Figures
Abstract
Background
The Inositol 1,4,5-trisphosphate receptor (InsP3R) is an InsP3 gated intracellular Ca2+-release channel. Characterization of Drosophila mutants for the InsP3R has demonstrated that InsP3-mediated Ca2+ release is required in Drosophila larvae for growth and viability.
Methodology/Principal Findings
To understand the molecular basis of these growth defects a genome wide microarray analysis has been carried out with larval RNA obtained from a strong InsP3R mutant combination in which 1504 independent genes were differentially regulated with a log2 of fold change of 1 or more and P<0.05. This was followed by similar transcript analyses from InsP3R mutants where growth defects were either suppressed by introduction of a dominant suppressor or rescued by ectopic expression of an InsP3R transgene in the Drosophila insulin like peptide-2 (Dilp2) producing cells.
Conclusions/Significance
These studies show that expression of transcripts related to carbohydrate and amine metabolism is altered in InsP3 receptor mutant larvae. Moreover, from a comparative analysis of genes that are regulated in the suppressed and rescued conditions with the mutant condition, it appears that the organism could use different combinations of pathways to restore a ‘normal’ growth state.
Citation: Kumar S, Dey D, Hasan G (2011) Patterns of Gene Expression in Drosophila InsP3 Receptor Mutant Larvae Reveal a Role for InsP3 Signaling in Carbohydrate and Energy Metabolism. PLoS ONE 6(8): e24105. https://doi.org/10.1371/journal.pone.0024105
Editor: Michael N. Nitabach, Yale School of Medicine, United States of America
Received: October 7, 2010; Accepted: August 4, 2011; Published: August 25, 2011
Copyright: © 2011 Kumar et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This work was supported by research fellowships from the University Grants Commission (http://www.ugc.ac.in) to Satish Kumar and the Department of Biotechnology (http://dbtindia.nic.in/index.asp) to Debleena Dey. The project was supported financially by grants from the Department of Biotechnology (http://dbtindia.nic.in/index.asp), and the National Centre for Biological Sciences, Tata Institute of Fundamental Research(http://www.ncbs.res.in). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: The authors have declared that no competing interests exist.
Introduction
The efficient survival of multicellular organisms requires physiological co-ordination between cells, tissues and various organs. This co-ordination is achieved through signaling pathways some of which evolved in parallel with multicellular complexity. Release of calcium (Ca2+) from intracellular stores appears to be such a signaling pathway that co-evolved with metazoan life forms suggesting that it might be an important modulator of basic physiological pathways [1]. Our understanding of how intracellular Ca2+ signaling modulates systemic physiology however remains cursory. Intracellular Ca2+-release in response to inositol 1, 4, 5-trisphosphate (InsP3) signals occurs through a ligand-gated Ca2+ channel, the InsP3 receptor (InsP3R) present on the membranes of intracellular Ca2+ stores, primarily in the endoplasmic reticulum (ER). Vertebrate genomes have three genes for the InsP3R for which knock-outs have been generated in the mouse model [2], [3]. Among these, the InsP3R1 knock-out animals are lethal to a large extent. Analysis of the few survivors obtained showed growth defects and ataxia [3]. In the InsP3R2 and 3 knock-outs exocrine secretion is defective resulting in feeding defects [2].
The Drosophila genome contains a single gene for the InsP3R (itpr), making it an attractive genetic model for understanding systemic roles for InsP3-mediated Ca2+ release. There are several well characterized itpr mutant alleles of which the stronger alleles are larval lethal and exhibit severe growth defects prior to lethality [4], [5]. In order to understand the molecular basis of these growth defects we have carried out a series of transcriptional profiling experiments from itpr mutant animals in the absence and presence of either an extragenic suppressor or a rescuing transgene. The suppressor is the Ca-P60AKum170ts mutant allele for the Drosophila sarco-endoplasmic reticular Ca2+-ATPase (SERCA), referred to as Kum170 throughout this paper [6]. Kum170 reduces the rate of Ca2+ uptake by the ER at 25°C in Drosophila neurons [7] and thus suppresses itpr mutant alleles by altering the dynamics of intracellular Ca2+ signals. The rescued condition has been described earlier and consists of expression of an itpr+ cDNA transgene in insulin-producing cells (IPCs) of the brain [4]. In vertebrates changing levels of growth hormones and growth factors like the Insulin-like Growth Factors (IGFs) strongly affect body and organ size. In Drosophila there is no functional separation between insulin-like growth factors and insulin signaling. Thus a single insulin/IGF system manages growth and energy metabolism. The cellular and molecular basis of rescue of itpr mutants by expression of the itpr+ cDNA in Drosophila IPCs remains to be understood.
Here, we characterized the transcriptional profile of itpr mutant larvae just prior to the manifestation of growth deficits, followed by a comparison of these changes in transcripts from suppressed and rescued mutant animals. Our data show that growth deficits are preceded by significant changes in gene expression and support a link between intracellular calcium signaling and energy metabolism. Reversal of the growth deficit either by suppression or rescue has helped identify candidate pathways and genes that might function downstream of intracellular Ca2+ release.
Materials and Methods
Drosophila melanogaster strains
itprsv35/ug3 is a larval lethal heteroallelic combination of single point mutants in the itpr gene generated in an ethyl methanesulfonate (EMS) screen. Detailed molecular information on these alleles has been published [5]. The embryonic wild-type itpr cDNA (UASitpr+) [8] was used for rescue experiments and Ca-P60AKum170ts [6], [9] was used as a suppressor. The dOrai20119 allele (referred to as dOrai2) was procured from the Bloomington Drosophila Stock Center [10]. Dilp2GAL4 used for the rescue experiments was from Dr. E. Rulifson [11]. The wild-type Drosophila strain used in all experiments is Canton-S (CS). Fly strains were generated by standard genetic methods using individual mutant and transgenic fly lines described above. Flies were grown at 25°C in standard cornmeal medium containing agar, corn flour, sucrose, yeast extract along with anti-bacterial and anti-fungal agents.
