotent cultures according to previously described methods [53–55]. Briefly, single-cell suspensions were counted and seeded at 10⁴ cells per well of U bottom 96 well ultra-low attachment plates (Corning) in mTeSR1 media supplemented with 10 μM ROCK inhibitor and centrifuged at 300g for 3 minutes to allow for initial aggregation. The following day, media in each well was replaced with knockout serum replacement (KSR) media, consisting of DMEM/F12, 20% KSR, 1x Penicillin/Streptomycin, 1x Glutamax, 1x Non-essential amino acids and 0.1mM β-mercaptoethanol (Life Technologies). KSR media was supplemented with 2 μM Dorsomorphin and A83-01 (Sigma-Aldrich) and changed daily for the first 5 days of induction. Between days 5 and 6 of induction, media was changed at a 1:1 ratio with neural induction media consisting of DMEM/F12, 1x N2, 1x Glutamax, 1x Non-essential amino acids, 1x Penicillin/Streptomycin and 10μg/mL Heparin (Stem Cell Technologies) supplemented with 1 μM CHIR99021 and SB-431542 (Sigma-Aldrich). At day 7, media changes consisted only of neural induction media supplemented with 1 μM CHIR99021 and SB-431542 until day 14, at which point cultures were changed to neural differentiation media consisting of 1:1 base media of DMEM/F12 and Neurobasal, 1x Glutamax, 1x Non-essential amino acids, 1x N2 and B27 (with vitamin A) supplements, 1x Penicillin/Streptomycin, 0.05mM β-mercaptoethanol and 2.5μg/ml insulin (Life Technologies).

Doubling time assay

MEFs were plated in a 10 cm petri dish, at a density of 10⁵ cells per well, in triplicate for each genotype. Every second day, cells were collected, and the overall cell number assessed using a Countess automated cell counter (Life Technologies) for a total of 6 days.

Cell proliferation assay

Cells were seeded at a density of 5×10³ or 10⁴ cells per well in duplicate, and growth assessed using an IncuCyte S3 Live-Cell Analysis system (Essen BioSciences Inc, USA) Where treatments were performed, drugs were added the day following cell seeding.

Cell cycle analysis

Cells were plated in a 6-well plate in duplicate at a density of 10⁵ cells per well and harvested in trypsin-EDTA (Sigma Aldrich, St Louis, USA) at indicated time points and fixed in ice-cold Ethanol for 24 hours. Cells were stained in 1mg/mL of propidium iodide (Sigma Aldrich) and 15mg/mL RNAse A) at 37°C in the dark. DNA content was assessed using a FACScanto II flow cytometry (BD Biosciences, Mountain View, CA). The proportion of cells in G0/G1, S phase and G2/M were quantified using ModFit LT 4.0 software (Verity Software House, Topsham, ME, USA).

Live-cell imaging and microscopy

Live-cell imaging was performed on an EVOS Fl Auto (ThermoScientific) or Spinning disk confocal (Andor) microscope using MetaMorph Microscopy automation and image analysis software. Images were analyzed using analySIS LS Research, version 2.2 (Applied Precision).

Histopathological analysis and immunohistochemistry staining

For histopathologic investigation with hematoxylin and eosin (H&E), tissues were collected and fixed Bouin’s solution (Sigma-Aldrich, USA) for 48 hours and embedded in paraffin blocks. 5 μm–thick sections were prepared for H&E staining with a Leica Autostainer XL. For periodic acid–Schiff (PAS) staining, tissues were removed from mice and fixed in 4% PFA for 24–48 hours. Tissues were embedded in paraffin and wax-embedded tissues were sectioned at 5–10 μm and mounted on Superfrost Plus slides (Thermo Fisher Scientific) using the Sakura Tissue-Tek TEC (Sakura Finetek, Tokyo, Japan). The slides were then dewaxed and rehydrated by standard protocols.

