Long non-coding RNA IBIN (CR44404) expression is induced by an infection in Drosophila

To investigate the importance of long non-coding RNAs in Drosophila immunity, we carried out a transcriptome analysis (RNAseq) of flies 24h after infection with the Gram-positive M.luteus in comparison to age and sex-matched uninfected controls. The RNA sequencing method used in this study recognizes polyadenylated non-coding RNAs, which are thought to represent the majority of long non-coding RNAs, although also ones without poly-A tails exist [25,26]. Prior to the transcriptome analysis, one of the Toll pathway target genes IM1 (Immune induced molecule 1), was measured from females and males upon M. luteus infection. IM1 was robustly induced in both male and female Drosophila (S1A Fig), and males were chosen for the transcriptome analysis. LYS-type peptidoglycan containing Gram-positive bacteria are known to induce the classical Toll pathway target genes including a number of antimicrobial peptides (AMPs) (e.g. [27]). As expected, AMPs were strongly upregulated in the transcriptome analysis upon a M. luteus infection, including Dro, Mtk, Drs, and multiple IMs (Fig 1A, S1 Table). Noteworthy, the highest upregulation in infected flies was seen in a previously unannotated long non-coding RNA gene, CR44404 (Fig 1A). The baseline expression of CR44404 is very low, and upon a M. luteus infection, it is induced by about 1300-fold. The induction of CR44404 expression was also shown to be comparable between males and females upon M. luteus infection (S1B Fig).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 1. lincRNA-IBIN (CR44404) expression is strongly induced by Gram-positive and Gram-negative bacteria and its expression is regulated by the Toll and Imd pathways and a functional BAP complex.

A) In a whole transcriptome analysis, 28 genes were more than 18-fold upregulated after a M. luteus infection. The highest upregulation in infected flies was found in a long non-coding RNA gene, CR44404 (lincRNA-IBIN). p-value <0.005 in all selected genes (S1 Table). B) 16 upregulated lncRNA genes have more than a threefold expression change in response to a M. luteus infection in adult flies. p-value <0.05 in all selected lncRNA genes (S2 Table). C) lincRNA-IBIN expression is induced in Drosophila adults within two hours of an infection by M. luteus or E. cloacae. For fold-induction values, expression values in uninfected samples were set to 1. D) M. luteus-induced lincRNA-IBIN expression is dependent on the Toll pathway (the Toll pathway adaptor protein MyD88) function. E) E. cloacae-induced lincRNA-IBIN expression is dependent on the Imd pathway (Relish) function. In D and E, for fold-induction values, expression values in uninfected w, MyD88^IR samples were set to 1 F) lincRNA-IBIN expression is induced in Drosophila adults upon silencing of the Drosophila inhibitor of κB factor cactus. G) lincRNA-IBIN expression is induced in Drosophila larvae with the constitutively active form of the Toll receptor, Toll^10b. In F and G, for fold-induction values, expression values in uninfected/untreated w samples were set to 1. H) lincRNA-IBIN expression is also modestly induced by the ubiquitous overexpression of Imd with daughterless-GAL4 (da>Imd) in Drosophila larvae. For fold-induction values, the expression value of w,da> was set to 1. I-J) Both M. luteus and E. cloacae-induced lincRNA-IBIN expression is dependent on the functional chromatin remodeling BAP complex. In I and J, for fold-induction values, expression values in uninfected w, osa^IR samples were set to 1.

https://doi.org/10.1371/journal.ppat.1007504.g001

Besides CR44404, there were only 15 other lncRNAs that were more than 3-fold upregulated upon infection (Fig 1B, S2 Table). While findings from vertebrates indicate that lncRNAs have wide and important functions in immune responses [13–16], cancer and metabolism [28,29], the role of lncRNAs in Drosophila immunity has only begun to emerge. CR44404 was chosen for further analysis based on its intriguing expression pattern.