Larval staging
Staging experiments for obtaining molting profiles of heteroallelic mutant larvae were carried out as described previously with minor modifications [5]. Briefly, flies were allowed to lay eggs for a period of 8 hrs at 25°C. Embryos were allowed to hatch and grow further at this temperature. Larvae of the desired genotype were selected from these cultures at 56–64 h after egg laying (AEL) and transferred into vials of standard cornmeal medium lacking agar (agar less medium). Larvae were grown in agar less medium at 25°C and screened at the indicated time points for number of survivors and their phase of growth and development. For each time interval, a minimum of 75 larvae were screened in batches of 25 larvae each. Computation of means, SEM, and t-tests were performed using Origin 7.5 software (Origin Lab, Northampton, MA, USA).
RNA isolation for microarray and qPCR
For isolation of total RNA, larvae of the requisite genotypes were selected at 58–62 hr AEL and snap frozen in liquid nitrogen. Total RNA was isolated using TRI Reagent (Sigma, St. Louis, USA) according to manufacturer's specifications. After quantification, RNA with a ratio of OD260/OD280>1.8 was taken for further experiments. Integrity of the isolated RNA was confirmed by the presence of full length rRNA bands on a 1.2% formaldehyde agarose gel. For microarrays three independent sets of RNA were isolated from control (CS), mutant (itprsv35/ug3) and rescued larvae (UASitpr+/+; Dilp2GAL4/+/ug3; referred to as rescue) and two sets of RNA from Kum170ts suppressed larvae (Kum170ts/+; itprsv35/ug3; referred to as suppressor). For qPCR three independent sets of RNA were isolated from all genotypes tested.
Microarrays
Further quality control of isolated RNA, labeling of RNA probes with either cyanine 3-dUTP (Cy3) or cyanine 5-dUTP (Cy5), their hybridization to one Drosophila 8*60 K array AMADID: 27326 (Agilent Technologies Inc., Santa Clara, CA, USA) consisting of 8 replicate 60 K microarrays, scanning of signal intensities and analysis plus normalization of signal intensities were carried out by Genotypic Technology, Bangalore, India. Details of the numbers of probes present on the 60 K microarray are given in Table 1. Approximately 6000 EST probes could not be matched to existing CG IDs in FlyBase [10]. The experiments consisted of three arrays hybridized with control and mutant RNA (mutant), three arrays hybridized with mutant and Dilp rescue (rescue) and two arrays hybridized with mutant and Kum suppressor (suppressor) conditions. Independent sets of larvae were collected and used to isolate RNA for each of the hybridizations. The biological replicates were tested for reproducibility using the Pearson's correlation protocol from Microsoft Office Excel 2003. Correlation coefficients for biological replicates were>0.6 in all cases (Table 2). All data obtained is MIAME compliant and raw hybridization data from the microarray have been submitted to the Gene Expression Omnibus database (http://www.ncbi.nlm.nih.gov/geo) under series GSE29736.
Data analysis
Data analysis was performed using GeneSpring GX7.3.1 software (Silicon Genetics, Redwood City, CA, USA). Differentially regulated genes were ranked on the basis of signal intensity, normalized ratio, flag value and variance across biological replicate experiments. Top ranked genes had a higher intensity; high-normalized ratio for up and low for down; they were unflagged and showed very low variance or standard deviation. The normalized signal intensity of all filtered genes was taken for calculating log2 of the fold change in all experiments. The default multiple test correction in GeneSpring GX is the Benjamini and Hochberg False Discovery Rate protocol which provides a good balance between discovery of statistically significant genes and limitations of false positive occurrences. This, combined with a t-test performed at the 0.05% significant level for each gene, was used for calculating the final P-values. With this protocol the genes identified by chance (false discovery rate) is 5% of genes that are considered statistically significant.
Annotations of biological processes, molecular function and cellular localization were obtained using publicly available Gene Ontology information (The Gene Ontology Consortium) [12] uploaded to GeneSpring GX7.3.1 software and the publicly available DAVID database [13], [14] and FlyBase [10]. For comparison with published microarrays, lists of regulated genes with CG IDs were downloaded. Numbers of common genes were obtained by comparing the CG IDs from published data with our data using GeneSpring GX.
Reverse Transcription-PCR (RT-PCR) and Real time PCR (qPCR)
Total RNA (1 µg) was reverse transcribed in a volume of 20 µl with 1 µl (200 U) Moloney murine leukemia virus (M-MLV) reverse transcriptase (Invitrogen Technologies, Carlsbad, CA, USA) using 1 µl (200 ng) random hexaprimers (MBI Fermentas, Glen Burnie, MD, USA) containing 1 mM dithiothreitol (DTT) (Invitrogen Technologies, Carlsbad, CA, USA), 2 mM of a dNTP mix (GE HealthCare, Buckinghamshire, UK) and 20 U of RNase Inhibitor (Promega, Madison, WI, USA) for 1 h at 42°C. The polymerase chain reactions (PCRs) were performed using 1 µl of cDNA as a template in a 25 µl reaction volume under appropriate conditions. Real-time quantitative PCR (qPCR) were performed on the Rotor-Gene 3000 (Corbett Research, Australia) operated with Rotor Gene software version 6.0.93 using MESA GREEN qPCR MasterMIX Plus for SYBR® Assay I dTTp (Eurogentec, Belgium). Experiments were performed with rp49 primers as internal controls and primers specific to the gene of interest, using serial dilutions for the cDNA of 1∶10, 1∶100 and 1∶1000. Sequences of the primers used in the 5′ to 3′ direction are given below. Sequence of the forward primer is given first in each case.