Antigen retrieval protocol which was performed with 10 mM Sodium citrate buffer pH = 6.0 using a Decloaking Chamber NxGen (Biocare Medical, USA) for 15 minutes at 95°C. Sections were permeabilized and blocked in blocking buffer at RT for at least 1 hour (20% FBS / 2% BSA / 0.2% Triton X-100 in PBS. Primary antibodies were diluted in blocking buffer and incubated at 4°C overnight in a humidified chamber. Alexa-fluor-conjugated (Life Technologies) secondary antibodies were incubated at RT for 3 hours in a humidified chamber. Slides were mounted with Vectashield (Vector Laboratories, Burlingame, CA, USA) followed by cover-slipping using a Leica CV5030 (Leica Biosystems, Wetzlar, Germany) glass coverslipper and Shandon Consul-Mount mounting media (Life Technologies). Slides were scanned with Aperio Scanscope FL/XT (Aperio, Vista, USA) using 20X or 40X magnification and imaged with an LSM780 confocal microscope (Zeiss, Jena Germany) before analyzing with Image Scope software (Leica Biosystems, Buffalo Grove, IL, USA). Nuclei count v9 algorithm or Imaris (Bitplane Scientific Software, Belfast, United Kingdom) was used to score immuno-positive cells.

Immunofluorescence (IF)

For immunofluorescence (IF) assays, cells were counted and seeded at 5×10⁴ cells on sterile glass coverslips. For assessing cilia, MEFs were serum-starved for 48 hours prior to analysis. Where indicated, drugs were added 24 hours prior to fixation. Cells were fixed in 4% PFA (Sigma Aldrich, St Louis, USA) or ice-cold Methanol (100%) for the centrosomal protein in PBS for 20 minutes at RT and permeabilized in 0.1% TritonX-100 (Sigma Aldrich) for 10 minutes or 90 seconds (cilia experiments) and blocked in 3% or 1% (cilia experiments) bovine serum albumin (BSA; Sigma Aldrich) in PBS for 1 hour in a humidified chamber at RT. Coverslips were washed and incubated with Alexa-fluor-conjugated secondary antibodies (Sigma Aldrich) diluted in 3 or 1% BSA (1:1000) for 30 minutes at 37°C in a humidified chamber in the dark. Coverslips were mounted using Prolong gold anti-fade mounting medium (Life Technologies). Imaging was performed on a DeltaVision personal DV deconvolution microscope and DeltaVision Ultra (super-resolution) (Applied Precision, GE Healthcare, Issaquah, WA) and analyzed using the GE DeltaVision software package. Automated counting was performed using script modules of Fiji-ImageJ software (Java3D, Minnesota, USA).

Whole-mount immunostaining

Brain organoids were stained following a previously published protocol [56]. Briefly, organoids were fixed in 1% paraformaldehyde solution overnight at 4°C. After washing, organoids were incubated for 4 hours at room temperature in a blocking buffer consisting of 5% FBS and 0.2% Triton X in PBS. Organoids were incubated with primary antibodies (extended methods) in blocking buffer overnight at 4°C, followed by washing in blocking buffer and subsequently incubated with secondary antibodies and Hoechst (1:1000) overnight at 4°C. Organoids were again washed twice in blocking buffer at 4°C and subsequently mounted onto microscope slides using Prolong glass antifade mountant (Life technologies). Live imaging was carried out using an Andor WD Revolution spinning disk microscope to assess an increase in integrated viral GFP. Immunostained samples were imaged using a Zeiss 780-NLO confocal microscope. Four random fields of view were imaged per organoid and manually quantified using Fiji software.

Antibodies for immunostaining

Immunostaining was performed with the following primary antibodies: Ki67 1:500 (rabbit, NCL-ki67p; Novacastra, Wetzlar, Germany); mouse anti γ-tubulin (1:400, T5326 Sigma), rabbit anti γ-tubulin (1:400, T5192 Sigma), rabbit anti Arl13b (1:300, 17711-1-AP Proteintech), mouse anti α-tubulin (1:300, T5168 Sigma), mouse anti Arl13b (1:300, 75287, Antibodies Inc.), rabbit anti TBR1 (1:200, ab31940 Abcam), Monoclonal Anti-Acetylated Tubulin antibody produced in mouse clone 6-11B-1(Sigma Aldrich), rat anti TBR2 488 (1:200, 53-4875-80 eBioscience), rabbit anti phospho-histone3 (1:300, ab47297 Abcam), mouse anti PAX6 (1:200, DSBH), Cep55 (1:500; sc-374051Santa Cruz biotechnology), Pericentrin (1:1000; Covance, PRB-432C), β-Catenin (1:1000; Cell Signaling Technology, 9582), Cleaved Caspase-3 (1:500; 9664 Cell Signaling Technology), Tuj1 (TU20) (1:200, 4466s Cell Signaling Technology), GFP (1:500, AB290 Abcam), DAPI was used for the nuclear staining (D9564; MilliporeSigma). ApopTag staining was performed with an ApopTag peroxidase in situ apoptosis detection kit (S7100; MilliporeSigma, Billerica, MA, USA).