CR44404 is 228 nucleotides long (genomic loci 2R:17,671,068..17,671,295 [+]) and it is located between two protein coding genes; P32 and CG30109. Therefore, CR44404 is classified as a long non-coding intergenic RNA (lincRNA) molecule. Although CR44404 is very close to the protein-coding gene P32, the genes do not overlap. To confirm that CR44404 is an independent transcript, the expression levels of the adjacent genes were examined in the transcriptome analysis. Neither P32 nor CG30109 were affected by infection in the same way as CR44404, the expression of which was ~1300-fold upon a M. luteus infection. Instead, P32 (1.17-fold) and CG30109 (1.27-fold) were not significantly induced by M. luteus infection at 24h time point, indicating that CR44404 is expressed independently from them.

CR44404 is polyadenylated; it has a highly conserved cleavage signal sequence AAUAA towards the end of the full-length transcript. CR44404 does not contain open reading frames and based on the NCBI domain search tool [30], it does not contain any predicted protein domains. According to RNA secondary structure predictions, CR44404 is multibranched (contains 3–4 GC-rich branches) and contains a variable amount of smaller (hairpin) loops connected to a bigger loop (S2 Fig). Based on the high expression of CR44404 upon infection and its genomic location, we named the gene lincRNA-Induced By INfection (lincRNA-IBIN).

lincRNA-IBIN expression is induced by Gram-positive and -negative bacteria and parasitoid wasps and is dependent on the functional Toll and Imd pathways and the BAP complex

As lincRNA-IBIN was shown to be strongly induced by Gram-positive bacteria 24h p.i, we next infected male flies with either the Gram-positive M. luteus or the Gram-negative Enterobacter cloacae (E. cloacae) to measure the gene expression kinetics of lincRNA-IBIN during multiple time points ranging from 0-24h after infection (Fig 1C). This revealed that lincRNA-IBIN is also induced by Gram-negative bacteria, and in both infections, the induction occurred within the first hours of infection and gradually increased towards the 24h time point (Fig 1C). To further study the role the Toll pathway and the Imd pathway [10,11], in the expression of lincRNA-IBIN, we knocked down MyD88 (an adaptor protein functioning downstream of the Toll receptor in the Toll pathway), cactus (a negative regulator of the Toll pathway) and Relish (an Imd pathway NF-κB factor). Thereafter, we infected the flies with M. luteus or E. cloacae and measured the lincRNA-IBIN RNA levels. Upon a M. luteus infection, the expression of lincRNA-IBIN was shown to be dependent on the expression of MyD88, i.e the functional Toll pathway (Fig 1D). Knocking down MyD88 upon a E. cloacae infection had no effect on the expression of lincRNA-IBIN (Fig 1E), whereas knocking down Relish or using the Relish^E20 null mutant inhibited the expression of lincRNA-IBIN, showing that it requires a functional Imd pathway in this context (Fig 1E). Knocking down Relish or using the Relish^E20 null mutant upon a M. luteus infection did not inhibit the expression of lincRNA-IBIN (Fig 1D). The role of the Toll pathway activation to the expression of lincRNA-IBIN was further confirmed in uninfected flies by knocking down the inhibitor of the κB factor cactus, which strongly induced the expression of lincRNA-IBIN (Fig 1F). Also, during the larval stage, lincRNA-IBIN was induced by the ectopic expression of the constitutively active form of the Toll receptor, Toll^10b (Fig 1G) and by overexpression of the Imd molecule with the ubiquitous da-GAL4 driver (Fig 1H).

Next, we tested if the Osa-containing Brahma (BAP) complex is needed for the expression of the lincRNA-IBIN. The BAP complex is a group of protein-coding genes working together in remodeling chromatin [31], and the complex has previously been reported to affect the Toll pathway-induced Drs-luc reporter in vitro in Drosophila [32,33]. Interestingly, when osa expression was knocked down, lincRNA-IBIN expression was strongly inhibited upon both a M. luteus (Fig 1I) and a E. cloacae (Fig 1J) infection. The knockdown of another BAP complex component brahma (brm) also reduced lincRNA-IBIN expression upon both infections (Fig 1I and 1J). Moreover, because lincRNA-IBIN is strongly induced by a bacterial infection in Drosophila adults, indicating a role in the humoral immune response, we next studied whether lincRNA-IBIN is also induced during the cellular immune response by infecting Drosophila larvae with Leptopilina boulardi (L. boulardi) parasitoid wasps. Also in this context, the expression of lincRNA-IBIN was strongly induced (Fig 2).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 2. lincRNA-IBIN expression is induced in immunogenic tissues and its cellular localization is mainly nuclear.