rp49 CGGATCGATATGCTAAGCTGT; GCGCTTGTTCGATCCGTA,
CG2650 GCTCATCCTGCCCATTGTCA; TGGTTCAGCACCTTCAGCGT,
unc-119 CGAGTTTCCTAACCTTCCACC; GGCGTAGTCGGCTTTGTTGT,
CG9698 CCAGAGGTATCTTGGATGGAG; TCATTCAGACCACGGAAGTCC,
rib CGACACACCCATCCTGAGAA; TCGCCTCCACTTACTCCCAA,
Cyp12d1-d GATGGTATTCCGCAACGAGGG; ATCGTAGTTTTCCCCATGCCTC,
DAT CATGGCCCACACACTGGGT; GATCTTGGGAAACTCGTCGCTC,
Idgf4 TCCTGCCCAATGTGAACTCTTCG; TCAGCTCGTAGATCGGTGCC,
l(2)dtl AAGGAGAAGGTGGACTGGCTGA; GGATTGGGAATGGGAGTGCGA,
pan TGCGTGCTAAGGTTGTTGCTG; CATTGGTATCTTGCTTCCGCTTC,
Aldh GAAACCATCAACCCGACCAC; ACATGCTGTAGGGCTTGCC,
ng2 TCCTCGGCTGTGTGATGATCC; GTGAGGCTGTTGTTGTGGTGG.
Each qPCR experiment was repeated three times with independently isolated RNA samples. Cycling parameters were 95°C for 5 min, 40 cycles of 95°C for 15 s and 60°C for 30 s, 72°C for 30 s, then 1 cycle of 72°C for 5 min. The fluorescent signal produced from the amplicon was acquired at the end of each polymerization step at 72°C. A melt curve was performed after the assay to check for specificity of the reaction. The fold change of gene expression in the mutant relative to wild-type was determined by the comparative ΔΔCt method [15]. In this method the fold change = 2−ΔΔCt where ΔΔCt = (Ct(target gene) –Ct(rp49))mutant− (Ct(target gene) − Ct(rp49))Wild type.
Results
Growth defects in strong InsP3R mutants can be suppressed by reducing Ca2+ uptake into the endoplasmic reticulum Ca2+ store
Strong hypomorphic alleles of the Drosophila itpr gene exhibit severe growth defects prior to lethality [4]. To understand the molecular changes and Ca2+ signals underlying these growth defects a dominant loss-of-function allele for the Sarco-endoplasmic reticulum Ca2+ ATPase (referred to as Kum170) was introduced in the lethal itpr heteroallelic mutant combination of itprsv35/ug3. Previous studies have shown that the Kum170 mutant allele can partially suppress phenotypes of weak itpr mutant alleles that arise during pupal development [9]. The cellular basis of this suppression is apparently elevated basal cytosolic Ca2+, which was measured in primary cultured neurons of the Kum170/+ allele [7]. The elevation of basal Ca2+ observed is most likely due to a reduced rate of Ca2+ uptake from the cytosol to the ER store. In itpr mutant animals with one copy of the Kum170 allele (Kum170/+; itprsv35/ug3), a significant increase in larval viability was observed as compared with itpr mutants on their own (Figure 1A). The viable larvae grew to a size comparable to wild-type and a few pupated and eclosed as adults (Figure 1B). In contrast to Kum170, there was no significant suppression of growth and viability of itprsv35/ug3 animals by the allele dOrai2/+ either on its own or in combination with Kum170/+ (Figure 1A and B). The dOrai2/+ allele is a gain-of-function allele for the Drosophila store-operated Ca2+ channel and suppresses itpr mutant phenotypes that arise during pupal development [7]. Since the Kum170 allele was a more robust suppressor of growth and viability in itpr mutant larvae it was used in subsequent experiments.
(A) Number of surviving animals of the indicated genotypes and stages obtained at the specified times after egg laying. As compared to wild-type (Canton-S or CS), itpr mutant organisms (itprsv35/ug3) are lethal. Two potential suppressor alleles, Kum170 and dOrai2, were tested for suppression of lethality in itprsv35/ug3. Results are expressed as mean survivors ± SEM and * indicates significance with P<0.01 (t-test). (B) Sample photographs of viable organisms of the indicated genotypes. dOrai2 suppresses growth defects of itprsv35/ug3 to a greater extent at 60 hrs after egg laying as compared with Kum170. However, this effect does not persist and at 120 hrs hours after egg laying growth defects are suppressed more effectively by Kum170. A few adults with outspread wings, a phenotype reminiscent of viable itpr mutants, eclose from itprsv35/ug3 pupae in the presence of Kum170.
Transcriptional profiling of itprsv35/ug3
To understand the molecular changes underlying growth defects in itprsv35/ug3 and their suppression a series of microarray experiments were performed. Initially, we obtained the transcriptional profile of RNA isolated from whole itprsv35/ug3 larvae, just before growth defects are evident (at 60 hrs after egg laying or AEL), and compared this with larvae of the wild-type Canton-S strain, in which genetic background the itpr mutants were originally generated. This experiment was repeated with three biological replicates and genes that were up and down-regulated (log2 fold change≥1; P<0.05) in itprsv35/ug3, represented as red dots, are shown in the volcano plot in Figure 2A. Yellow dots represent genes that were not altered significantly by the above criteria. Amongst the 1504 independent genes that crossed this stringency threshold, 768 were up-regulated (right) and 736 were down-regulated (left). A complete list of these genes with individual hybridization intensity values and fold changes is given in the supplementary data (Table S1).