β-Galactosidase staining

Detection of β-Galactosidase Activity using LacZ reporter and X-gal Staining was performed as described by (Burn, 2012). X-gal (5-Bromo-4-chloro-3-indoxyl-beta-D-galactopyranoside, GoldBio) was used to detect reporter gene expression marked by a dark blue stain. Briefly, whole embryos/organs were dissected and fixed (4% PFA for 30 minutes) following by washing (three times with wash buffer (0.02% NP-40, 0.01% deoxycholate in PBS) and chromogenic staining with staining solution (5 mM K3Fe(CN)6, 5 mM K4Fe(CN)6, 0.02% NP-40, 0.01% deoxycholate, 2 mM MgCl2, 5 mM EGTA, 1 mg/mL X-gal in PBS) in the dark at 37°C overnight.

Gene transduction and transfection

For the generation of stable and constitutive cell lines with overexpression or knockdown of Cep55, we used Flag-CEP55 cloned into the pLenti PGK Hygro Dest vector (addgene#19066), or mouse small-hairpin RNAs (shRNAs) in the pLKO plasmid (Sigma Aldrich, St Louis, USA). Cells were transduced by spinfection for 1 h in the presence of Hexadimethrine bromide (Polybrene) (Sigma Aldrich, St Louis, USA) and media collected and filtered at 48 h and 72 h post-transfection. For human cell lines, constitutive CEP55-knockdown was performed as previously described [1]. The Selection of clones was performed using 400 μg/mL Hygromycin, 50 μg/mL Zeocin, 5 μg/mL Blastocydin (Life Technologies) or 5 μg/mL of Puromycin (Life Technologies). Transient Cep55 silencing was performed by reverse transfection using 10–20 nM of individual small interfering RNAs (siRNAs manufactured by Shanghai Gene Pharma, China) and Lipofectamine RNAiMAX (Life Technologies) for 48 hours.

Adenoviral shRNA infections

Cerebral brain organoids were infected with adenoviral shRNA viruses as per manufacturer’s instructions (Vector Biolabs). Two control and CEP55 adenoviral shRNAs were used: scrambled control Ad-U6-RNAi (cat# 1640), CMV driven Ad-GFP control (cat# 1060) and human CEP55 shRNA silencing adenovirus (cat# shADV-204994). Day 16 cerebral organoids were infected with the control and CEP55 adenoviral shRNAs at a MOI of 10. Organoids were harvested 24- and 48-hours post-infection to characterize knockdown of CEP55.

Retrovirus and lentivirus packaging and transduction

For the production of retrovirus or lentivirus, Phoenix Amphotropic (retrovirus) or HEK293T cells (lentivirus) were plated at 90% confluency in a T75 flask and transfected with 5 μg of DNA and 15 μL Polyethylenimine or PEI (Polysciences, Inc., 23966–2, POL) (1:3 ratio) in Optimum media. At 5 h post-transfection, media was changed and the packaging cells incubated for 72 hours. At 48 hours and 72 hours post-transfection, the media was filtered using a 0.45 μm filter onto target cells prior to spinfection (at 1000 X g for 1 h at 25° C) in the presence of hexadimethrine bromide (polybrene; Sigma Aldrich, H9268-5G). Media was removed after spinfection and cells were allowed to recover for the next 48 h before selection with the corresponding antibiotic was carried out to select for transduced cells. Antibiotic selection was sustained until an untransduced control plate of cells had all died.

Sequences for Cep55 siRNA and ShRNA

(5’-3’) Cep55_Scr (CCGGCGCTGTTCTAATGACTAGCATCTCGAGATGCTAGTCATT AGAACAGCGTTTTTT); Cep55_sh#2 (CCGGCAGCGAGAGGCCTACGTTAAACTCG AGTTTAACGTAGGCCTCTCGCTGTTTTTG); Cep55_sh#4 (CCGGGAAGATTGAATC AGAAGGTTACTCGAGTAACCTTCTGATTCAATCTTCTTTTTT); SiRNA (Cep55_Scr Sense (5’-3’): CAAUGUUGAUUUGGUGUCUGCA) and anti-sense (5’-3’): UGAAU AGGAUUGUAAC); SiRNA Cep55_SEQ1 Sense (5’-3’): CCAUCACAGAGCAGCC AUUCCCACT and anti-sense (5’-3’): AGUGGGAAUGGCUGCUCUGUGAUG GUA)