A-B) lincRNA-IBIN is induced in the larval fat body and hemocytes after a L. boulardi infection and is dependent on the expression of the BAP complex member osa in these tissues. For fold-induction values, expression values in uninfected w, osa^IR samples were set to 1. C) qPCR for hemocyte-specific Hml (i) and fat body-specific Lsp1α (ii) was carried out to confirm the purity of the tissue fractions. lincRNA-IBIN was not found in the plasma fraction in large quantities (iii). D) RNA FISH performed in larval hemocytes shows that lincRNA-IBIN is mainly located in the nucleus; pink labelling (lincRNA-IBIN) co-localizes with blue nuclear labelling (DAPI). i) Negative control (without lincRNA-IBIN probes), ii) hemocytes from w¹¹¹⁸ larvae showing the basal expression level and localization of lincRNA-IBIN, iii) hemocytes from larvae overexpressing lincRNA-IBIN¹ (HH>lincRNA-IBIN¹) and infected with L. boulardi.

https://doi.org/10.1371/journal.ppat.1007504.g002

In conclusion, lincRNA-IBIN seems to have a rather broad role in the immune response, being induced by a bacterial infection in flies and by parasitoid wasps in larvae. The M. luteus -mediated induction of lincRNA-IBIN expression was shown to be dependent on the Toll pathway, whereas the E. cloacae -mediated induction requires the Relish/Imd pathway. In each studied case, lincRNA-IBIN expression was dependent on a functional BAP complex. This type of unspecific induction via both NF-κB pathways is rather uncommon in Drosophila and argues for a general immunity related function for lincRNA-IBIN.

Tissue-specific expression and cellular localization of lincRNA-IBIN

To understand the role of lincRNA-IBIN in Drosophila immunity, we investigated where lincRNA-IBIN was expressed and whether its effects were tissue-specific. Since lincRNA-IBIN expression is strongly infection-inducible, we reasoned that it is most likely expressed in immune-responsive tissues (the fat body and hemocytes, the Drosophila blood cells). Wasp infection of Drosophila larvae led to the induction of lincRNA-IBIN expression in the fat body and hemocytes (Fig 2A and 2B). Like in flies, osa RNAi in larval hemocytes (HH> osa^IR) and fat bodies (C564> osa^IR) kept the expression of lincRNA-IBIN close to the basal level (Fig 2A and 2B). Because lincRNA-IBIN is a short gene and very strongly induced upon infection like AMPs, we next investigated whether lincRNA-IBIN is secreted into the plasma in similar manner as AMPs (Fig 2C). First, we confirmed that hemocytes and plasma were separated by centrifugation (S3 Fig). We also checked the expression of a hemocyte specific gene Hemolectin (Hml) and a fat body-specific gene Larval serum protein 1 alpha (Lsp1α) in each tissue sample (Fig 2C, i and ii). A Hml signal was detected in the hemocyte fraction, whereas Lsp1α levels were high in fat body samples but not in hemocytes or in the plasma (Fig 2C, i and ii). We did not detect lincRNA-IBIN in the plasma fraction in large quantities (Fig 2C, iii).

Pin-pointing the cellular localization of a lncRNA reveals typically more about its function than does the structure of the RNA. A RNA FISH (RNA Fluorescent In Situ Hybridization) protocol was performed with 3rd instar larval hemocytes. Uninfected w¹¹¹⁸ larval hemocytes were used as a control for imaging the basal expression level and localization of lincRNA-IBIN (Fig 2D, ii). Hemocytes from larvae overexpressing lincRNA-IBIN¹ (HH>lincRNA-IBIN¹) and infected with L. boulardi were used to induce the expression of lincRNA-IBIN (Fig 2D, iii), and they showed that lincRNA-IBIN (pink labelling) was primarily expressed in the nuclear compartment (blue labelling) of the cell. Therefore, we conclude that lincRNA-IBIN is expressed in immune responsive tissues, is not secreted into the plasma in large amounts and its cellular localization is mainly nuclear. This suggests that the function of lincRNA-IBIN may be in the regulation of gene expression, which is typical for lncRNAs [34–36].