(A) A volcano plot of the expression level of all genes in itprsv35/ug3 as compared with wild-type. The X-axis defines the magnitude of the difference in expression between the mutant and the control state while the Y-axis defines the P-value of the observed change. Red dots represent genes whose expression was altered by one fold up or down upon taking log2 of the normalized expression ratios (X axis) with P<0.05 (−log10 of P value on the Y axis; −log10 of 0.05 = 1.3, horizontal blue line). (B) Gene Ontology (GO) classification of up-regulated and down-regulated genes in the listed categories. The X-axis represents the number of genes in the mutant in the marked category. Right panels indicate up-regulated genes and left panels indicate down-regulated genes. Only functional categories with P<0.05 are shown. * indicates functional categories with P<0.01.
To identify specific pathways affected by reduced InsP3 receptor function genes with significantly altered transcription profiles were classified into established Gene Ontology (GO) categories. Groups of genes under a similar category whose numbers were significant (P<0.05) are depicted in the bar graphs in Figure 2B and C. Categories with higher significance (P<0.01) are marked with asterisks. In the mutant UP state 358 genes could be classified in various GO categories for biological processes (Table S2, BP), while in the mutant DOWN state 369 genes could be classified similarly (Table S2). From this analysis itprsv35/ug3 larvae show the greatest perturbation in genes affecting carbohydrate and amine metabolism. Genes affecting these two biological processes are both up-regulated and down-regulated and hence were analyzed further by placing them in metabolic pathways using the KEGG database. Down-regulated genes that classified under carbohydrate metabolism included Aconitase (TCA cycle), Enolase (Glycolysis), Zwischenferment (Pentose phosphate pathway) and several genes in galactose metabolism, indicating a reduction in the energy flux in itpr mutants. Up-regulated genes in carbohydrate metabolism were primarily in starch and sucrose pathways (e.g. amylase, maltase) and in amino sugar metabolism (chitinase). The chitinases overlap with genes up-regulated in amine metabolism. This group also includes enzymes that fall in pathways of tryptophan, arginine and proline metabolism. Amine metabolism genes that are down-regulated include several t-RNA synthetases and two enzymes affecting the one carbon pool by folate, another pathway that feeds into energy metabolism. Amongst other classes of up-regulated genes, of interest are a set affecting circadian rhythms, which include clock, cycle, cry, dopamine transporter (DAT), serotonin receptor 1A (5HT1A) and norpA. Some of these fall under other GO categories listed. For example clock and cycle are part of the list under positive regulation of transcriptional regulation, while norpA (encoding phospholipase Cβ) also comes under phospholipid metabolism. Genes encoding proteins regulating secretion and exocytosis such as Synoptagmin 1, Synoptagmin 7, Synapsin, and Calcium activated protein for secretion (Caps) are also up-regulated. In the set of genes significantly down-regulated under the translation category are several ribosomal proteins including mitochondrial ribosomal proteins. As expected from earlier findings genes belonging to the molting cycle are also down-regulated [16]. Next, genes differentially regulated in itpr mutant larvae were re-analyzed with GO terms for cellular compartments (CC) and molecular functions (MF) (Fig 2C, Table S2). The largest number of down-regulated genes localized to mitochondria supporting an early effect of reduced InsP3 receptor function on mitochondrial function and energy metabolism.
Biological classification of differentially regulated genes in itpr mutants by transcriptional profiling after suppression of growth defects
To identify pathways and genes likely to impact growth and viability most significantly, we measured whole genome transcript levels from RNA of itpr mutant larvae with a suppressor allele (Kum170/+; itprsv35/ug3) and compared them to transcript levels in the itpr mutant (itprsv35/ug3; Figure 3). To make this differential analysis more rigorous in parallel we carried out a comparison of RNA obtained from itpr mutant larvae rescued by expression of a UASitpr+ transgene in Drosophila insulin-like peptide producing cells with Dilp2GAL4. These larvae exhibit normal growth similar to Kum170/+; itprsv35/ug3 animals [4]. Both rescue and suppressed conditions restored expression levels of a significant number of genes altered in itprsv35/ug3 (Figure 3; log2 fold change ≥1 and P<0.05). The heat maps show differential expression levels of genes in the itpr mutant when compared to wild-type (first column in Figure 3A and C). This was followed by comparison of expression levels in itprsv35/ug3 with either the Dilp2GAL4 rescue (second column) or suppression by Kum170 (third column) conditions. A complete list of these genes with individual hybridization intensity values and fold changes is available in the supplementary information for Kum170 (Table S3) and for Dilp2GAL4 rescue (Table S4). The numbers of genes whose expression levels returned towards the wild-type in the rescue or suppressed condition are depicted in the Venn diagrams (Fig 3B and D). A complete list of these genes with individual hybridization intensity values and fold changes is available in the supplementary information (Table S5).
