Introduction

In Ethiopia, Plasmodium falciparum and Plasmodium vivax are co-transmitted and respectively accounted for 60% and 40% of all malaria cases [1,2]. Nearly 68% of the landmass of Ethiopia is favourable for malaria transmission [1] and endemicity is heterogeneous with varied epidemiological presentation in different geographic settings [3]. Like in many parts of Africa, the incidence of malaria has substantially declined with a reported 40% reduction between 2000 and 2015 [4,5]. Ethiopia is on track to achieve the 2020 milestone to reduce the incidence of malaria by 40%. This also aligns with the World Health Organization (WHO) Global Technical Strategy (GTS) to intensify existing malaria interventions towards elimination by 2030 [5].

Rapid diagnostic tests (RDTs) were also introduced to improve early diagnosis of malaria in remote areas where microscopic examination of blood smears remains impractical. A majority of commercially available mRDTs are designed to detect malaria specific antigens such as lactate dehydrogenase or aldolase for pan-malaria diagnosis and PfHRP2 for P. falciparum specific diagnosis [6]. RDTs have become extremely essential for implementing early diagnosis and prompt effective treatment of malaria and for the continuous reduction of its burden.

In Ethiopia, mRDTs were introduced as one of the diagnostic methods following the revision of malaria diagnosis and treatment guideline in 2004 in the country. Depending on the antigen they target, different types of RDTs exist. Those that target histidine-rich protein-2 (HRP-2) only detect P. falciparum, while those that target the parasite enzyme lactate dehydrogenase (LDH) and aldolase can detect non-falciparum from mixed infection [7,8]. PfHRP2/3-based RDTs have been widely used for detection of P. falciparum at health posts/community levels in Ethiopia since 2005 [9].

PfHRP2 is a non-essential protein encoded by pfhrp2 gene located on chromosome 8 of P. falciparum. Its structural homologue, PfHRP3, is coded by a locus on chromosome 13 [10]. Pfhrp3 antigen epitopes are recognised by some PfHRP2-based RDTs [11] and may influence the diagnostic performance of these mRDTs. Hence, PfHRP3 contributes to reactivity of PfHRP2-based RDTs. Although PfHRP2-based RDTs have been widely used, its performance is complicated by the natural deletion of pfhrp2 gene in parasite populations in some geographical regions. Variation in the performance of RDTs has been observed, probably driven by polymorphisms in gene loci targeted, such as the recently described deletions in the Pfhrp2/3 loci. The prevalence and dynamics of these pfhrp2/3 deleted P. falciparum strains and their impact on diagnosis has not been extensively investigated in Ethiopia. Following the first report detailing the deletion of the pfhrp2 gene in P. falciparum isolates from Peru, several studies have shown the global spread of malaria parasites lacking pfhrp2 gene and the flanking chromosomal regions [12]. This generated anxiety on possible reduced sensitivity of PfHRP2-based RDTs. In Eritrea, P. falciparum lacking pfhrp2 now constitute a major threat to malaria control [13,14] as they are not detected by PfHRP2-based RDTs and remain untreated. It has been suggested that these strains with deletions at pfhrp2/3 genes have a fitness advantage and pose a challenge to progress made in malaria control and elimination [15] as these parasites will escape detection by PfHRP2-based RDTs and may be selected to expand due to routine use of RDTs leading to increasing frequencies of parasite population with pfhrp2/3 deleted genes in the communities. Though P. falciparum strains without these loci continue to thrive, the role of PfHRP2/3 loci in parasite virulence and fitness is not clear as these are expressed in all stages of development of parasite, probably contributing to survival advantage [16–18].

A substantial proportion of parasite isolates with both pfhrp2 and pfhrp3 gene deletions have been reported across malaria endemic countries in Africa with the highest prevalence of deletion from Eritrea (62%) [14] and the lowest from Angola (0.4%) [19]. Indeed, in some hospitals in Eritrea the levels of gene deletions were as high as 80% [14]. As the malaria transmission intensity and intervention history in Ethiopia is similar to that in Eritrea, it is therefore possible that pfhrp2/3 deleted isolates may be in circulation in Ethiopia at similarly high frequencies. Following the WHO recommendation for pfhrp2/3 surveys and cross border surveillance activities, this study investigates the extent of pfhrp2/3 deleted P. falciparum parasites in an Ethiopian P. falciparum population. Molecular analyse targeting the region across exons and flanking genes were used to provide evidence of gene deletions in the pfhrp2/3 genes.