Cell and tissue lysate preparation

For preparation of tissue lysate, the organs were diced using a sterile scalpel blade followed by lysis in RIPA buffer (25mM Tris-HCl (pH 7.6), 150mM NaCl, 1% NP40, 1% Sodium deoxycholate and 0.1% SDS) or Urea lysis buffer (8M urea, 1% SDS, 100mM NaCl, 10mM Tris) and the samples were sonicated for 10 seconds on a Branson Sonifier 450 (Branson Ultrasonic Corporation, Danbury, CT, USA). Cell debris was removed by centrifugation at 13,000 RPM at 4°C for 30 minutes. Protein concentration was determined using a Pierce BCA Protein Assay Kit with Bio-Rad Protein Assay Dye Reagent (Thermo-Scientific). 30 or 60 μg of protein was resuspended in 1X laemmli buffer and samples heated to 95°C for 5 minutes prior to electrophoresis.

Western blot

Western blotting was performed as previously described [3]. (Prepared protein samples were subjected to electrophoresis at 120 V using the Bio-Rad Mini-PROTEAN Tetra system in SDS running buffer (25 mM Tris-HCl, 192 mM glycine, 0.1% SDS (v/v)). Gel transfer was performed using the Invitrogen X-cell SureLock transfer system at 80 V for 90 minutes in 1X transfer buffer (50 mM Tris, 40 mM Glycine, 20% methanol) onto Amersham Hybond nitrocellulose membrane (GE Healthcare, Waukesha, WI, USA), and transfer efficiency assessed by Ponceau S staining (0.1% (w/v) Ponceau S in 5% acetic acid). Membranes were blocked in blocking buffer (5% Skim milk powder (Diploma Brand) in PBS containing 0.5% Tween-20- PBS-T) for 1 hour on a shaker at RT followed by overnight incubation with primary antibodies at 4° C. The membranes were washed (3x PBS-T) and incubated in secondary antibodies for 1 hour. Protein detection was performed using Super Signal chemiluminescent ECL-plus (PerkinElmer, Waltham, MA, USA) on a BioRad Gel doc (Bio-Rad ChemiDoc Touch, USA).

Antibodies for Western blot

Cep55 (1:1000, In-house raised in rabbit against murine Cep55 (amino acids 55–250) and The Cell Signaling Technology, CEP55 (D1L4H) Rabbit mAb #81693 1:1000), Vinculin (1:2000; 13901 Cell Signaling Technology), β-Actin (1:2000, 612656 BD Pharmingen), β-Catenin (1:1000, 9582 Cell Signaling Technology), GSK 3β (1:1000, 9369 Cell Signaling Technology), pGSK 3β(Ser9) (1:1000, 9322 Cell Signaling Technology), Cleaved Caspase-3 (1:500, 9664 Cell Signaling Technology), pAKT(s473) (1:1000, 4060 Cell Signaling Technology), AKT (1:1000, 9271 Cell Signaling Technology), p Myc (T58) (1:1000, ab28842 Abcam), Non-phospho (Active) β-Catenin (Ser33/37/Thr41) (1:1000, 8814 Cell Signaling Technology), MYC (Y69) (1:1000, Ab32072Abcam).

Statistical analysis

The sample sizes were determined based on previously published studies that performed similar analyses using samples sizes that are widely accepted [57] and demonstrated to be sufficient to reveal differences in cortical phenotypes in organoids [58] and in vivo experiments [48,59]. The sample size for in vivo embryonic analysis of developing neocortex was 4/ group which can detect differences of 2.38 standard deviations with 80% power. Two-tailed unpaired or paired Student’s t-test, one-way (Kruskal–Wallis test) or two-way ANOVA with post hoc Bonferroni, log-rank testing was performed as indicated using Prism v8.0 (Graph Pad Software, La Jolla, CA, USA) and the P-values were calculated as indicated in the figure legends. Mean and standard error of mean (Mean ± SD) are used to describe the variability within the sample in our analysis. ns; P > 0.05; *P ≤ 0.05; **P ≤ 0.01, ***P ≤ 0.001, and ****P ≤ 0.0001.