The first column of the heat map in A shows the level of 768 up-regulated genes in mutant (log2 fold change ≥1 and P<0.05) and correspondingly their level in rescue (UASitpr+/+; Dilp2GAL4/+; itprsv35/ug3) and suppressed conditions (Kum170/+; itprsv35/ug3). Orange depicts up-regulation and black depicts down-regulation. The Venn diagrams (B) give the numbers of genes that overlap with up-regulated genes in the mutant and down-regulated in the rescue and suppressor individually. (C) Down-regulated genes (736) in the mutant (log2 fold change ≥1 and P<0.05) and their level of regulation in rescue and suppressed conditions with the corresponding Venn diagrams (D). Complete lists for up-regulated and down-regulated genes in mutants including one's that are rescued or suppressed are attached as supplementary information (Table S3, S4). E) GO classification of regulated genes in the suppressed and rescued condition (log2 fold change ≥1 and P<0.05) that are common with the mutant. The X-axis represents the number of genes in the suppressed and rescued condition in the marked category. Right panels indicate up-regulated genes and left panels indicate down-regulated genes. Biological processes with P<0.05 are shown. * indicates functional categories with P<0.01. Complete lists of these gene names are given in Tables S6 (suppressor) and S7 (rescue).
To understand which biological processes are responsive to rescue/suppression transcriptionally altered genes in these conditions were classified into functional categories. As shown in Figure 3E the suppressed condition significantly (P<0.05) up-regulated expression level of genes for lipid and pyruvate metabolism, defense and stress responses. In the rescue condition different biological classes were up-regulated of which only defense response is common with the suppressed condition. Similarly for the down-regulated genes in suppressed and rescued conditions very few common processes were discovered. A similar analysis for GO categories that were suppressed and rescued both under cellular components and molecular functions also gave very few common components or functions (Figure S1). The complete lists of the genes in these GO categories are listed in Table S6 and S7. Taken together these observations suggest that suppression and rescue effect different processes to restore “normal” function.
Next we identified genes that were further up or down-regulated in the suppressed and rescued conditions. Among the up-regulated genes in mutants, 153 in the rescued condition and 85 in the suppressed condition were further up-regulated (Table S5). A total of 69 genes were up-regulated further in BOTH rescue and suppressed conditions (Table S5). The number of down-regulated genes in mutants that were further down-regulated in either suppressor or rescue was considerably fewer (Table S5). In this class there were 14 genes in rescue and 3 in the suppressor. None of these were common between the two conditions. A possible interpretation of this observation is that transcriptional up-regulation in itpr mutants is a compensatory mechanism which is further enhanced for some genes in the rescue and suppressed conditions. Genes that are down-regulated may be causative. Taken together these analyses suggest that rescued and suppressed conditions do not necessarily help the animal revert to its “normal” wild-type state.
The analyses so far helped to identify pathways that are differentially regulated in the various conditions tested. Next, we identified individual genes that may or may not cluster significantly in a GO pathway but whose expression is restored towards wild-type levels by a log2 fold change of 1 or more and P<0.05 in both rescue and suppressed conditions. Of the 15 genes identified in the UP mutant and DOWN rescue and suppressed states, 5 are predicted to effect oxidation-reduction processes and metabolism. There is one transcription factor (ribbon) known to effect development and up-regulated in larvae fed on a protein deficient diet of sugar only [17]; an alkaline phosphatase encoding gene (CG8147) which has earlier been identified as regulated by starvation and circadian rhythms [18], [19]; a circadian clock controlled gene CG2650, which is also regulated by altered mitochondrial function [20]. In the remaining genes, 5 were of unknown function, while the functions predicted for others are microtubule based movement (CG10859) and proteolysis with a possible role in immune function (CG18180; Table 3). CG1659, the Drosophila homolog of the C.elegans gene unc119 has no known function but is highly expressed in the embryonic, larval and adult nervous system [10]. Among the genes of unknown function three (CG18180, CG17974 and CG12934) are up-regulated when larvae are nutrient deprived [17]; in addition CG12934 is up-regulated under starvation, while CG18180 is up-regulated by altered mitochondrial function [20]. Genes that were down-regulated in the mutants and whose expression was restored in the rescue and suppressed condition are shown in Table 3. Of the 16 genes identified in the DOWN mutant and UP rescue and suppressed states, two (CG32601 and pangolin) are transcriptional regulators of which pangolin is a repressor of Wnt signaling [21], l(2)dtl has homology with a ubiquitin ligase binding protein and is predicted to function in cell cycle regulation [22], [23] and insulin like peptide 5 is one of the Drosophila insulin peptides that function in metabolic control of energy utilization [24]. Two genes code for serine-type endopeptidases (CG33459 and CG12385). Of these CG33459 is up-regulated by JAK/STAT activation [25] and CG12385 is down-regulated by starvation and stress [17], [26]. From the predicted functions of three other genes (CG3752, CG13325, CG8525) it is likely that these affect different aspects of metabolism. Previous microarray data from related conditions has shown that they are down-regulated as follows; CG3725 under starvation [17], CG13325 in larvae fed on sucrose only [17] and CG8525 in an insulin signaling mutant (dFOXO; 26). Seven genes in this group are of unknown function. Among these CG8317 is also down-regulated in sucrose fed larvae, though it is up-regulated under starvation [17].