Materials and methods

PCR confirmation of Plasmodium falciparum infections

Parasite DNA was extracted from dried blood spots using the chelex100 extraction method as described earlier [20]. The presence of Plasmodium species was confirmed by targeting 18S rRNA by a nested polymerase chain reaction (nPCR) using genus-specific primers rPLU 6: (5’TTAAAATTGTTGCAGTTAAAACG3’), rPLU 5: (5’CCTGTTGTTGCCTTAAACTTC3’) followed by species-specific primers rFAL 1: (5’TTAAACTGGTTTGGGAAAACCAAATATATT3’), rFAL2: (5’ACACAATGAACTCAATCATGACTACCCGTC3’) as described by Snounou [21]. The cycling conditions were as follows: denaturation, 95°C for 5 min; 35 cycles of 94°C for 30 s, 56°C for 30 s, and 60°C for 60 s; and a final extension at 60°C for 5 min. The presence of amplification product is detected by simple ethidium bromide staining following agarose gel electrophoresis and a 205 bp size of the PCR product confirms P. falciparum.

PCR-based genotyping of pfhrp2/3 deletions.

Amplifications of exons 2 and their flanking regions of pfhrp2/3 genes were done by semi-nested PCR [22] using published protocols and primers (Table 1). Nest-1 PCR targets repeat sequences within the most variable part of the genes while the second primer set targets an intron region. For pfhrp2, PCR nest-1 product sizes of 720–830 bp were expected while for Pfhrp3, the expected PCR product size was< 500 bp. The PCR products were purified by the GeneJet PCR Cleanup Kit from Thermo Fisher Scientific and sent for sequence determination at Eurofins genomics, Germany. Sequences were analysed by the 4peaks program (A. Griekspoor and Tom Groothuis, nucleobytes.com).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Table 1. Primers name and sequences used to amplify pfhrp2/3 genes including the flanking regions.

https://doi.org/10.1371/journal.pone.0241807.t001

Amplification of pfhrp2/3 flanking regions

For amplifications of genes immediately flanking pfhrp2 (MAL7P1.230 (5.535 kb upstream) and MAL7P1.228 (6.49 kb downstream)), and pfhrp3 (MAL13P1.485 (4.404 kb upstream) and MAL13P1.475 (1.684 kb downstream)), the following primers and PCR conditions were used (Table 2).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Table 2. PCR conditions and expected product sizes of the pfhrp2/3 flanking regions.

https://doi.org/10.1371/journal.pone.0241807.t002

To rule out the possibility that the absence of amplification in pfhrp2/3 may be an artifact of the PCR, alternative primers with different binding sites and amplification conditions were used. All primers were used on samples from Tanzania with intact pfhrp2/3 genes with good results. In addition, amplifications of pfmdr1 and pfubp-1 genes were successful in all samples suggesting the deletion of pfhrp2/3 genes.

Ethical issue.

The study was approved by Aklilu Lemma Institute of Pathobiology, Addis Ababa University, Institutional review Board. Written consent and/or assent were obtained from each study participant.

Results

PCR confirmation of Plasmodium falciparum infections

Of 189 self-reporting febrile patients seeking malaria diagnosis at Adama Malaria Diagnostic Centre, 33.9% (64/189) were positive for P. falciparum as confirmed by expert microscopy which was later proven positive by PCR. The male: female ratio was 3.1:1. Participant’s mean age was 25.2 years (range 11–48). The minimum parasite density reported was 400 parasites/μL. Although all microscopically confirmed cases tested positive by PCR, only 50 samples had enough DNA for further analysis of deletion in pfhrp2/3 genes and the flanking regions.