Overexpressing lincRNA-IBIN enhances the expression of selected AMPs upon an infection and survival from an infection

To study the function of lincRNA-IBIN in uninfected and infected flies, we generated UAS-lincRNA-IBIN overexpression fly lines. Two of the generated lines, lincRNA-IBIN¹ and lincRNA-IBIN⁷, were selected for the following experiments. lincRNA-IBIN overexpression in the lincRNA-IBIN¹ and lincRNA-IBIN⁷ lines was induced using the C564-GAL4 driver, which is expressed strongly in the fat body [37,38](Fig 3A). lincRNA-IBIN expression in uninfected flies was significantly increased in both overexpression lines (Fig 3A, white bars), with higher expression levels in the lincRNA-IBIN⁷ line. 24 h after a M. luteus infection, the effect of the overexpression on the expression of lincRNA-IBIN was masked by the overwhelming endogenous expression of lincRNA-IBIN (Fig 3A, black bars). To study the effect of the long-term exposure of flies to elevated levels of lincRNA-IBIN, we monitored the lifespan of flies overexpressing lincRNA-IBIN with the C564-GAL4 driver and controls. To ensure maximal lincRNA-IBIN expression, flies were cultured at +29°C for the duration of the experiment. Neither one of the lincRNA-IBIN overexpression lines (lincRNA-IBIN¹ and lincRNA-IBIN⁷) showed a statistically significant difference in the lifespan between flies overexpressing lincRNA-IBIN and controls (S4 Fig).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 3. Overexpressing lincRNA-IBIN improves the survival of Drosophila adults from an infection and the expression of selected target genes.

A) UAS-lincRNA-IBIN (CR44404) overexpression with the C564-GAL4 driver (C564>lincRNA-IBIN¹ and C564>lincRNA-IBIN⁷) significantly increases the expression of lincRNA-IBIN in uninfected flies measured with qPCR, as does an infection with M. luteus. B) lincRNA-IBIN overexpression (C564>lincRNA-IBIN⁷) improves the survival of the flies after an infection with M. luteus + E. faecalis. C-D) lincRNA-IBIN overexpression increases the expression of two Toll pathway target genes IM1 (C) and Drosomycin (D) after a M. luteus infection. MyD88 knockdown flies were used as a negative control and cactus knockdown flies as a positive control. In A, C and D, for fold-induction values, expression values in uninfected w, lincRNA-IBIN⁷ samples were set to 1. E) E. cloacae-induced endogenous lincRNA-IBIN expression is lost upon Relish RNAi. lincRNA-IBIN overexpression is shown in the Relish RNAi background. F) Upon a E. cloacae infection, lincRNA-IBIN overexpression gives a statistically significant survival advantage to flies with a Relish RNAi background. G) Attacin C (AttC) is not produced in Relish RNAi flies, but with IBIN overexpression a very small amount of AttC is induced. H) Diptericin A (DptA) is not produced with or without lincRNA-IBIN overexpression in flies with a Relish RNAi background upon a E. cloacae infection. In E, G and H, for fold-induction values, expression values in uninfected w, Rel^IR samples were set to 1.

https://doi.org/10.1371/journal.ppat.1007504.g003

As lincRNA-IBIN was the most strongly induced gene upon a M. luteus infection, we first investigated whether overexpressing lincRNA-IBIN affected the survival of the flies against a septic infection with Gram-positive bacteria. For the survival experiment, we chose lincRNA-IBIN⁷ flies as these produced the highest overexpression without an infection. We first infected lincRNA-IBIN⁷ flies with M. luteus to prime the Toll pathway. 24h later, the flies were infected with the more pathogenic bacteria, Enterococcus faecalis (E. faecalis) [39]. Overexpression of lincRNA-IBIN⁷ (C564-GAL4>lincRNA-IBIN⁷) improved the survival of the flies from the infection compared to the flies not overexpressing lincRNA-IBIN (Fig 3B). MyD88 (a positive regulator of the Toll pathway) and cactus (a negative regulator of the Toll pathway) knock-down flies were used as controls. This indicates that lincRNA-IBIN positively affects immunity against the pathogenic Gram-positive bacteria E. faecalis.