Validation of selected target genes identified by the microarray screens and their normal tissue specific expression
Quantitative real-time PCR (qPCR; Figure 4) was carried out to validate the altered expression level of selected genes that underwent significant changes in the mutant. In these experiments we tested candidates that were differentially regulated in rescued and suppressed conditions, as well as other genes that were of potential interest amongst the genes identified in the mutant condition only. Unlike the microarray where rescue and suppressed conditions were compared with mutant, here we quantified the expression levels of all conditions with RNA extracted from wild-type. Amongst the up-regulated genes we validated six genes in mutant, rescue and suppressor conditions, each of which was a candidate from a different biological process. In the rescue and suppressed conditions the expression level of two genes (CG2650 and CG1659) was down-regulated when compared with the mutant, but remained high when compared with RNA from wild-type. The remaining four up-regulated genes validated in mutants were all down-regulated compared to wild-type. These included Cyp12d1-d (CG33503) and DAT (dopamine transporter with a neuronal function; CG8380; Fumin). In the microarray, DAT is regulated similarly but was filtered out due its higher P value. Amongst genes that were down-regulated in the mutant condition we tested l(2)dtl (CG11295), Idgf4 (CG1780), pangolin (CG34403) and CG3752, all of which were validated as down-regulated in mutant and up-regulated in suppressor and rescue conditions by qPCR (Figure 4). Due to the filtering cut offs Idgf4 does not appear in Table 3. To begin understanding the functional significance of these transcriptional changes the expression level of a subset of genes was also assessed in the brain and fat bodies of third instar larvae (Figure 5). Both these tissues have a central role in the control of energy metabolism in Drosophila and are known to express itpr transcripts at moderate levels [8], [10]. The genes tested were l(2)dtl and DAT which were found to be brain enriched, cyp12d and ng2 which were enriched in the fat body and Idgf3 and Idgf4 which were expressed in both tissues. ng2 and Idgf3 were included since both are down-regulated significantly in mutants and up-regulated in the rescue condition. They were filtered out from the genes in Table 3 since they do not show a significant change in the suppressor.
The Y-axis represents the log2 of fold changes which were calculated by the ΔΔCt method in which the Ct values of each gene were normalized to the level of a housekeeping gene (rp49) in control RNA from CS larvae. Each value is the mean ± SEM of three independent experiments, obtained from three independent RNA samples. The rescued and suppressed values were tested for significant difference from the mutants by Students t-tests followed by a Bonferroni correction for multiple tests. Except for CG2650 and unc119 all other genes were significantly altered (P<0.01).
Expression of candidate genes identified from the microarray analysis was tested in RNA from brains and fat bodies of third instar larvae by RT-PCR.
Discussion
Signaling through the InsP3 receptor and intracellular Ca2+ release are thought to affect multiple physiological conditions in mammals [27]. However, the underlying molecular mechanisms regulated or controlled by InsP3-mediated Ca2+ release in the context of specific physiological conditions still need elucidation. The genome-wide microarray analysis reported here with existing well-characterized InsP3R mutants has allowed us to investigate this question in the context of growth. From the gene ontology and pathway analyses of gene expression changes in the strong itpr mutant studied here, it is clear that metabolic genes particularly those related to carbohydrate and amine metabolism are significantly altered. The underlying cause(s) of these metabolic changes is of interest. One possibility, partially supported by our data as well as recent evidence from other groups [28] is a change in mitochondrial bioenergetics leading to subsequent effects on metabolic pathways. In the itpr mutant condition 50 down-regulated genes cluster in the mitochondrion (Fig 2; CC) and a highly significant number (P = 3.2E−5) have the molecular function (MF) of oxido-reduction. A set of genes classified as oxidoreductases are also up-regulated. However, these are primarily for detoxification and xenobiotic responses and are presumably up-regulated as a compensatory stress mechanism.
Microarray studies in Drosophila with nutritionally altered, stress and mitochondrial mutant (tko) conditions have been published [17], [20], [26]. Therefore, we compared the list of up-regulated and down-regulated genes in our study with published gene lists for microarrays in what appear to be related conditions. In this analysis the maximum overlap obtained was between genes up-regulated in itprsv35/ug3 larvae with larvae undergoing starvation, followed by larvae grown on sugar alone (i.e. protein deficient), followed by the mitochondrial mutant tko (Figure 6A). The correlation with starvation conditions is not surprising since one of the earliest phenotypes of itprsv35/ug3 larvae is reduced feeding [4]. The change in circadian rhythm genes observed in the mutant condition may also be related to the feeding changes since circadian cycles are thought to integrate feeding and metabolic functions [29]. Even so the response of itprsv35/ug3 larvae does not correlate directly with either starvation or protein deficiency conditions or mitochondrial dysfunction, indicating that the transcriptional response to reduced intracellular Ca2+ release is complex (Figure 6B). Interestingly, the response of groups of genes that overlap with starvation, protein deficient and mitochondrial mutant conditions revert in the rescued and suppressed conditions (Figure 7). As suggested from Table S7, however, the extent of reversion differs in the two conditions, supporting the idea that the physiological states of rescued and suppressed larvae are different. In the rescued condition the itpr cDNA is expressed in a limited set of neuronal cells, while in the suppressed condition the dominant mutant for Ca-P60AKum170ts affects the whole organism. Since the rescuing neurons are known to secrete several insulin-like peptides, which regulate cellular physiology through a pathway that acts via the transcription factor dFOXO, we also compared our data with microarray data from a Foxo mutant combination [30]. We do not observe a correlation with dFOXO regulated genes. Thus the transcriptional changes observed in itprsv35/ug3 must involve other gene regulatory factor(s) that are either directly responsive to changes in intracellular Ca2+ or the altered metabolic state of the organism. We analyzed our gene lists for possible candidates and identified ribbon (CG7230), pangolin (CG34403) and l(2)dtl (CG11295) as potential regulators of gene expression. None of these molecules appear to have a motif that would make them directly responsive to Ca2+ changes, suggesting that their regulation is indirect. The precise mechanisms of their regulation in itpr mutants need further study. Interestingly, ribbon is up-regulated in protein–deficient larvae, suggesting that in addition to its established role in regulation of development it could be a metabolic regulator [17]. No data are available at this stage to support a role for pangolin and l(2)dtl in the regulation of energy metabolism. Since pangolin is best known as a negative regulator of wingless signaling, we searched among the genes regulated in itprsv35/ug3 mutant for other components of the wingless pathway (Table S1). wnt5 was up-regulated by a log2 fold change of 0.6 to 0.9 and marginally down-regulated in both suppressor and rescue conditions. In vertebrates, Wnt5 has been implicated in InsP3R activation during development [31]. l(2)dtl mutants in Drosophila are lethal as embryos and l(2)dtl transcripts are up-regulated under heat-shock [32]. The molecular function of l(2)dtl has not been investigated in Drosophila. In mouse the l(2)dtl homolog is known as CTD2. Several independent studies have shown that it plays an important role in cell proliferation through regulation of a G2/M checkpoint [22]. A functional analysis of these genes needs to be carried out in Drosophila itpr mutants. This will help validate their potential regulation by InsP3 mediated intracellular Ca2+ signaling and also in understanding how developmental pathways impact growth and metabolism.