By targeting six regions in the pfhrp2/3 genes and their flanking genes, different deletion patterns were observed in Ethiopian P. falciparum clinical samples. Most parasite isolates had deleted the gene located 3’ of pfhrp2, PF3D7_0831900, compared to the flanking gene5’, PF3D7_0831700. In contrast, the 5’ flanking PF3D7_1372100 gene, upstream of pfhrp3, showed more deletions than the downstream 3’ flanking PF3D7_1372400 region. Combining deletions in the genes and flanking regions, the most common pattern exhibited in the isolates was the presence of the two flanking regions for pfhrp2 in combination with the downstream flanking region for pfhrp3. This was followed by isolates that had a deleted downstream flanking region of pfhrp3 but with the two flanking regions of pfhrp2 retained. Notably, only one isolate showed intact flanking regions for both gene loci. Amplifications of pfmdr1 and pfubp-1 genes in these samples are an indication that the absence of PCR products in the pfhrp2/3 genes and the respective flanking regions are due to deletions.

Genetic deletion of pfhrp2 and pfhrp3 and their flanking genes.

The deletion variant at pfhrp2 gene was fixed in the population analysed as the gene was deleted in all 50(100%) isolates assessed. The deletion extended downstream pfhrp2 gene flanking region towards the Pf3D7 0831900(MAL7PI.230) gene in 11/50 (22%) of the cases (Table 3). In contrast, only 2/50(4%) of samples had deletions for the upstream gene Pf3D7 0831700(MALPI.228).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Table 3. Extension of deletions of pfhrp 2 and pfhrp3 genes, the respective flanking regions and exon primers used in Ethiopian isolates.

https://doi.org/10.1371/journal.pone.0241807.t003

Similar results were observed for pfhrp3 and flanking regions. Here, all the isolates had deletions in the pfhrp3 gene (100%). Like for pfhrp2 gene, pfhrp3 deletion extended to the downstream flanking region to include Pf3D7 13272400 (MAL13PI.485) in 40% of samples. However, the extension of the deletion was more prevalent upstream towards Pf3D7 081372100 (MAL13PI.475), with 49/50 (95%) of isolates deleted at these loci.

The summary of deletions in pfhrp2 and pfhrp3 genes and the respective flanking regions are indicated in S1 File.

In addition to the exon primers that cover the normally analysed variable region, a set of primers targeting an intron sequence with a varying number of AT repeats. In spite of the negative results for all samples in exon-based PCR, five samples actually gave PCR products for the intron region. The samples contained different numbers of AT repeat sequence motif (one sample with 10 repeats, and four samples with 17 repeats) and suggest that the deletion in this region did not involve the entire region (Table 4).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Table 4. Repeat sequences in pfhrp2 intron, in 50 Ethiopian samples tested, those not listed did not give PCR products.

https://doi.org/10.1371/journal.pone.0241807.t004

Discussion

As per WHO which hosted a technical consultation on pfhrp2/3 gene deletions and drafted interim guidance for investigating false-negative RDTs [23], understanding the distribution and evolution of these mutant parasites is a priority. However, it is yet unknown whether reliance on PfHRP2-based RDTs to guide treatment across malaria endemic countries is exerting evolutionary pressure favouring the spread of this mutation. At present, PfHRP2-based RDTs are central to malaria control programmes in spite of the threat by parasites that do not express PfHRP2. This study is the first to report the presence of extensive deletion of pfhrp2 gene including deletion in its structural homolog, pfhrp3, in clinical isolates in Ethiopia

All 50 samples (100%) yielded deletion for pfhrp2 and pfhrp3 genes. In pfhrp2 gene, the deletion extended to 4% (2/50) of flanking region gene 228. Flanking region gene 230 contained deletions in 22% (11/50) of the samples. Around pfhrp3 genes 475 and 485 were deleted for 95% and 40% of the samples, respectively. The fact that HRP2-based RDTs tests accounted for 74% of malaria diagnostic testing in the sub-Saharan Africa in 2017 [24], such massive utilization of RDTs could lead to selection and spread of P. falciparum strains that can evade detection through the deletion of the pfhrp2 genes.

Nowadays, a great concern with the use of PfHRP2-based RDTs malaria diagnosis has been the evolving reports of P. falciparum isolates lacking the pfhrp2 and pfhrp3 genes, which respectively encode the PfHRP2 and the PfHRP3 proteins [12,25,26]. The deletion assay includes six targets of pfhrp2/3 and flanking regions, and at least one locus was amplified for 50 samples out of 64 microscopically and PCR confirmed P. falciparum clinical samples collected. While the deletion in pfhrp2 gene extended downstream in 11/50 (22%) of the isolates, the deletion was only 4% in upstream of pfhrp2. However, it is unclear if these pfhrp2 deletions are recent events or emerged prior to the introduction of PfHRP2-based RDTs in Ethiopia. In Peru, for instance, pfhrp2-deleted parasites were present before the introduction of RDTs, but the sweep in the population that occurred after RDT introduction shows the strength of selection against this new diagnostic tool [27]. It is indicated that the extensive use of PfHRP2-based RDTs is sufficient to select P. falciparum parasites lacking this protein [15].