Next, we investigated whether lincRNA-IBIN regulates the central feature of the fly immune defense against Gram-positive bacteria, namely the production of AMPs via the Toll pathway. The expression of the Toll pathway mediated genes was monitored in flies overexpressing lincRNA-IBIN and controls after exposure to M. luteus for 24 hours (Fig 3C and 3D). lincRNA-IBIN overexpression using both the lincRNA-IBIN¹ and lincRNA-IBIN⁷ lines with the C564-GAL4 driver resulted in significantly elevated levels of IM1 upon infection (Fig 3C). The expression of Drosomycin was elevated in C564>lincRNA-IBIN⁷ flies, whereas in the lincRNA-IBIN¹ line the trend was similar, yet not significant (Fig 3D). As expected, MyD88 knockdown decreased the expression of IM1 and Drosomycin upon infection, whereas cactus knockdown caused a strong induction of IM1 and Drosomycin expression also in the uninfected flies (Fig 3C and 3D).

To address the importance of lincRNA-IBIN in a situation where the expression of endogenous lincRNA-IBIN is prevented, we utilized the following experimental approach. Upon an E. cloacae infection, lincRNA-IBIN expression is fully dependent on Relish (Fig 1E). Relish RNAi flies do not produce endogenous lincRNA-IBIN upon an E. cloacae infection, but in the Relish RNAi flies combined with the lincRNA-IBIN⁷ construct, lincRNA-IBIN is overexpressed (Fig 3E). Next, we monitored the survival of Relish RNAi flies and Relish RNAi flies with the lincRNA-IBIN⁷ construct from an E. cloacae infection (Fig 3F). Fig 3F demonstrates that lincRNA-IBIN overexpression provides protection against an E. cloacae infection. lincRNA-IBIN overexpression does not itself induce antimicrobial peptides (Fig 3G and 3H), indicating that the protection is independent of the AMPs. Taken together, lincRNA-IBIN overexpression enhances the expression of target genes of the Toll pathway. Upon infection, lincRNA-IBIN overexpression gave flies a survival advantage. However, this is not due to the induction of AMPs itself, but results from a mechanism that prompts further investigation.

Overexpression of lincRNA-IBIN in hemocytes increases hemocyte numbers

As shown in Fig 2, lincRNA-IBIN is expressed in immunogenic tissues in the fly, such as the fat body and hemocytes. Next, we examined the role of lincRNA-IBIN overexpression in the cellular response, i.e. the hemocytes. Phagocytic plasmatocytes are the main hemocyte type in uninfected larvae. Lamellocytes, which are formed upon a parasitoid wasp infection, function in the encapsulation of the wasp eggs and larvae [5,40,41]. To further investigate if lincRNA-IBIN has a role in two major components of the cellular immune response, namely the increase in hemocyte numbers and differentiation of lamellocytes, we utilized the hemocyte reporters (msnCherry,eaterGFP) to detect hemocytes with flow cytometer. The combination of the reporters with the hemocyte (MeHH> for short, see materials and methods) and fat body (MeC564>) drivers enabled us to detect the hemocytes and overexpress lincRNA-IBIN in these tissues. Driving lincRNA-IBIN expression in hemocytes (MeHH>lincRNA-IBIN) resulted in an increase in total hemocyte numbers in uninfected larvae (S5A Fig), but did not induce ectopic lamellocyte formation (S5A’ Fig). lincRNA-IBIN overexpression in the fat body (MeC564>lincRNA-IBIN) did not have an effect on hemocytes (S5B–S5B’ Fig).