(A) The list of genes significantly (P<0.05) up-regulated and down-regulated in mutant larvae were compared to gene lists obtained from selected published reports for larvae grown on sugar (protein deficient), under starvation, mutants for dFoxo and tko, and stress changes. Numbers of overlapping genes between these published conditions and those up-regulated and down-regulated in itpr mutants are listed in red and green square boxes. (B) Venn diagrams with the numbers of overlapping genes among the indicated conditions.
Box plots show the expression levels of genes common between itpr mutants and the indicated categories from figure 6. For genes up-regulated in mutants these include 93 genes for starvation up, 35 genes for starvation down, 76 genes for sugar up, 81 genes for sugar down, 49 genes for tko up and 20 genes for tko down. For genes down-regulated in mutants these include 71 genes in starvation up, 93 genes in starvation down, 75 genes in sugar up, 120 genes in sugar down, 17 genes in tko down and 37 genes in tko up.
Supporting Information
Figure S1.
Gene Ontology classification for cellular components and molecular function (GO, CC and MF) of up-regulated and down-regulated genes in suppressed and rescued larvae. The X-axis represents the number of genes in the suppressed and rescued condition in the marked category. Right panels indicate up-regulated genes and left panels indicate down-regulated genes. Number of genes in the categories shown had a P value≤0.05. * indicates functional categories with P<0.01. Complete lists of genes for each category are in Tables S6 and S7.
https://doi.org/10.1371/journal.pone.0024105.s001
(TIF)
Table S1.
A list of significantly up-regulated and down-regulated genes (log2 fold change >1; P <0.05) in mutant larvae ( itprsv35/ug3 ).
https://doi.org/10.1371/journal.pone.0024105.s002
(XLS)
Table S2.
A list of significantly up-regulated and down-regulated GO categories (Biological Processes; BP, Cellular Component; CC, Molecular Functions; MF, P <0.05) with gene names in itprsv35/ug3 .
https://doi.org/10.1371/journal.pone.0024105.s003
(XLS)
Table S3.
A list of up-regulated and down-regulated genes with log2 fold change ≥1 and P <0.05 in suppressed larvae ( Kum170/+; itprsv35/ug3 ).
https://doi.org/10.1371/journal.pone.0024105.s004
(XLS)
Table S4.
A list of up-regulated and down-regulated genes with log2 fold change ≥1; P <0.05 in rescued larvae ( UASitpr+/+; Dilp2GAL4/+; itprsv35/ug3 ).
https://doi.org/10.1371/journal.pone.0024105.s005
(XLS)
Table S5.
A list of filtered (P<0.05) up-regulated and down-regulated genes that are common between mutant, rescued and suppressed larvae with fold changes and GO terms.
https://doi.org/10.1371/journal.pone.0024105.s006
(XLS)
Table S6.
A list of significantly up-regulated and down-regulated GO categories (BP, CC, MF, P <0.05) in suppressed larvae, with gene names.
https://doi.org/10.1371/journal.pone.0024105.s007
(XLS)
Table S7.
A list of significantly up-regulated and down-regulated GO categories (BP, CC, MF, P <0.05) in rescued larvae, with gene names.
https://doi.org/10.1371/journal.pone.0024105.s008
(XLS)
Acknowledgments
We thank Genotypic Technology, Bangalore, for their help in use of the Gene Spring software.
Author Contributions
Conceived and designed the experiments: SK DD GH. Performed the experiments: SK DD. Analyzed the data: SK DD GH. Contributed reagents/materials/analysis tools: SK DD GH. Wrote the paper: SK GH.
References
- 1. Cai X (2008) Unicellular Ca2+ signaling ‘toolkit’ at the origin of metazoa. Mol Biol Evol 25: 1357–1361.
- 2. Futatsugi A, Nakamura T, Yamada MK, Ebisui E, Nakamura K, et al. (2005) IP3 receptor types 2 and 3 mediate exocrine secretion underlying energy metabolism. Science 309: 2232–2234.
- 3. Matsumoto M, Nakagawa T, Inoue T, Nagata E, Tanaka K, et al. (1996) Ataxia and epileptic seizures in mice lacking type 1 inositol 1,4,5-trisphosphate receptor. Nature 379: 168–171.
- 4. Agrawal N, Padmanabhan N, Hasan G (2009) Inositol 1,4,5- trisphosphate receptor function in Drosophila insulin producing cells. PLoS One 4: e6652.
- 5. Joshi R, Venkatesh K, Srinivas R, Nair S, Hasan G (2004) Genetic dissection of itpr gene function reveals a vital requirement in aminergic cells of Drosophila larvae. Genetics 166: 225–236.
- 6. Sanyal S, Consoulas C, Kuromi H, Basole A, Mukai L, et al. (2005) Analysis of conditional paralytic mutants in Drosophila sarco-endoplasmic reticulum calcium ATPase reveals novel mechanisms for regulating membrane excitability. Genetics 169: 737–750.