Similarly, deletion was evident in 100% of the isolates analysed in pfhrp3 gene and extended to the downstream flanking region that codes for Pf3D7 13272400 (MAL13PI.485) gene in 40% of the isolates. The pfhrp3 deletion also extended upstream to Pf3D7 081372100 (MAL13PI.475) region in 49/50 (95%) of the isolates, exhibiting complete absence of the locus. Two distinct repeat motifs were observed for pfhrp2 intron region in 50 of the samples tested suggesting that the deletion in this region did not involve the entire region.

Interestingly, PfHRP2-based RDTs are far more popular in Ethiopia than pLDH-based RDTs, partly because of their higher sensitivity for P. falciparum diagnosis. The presence of deletions in both pfhrp2 and pfhrp3 genes suggest that this could have been a result of a recent selection as a consequence of the widely used PfHRP2-based RDTs. The possible spread of pfhrp2/3 deleted parasite from a neighbour country like Eritrea can’t be overlooked for the presence high deletions in Ethiopian P. falciparum populations. Very high frequencies of these deletions have also been reported in Eritrea, a close geographic population and neighbour to Ethiopian parasite populations [13,14]. Deletions in both genes are less frequent in other African populations, though this phenomenon is quite prevalent in South American countries [27,28]. Recent whole genome analysis of P. falciparum across Africa countries found isolates from Ethiopia to be highly divergent from the rest of continent, defining a genomic background that could respond differently to selective forces such as RDTs and drugs [20]. These deletion isolates formed a closely related cluster probably from clonal proliferation of a recent pfhrp2-deleted ancestor [27]. Expansion of these deleted isolates could jeopardise the effectiveness of PfHRP2-based RDTs.

RDT-based malaria diagnosis followed by treatment could be selectively clearing infections with parasites retaining the pfhrp2/3 genes and hence increase the rate of spread of parasites with deletions [29]. When the pfhrp2 gene deletion was reported in 2010 in South America, this led to the recommendation against the use of PfHRP2-based RDTs in these areas [30–32]. If the results here are corroborated in a larger study across Ethiopia, a similar recommendation may be warranted. Unfortunately, patient recruitment in this study was based on microscopy and this does not allow us to determine the outcome of PfHRP2/3-based RDT for P. falciparum population with complete deletion of pfhrp2/3 genes. Hence, further large-scale studies using microscopy and PfHRP2/3-based RDTs are required to validate these high frequencies of pfhrp2/3 gene deletions and their effect on RDT malaria diagnosis in Ethiopia. For now, polymorphisms in pfhrp2/3 genes in Ethiopian isolates don’t seem to influence performance of currently used PfHRP2 RDTs given that they have been widely used in the country. Furthermore, as the samples were collected from one location in Ethiopia, a geographically expanded study would better inform the national malaria control program (NMCP) on need for reviewing policy on type of mRDTs in the country and the extent of pfhrp2/3 genes deletions.

This study has several important limitations. The samples were collected during a single malaria transmission season spanning September through December 2015 from one study site. Hence, the results here can’t be generalized to the clinical isolates from other endemic areas of Ethiopia. The number of isolates analysed was also small in number (50 P. falciparum clinical isolates). The fact that the clinical samples were collected using microscopy alone, it is impossible to know if the deleted isolates would test negative or positive for RDTs in the absence of pfhrp2/3 genes as we didn’t perform RDT-based diagnosis.

In summary, P. falciparum parasite populations with deletions of the pfhrp2 and pfhrp3 genes are present in Adama site of Ethiopia. Continuous monitoring of deletions among clinical isolates in the target regions is important in this era of malaria elimination, which largely depends on RDTs.

Supporting information

Acknowledgments

We sincerely thank all study for their participations and laboratory technicians for their support and cooperation during this study.