lincRNA-IBIN could enhance the proliferation of hemocytes or their release from a reservoir located in segmental bands under the larval cuticle, called the sessile compartment [42,43]. To that end, we imaged whole larvae and checked for the existence of sessile bands. We did not observe any noticeable loss of sessile bands that could explain the increased hemocyte numbers (S5C Fig). In L. boulardi-infected larvae, there was a slight decrease in the numbers of hemocytes in the lincRNA-IBIN⁷ line (S5A Fig), but lamellocytes were not affected (S5A’ Fig). Taken together, the overexpression of lincRNA-IBIN in hemocytes increases the hemocyte numbers, but does not affect hemocyte differentiation, in unchallenged Drosophila larvae.

Transcriptome profiling of flies overexpressing lincRNA-IBIN shows effects on sugar and amino acid metabolism

To identify the downstream pathways and targets of lincRNA-IBIN, we performed transcriptome profiling of flies overexpressing (OE) the lincRNA-IBIN⁷ construct with the C564-GAL4 driver. lincRNA-IBIN OE and control flies were either infected with M. luteus or E. cloacae, or they were left uninfected. In uninfected lincRNA-IBIN OE flies, lincRNA-IBIN expression was induced 166-fold (Fig 4A (472±33 normalized number of reads for C564>IBIN vs. 2.8±0.62 normalized number of reads for w, IBIN). Also in this transcriptome analysis, target genes of the Toll pathway were induced in M. luteus-infected flies, and lincRNA-IBIN OE further elevated their levels (S3 Table). Candidate target genes under lincRNA-IBIN regulation were searched for in the uninfected lincRNA-IBIN⁷ transcriptome data using a cut-off value of 2 for fold change. Genes with induced expression level from medium to high (>10 reads) in the treatment of interest were included in the analysis. Based on this criteria, 45 genes (including lincRNA-IBIN) were upregulated (S4 Table) and 21 genes were downregulated (S5 Table) in unchallenged lincRNA-IBIN OE flies. The top upregulated genes included one of the copies of Major heat shock 70 kDa protein, Hsp70Bb (32.9-fold), Niemann-Pick type C-2 (Npc2e, 29.6-fold) and Amyrel (6.8-fold; S4 Table). Among the most downregulated genes were εTrypsin (5.3-fold) and βTrypsin (3.2-fold) both involved in proteolysis (S5 Table). A cluster analysis of the up- and downregulated genes revealed two major gene clusters, both of which are involved in metabolism (Fig 4B). Eight out of forty-five genes upregulated in lincRNA-IBIN overexpressing flies belong to a carbohydrate metabolism/glycoside hydrolase gene cluster, and six out of twenty-one downregulated genes belong to a proteolysis / peptidase S1 gene cluster (Fig 4B).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 4. Transcriptome analysis of lincRNA-IBIN overexpressing flies reveals changes in metabolic genes that result in increased glucose levels in the hemolymph.

A) lincRNA-IBIN⁷ overexpression with the C564-GAL4 driver increases lincRNA-IBIN expression in uninfected flies by 161-fold. This induction is not visible upon a E. cloacae or M. luteus infection, since the infection induces strong lincRNA-IBIN expression. B) Cluster analysis of genes up-and downregulated in C564>lincRNA-IBIN flies compared to w; lincRNA-IBIN controls. The major cluster of induced genes consists of glycoside hydrolase enzymes, whereas enzymes involved in proteolysis form the main downregulated cluster. Clustering was done using GO Biological Process and InterPro protein classification (GO BP/InterPro). C,D) Expression differences of selected Drosophila genes involved in metabolism with and without lincRNA-IBIN overexpression and with and without an infection based on the transcriptome analysis. E) lincRNA-IBIN is induced in the Drosophila adult midgut by a E. cloacae septic injury 24h post infection. F) Workflow of the collection of hemolymph for glucose and trehalose measurements. G,H) Circulating hemolymph glucose levels are elevated upon G) infection and H) overexpression of lincRNA-IBIN in the adult midgut.