- 7. Venkiteswaran G, Hasan G (2009) Intracellular Ca2+ signaling and store-operated Ca2+ entry are required in Drosophila neurons for flight. Proc Natl Acad Sci U S A 106: 10326–10331.
- 8. Venkatesh K, Siddhartha G, Joshi R, Patel S, Hasan G (2001) Interactions between the inositol 1,4,5-trisphosphate and cyclic AMP signaling pathways regulate larval molting in Drosophila. Genetics 158: 309–318.
- 9. Banerjee S, Joshi R, Venkiteswaran G, Agrawal N, Srikanth S, et al. (2006) Compensation of inositol 1,4,5-trisphosphate receptor function by altering sarco-endoplasmic reticulum calcium ATPase activity in the Drosophila flight circuit. J Neurosci 26: 8278–8288.
- 10. Tweedie S, Ashburner M, Falls K, Leyland P, McQuilton P, et al. (2009) FlyBase: enhancing Drosophila Gene Ontology annotations. Nucleic Acids Res 37: D555–559.
- 11. Rulifson EJ, Kim SK, Nusse R (2002) Ablation of insulin-producing neurons in flies: growth and diabetic phenotypes. Science 296: 1118–1120.
- 12. Ashburner M, Ball CA, Blake JA, Botstein D, Butler H, et al. (2000) Gene ontology: tool for the unification of biology. The Gene Ontology Consortium. Nat Genet 25: 25–29.
- 13. Huang da W, Sherman BT, Lempicki RA (2009) Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat Protoc 4: 44–57.
- 14. Dennis G Jr, Sherman BT, Hosack DA, Yang J, Gao W, et al. (2003) DAVID: Database for Annotation, Visualization, and Integrated Discovery. Genome Biol 4: P3.
- 15. Lorentzos P, Kaiser T, Kennerson ML, Nicholson GA (2003) A rapid and definitive test for Charcot-Marie-Tooth 1A and hereditary neuropathy with liability to pressure palsies using multiplexed real-time PCR. Genet Test 7: 135–138.
- 16. Venkatesh K, Hasan G (1997) Disruption of the IP3 receptor gene of Drosophila affects larval metamorphosis and ecdysone release. Curr Biol 7: 500–509.
- 17. Zinke I, Schutz CS, Katzenberger JD, Bauer M, Pankratz MJ (2002) Nutrient control of gene expression in Drosophila: microarray analysis of starvation and sugar-dependent response. EMBO J 21: 6162–6173.
- 18. Fujikawa K, Takahashi A, Nishimura A, Itoh M, Takano-Shimizu T, et al. (2009) Characteristics of genes up-regulated and down-regulated after 24 h starvation in the head of Drosophila. Gene 446: 11–17.
- 19. McDonald MJ, Rosbash M (2001) Microarray analysis and organization of circadian gene expression in Drosophila. Cell 107: 567–578.
- 20. Fernandez-Ayala DJ, Chen S, Kemppainen E, O'Dell KM, Jacobs HT (2010) Gene expression in a Drosophila model of mitochondrial disease. PLoS One 5: e8549.
- 21. Brunner E, Peter O, Schweizer L, Basler K (1997) pangolin encodes a Lef-1 homologue that acts downstream of Armadillo to transduce the Wingless signal in Drosophila. Nature 385: 829–833.
- 22. Sansam CL, Shepard JL, Lai K, Ianari A, Danielian PS, et al. (2006) DTL/CDT2 is essential for both CDT1 regulation and the early G2/M checkpoint. Genes Dev 20: 3117–3129.
- 23. Higa LA, Wu M, Ye T, Kobayashi R, Sun H, et al. (2006) CUL4-DDB1 ubiquitin ligase interacts with multiple WD40-repeat proteins and regulates histone methylation. Nat Cell Biol 8: 1277–1283.
- 24. Gronke S, Clarke DF, Broughton S, Andrews TD, Partridge L (2010) Molecular evolution and functional characterization of Drosophila insulin-like peptides. PLoS Genet 6: e1000857.
- 25. Bina S, Wright VM, Fisher KH, Milo M, Zeidler MP (2010) Transcriptional targets of Drosophila JAK/STAT pathway signalling as effectors of haematopoietic tumour formation. EMBO Rep 11: 201–207.
- 26. Girardot F, Monnier V, Tricoire H (2004) Genome wide analysis of common and specific stress responses in adult drosophila melanogaster. BMC Genomics 5: 74.
- 27. Berridge MJ, Bootman MD, Roderick HL (2003) Calcium signalling: dynamics, homeostasis and remodelling. Nat Rev Mol Cell Biol 4: 517–529.
- 28. Cardenas C, Miller RA, Smith I, Bui T, Molgo J, et al. (2010) Essential regulation of cell bioenergetics by constitutive InsP3 receptor Ca2+ transfer to mitochondria. Cell 142: 270–283.
- 29. Bass J, Takahashi JS (2010) Circadian integration of metabolism and energetics. Science 330: 1349–1354.
- 30. Gershman B, Puig O, Hang L, Peitzsch RM, Tatar M, et al. (2007) High-resolution dynamics of the transcriptional response to nutrition in Drosophila: a key role for dFOXO. Physiol Genomics 29: 24–34.
- 31. Kohn AD, Moon RT (2005) Wnt and calcium signaling: beta-catenin-independent pathways. Cell Calcium 38: 439–446.
- 32. Kurzik-Dumke U, Neubauer M, Debes A (1996) Identification of a novel Drosophila melanogaster heat-shock gene, lethal(2)denticleless [l(2)dtl], coding for an 83-kDa protein. Gene 171: 163–170.