https://doi.org/10.1371/journal.ppat.1007504.g004

To investigate the identified metabolism related gene clusters in more detail, we plotted normalized read values of selected genes including all the treatments (uninfected, lincRNA-IBIN⁷ OE, E. cloacae and M.luteus infections with and without lincRNA-IBIN⁷ OE; Fig 4C & 4D). As shown in Fig 4C, overexpression of lincRNA-IBIN⁷ in uninfected flies causes the upregulation of six maltase genes (Mal-A1, Mal-A6, Mal-A7, Mal-A8, Mal-A2, Mal-B1), whose function is to catalyze the hydrolysis of maltose (disaccharide) to glucose units (monosaccharide). In addition, lincRNA-IBIN⁷ overexpression increased the expression of amylases (Amy-p, Amy-d, Amyrel), which hydrolyze dietary starch into disaccharides. tobi (target of brain insulin) and Gba1a (Glucocerebrosidase 1a) are also involved in sugar metabolism, and were elevated by lincRNA-IBIN⁷ overexpression (Fig 4C). Of note, the expression of some of these genes involved in carbohydrate metabolism was also elevated upon M. luteus and E. cloacae infections (Fig 4C, blue and orange bars). This demonstrates that enhanced sugar metabolism is needed to fight infections as shown before [44–46], and indicates that lincRNA-IBIN is involved in providing this metabolic switch. In contrast, many genes involved in peptide and protein catabolism were downregulated upon lincRNA-IBIN⁷ overexpression and infection (Fig 4D). The enhanced (S6B and S6C Fig) or downregulated (S6D Fig) expression of selected metabolic genes upon lincRNA-IBIN overexpression (S6A Fig) was confirmed by qPCR also with the other lincRNA-IBIN overexpressing fly line, lincRNA-IBIN¹.

lincRNA-IBIN is expressed in the adult midgut upon a septic infection and modulates glucose levels in the hemolymph

According to the Flybase high throughput expression data (www.flybase.org), all the identified metabolism genes are almost exclusively expressed in the midgut. Therefore we next analyzed whether lincRNA-IBIN is expressed in the adult midgut in response to septic injury. To ensure maximal induction of lincRNA-IBIN, we infected adult flies by pricking them with E. cloacae, and 24h later dissected the midgut tissues of the infected flies and controls. An E. cloacae infection induced the expression of lincRNA-IBIN also in the adult midgut (Fig 4E). Furthermore, strong expression of the C564-GAL4 driver in the adult midgut was demonstrated (S7A Fig), indicating that besides the fat body, lincRNA-IBIN is also overexpressed in the midgut when the driver C564-GAL4 is used (S7B Fig). This is in line with the observed transcriptional changes when the overexpression of lincRNA-IBIN was driven using the C564-GAL4 driver.

To further study changes in glucose metabolism during an infection, we measured glucose and trehalose levels from the hemolymph 24h after a septic injury with E. cloacae. Hemolymph from uninfected and infected flies (50 flies in each sample) was collected for the analysis (Fig 4F). An infection induced an increase in the glucose level in circulating hemolymph (Fig 4G), whereas the level of circulating trehalose was unaltered (S7C Fig). This suggests that increasing the hemolymph glucose level is important for the immune response. Next, to investigate the role of lincRNA-IBIN on the hemolymph glucose level, hemolymph from flies overexpressing lincRNA-IBIN⁷ with the C564-GAL4 driver and controls (w; lincRNA-IBIN⁷) was collected as described (Fig 4F). In addition to an infection (Fig 4G), also lincRNA-IBIN⁷ overexpression caused a statistically significant increase in the glucose level in circulating hemolymph (Fig 4H). In conclusion, these data imply that a septic infection with Gram-negative bacteria enhances the transcription of genes involved in carbohydrate metabolism, which leads to elevated sugar levels in the hemolymph. lincRNA-IBIN regulates in part this metabolic shift to ensure sufficient energy resources for the needs of the immune cells and tissues.

Drosophila lines and fly husbandry

The UAS-GAL4 -based system in Drosophila was utilized in most experiments to achieve the silencing or overexpression of genes in the F1 progeny [71]. The brm (transformant ID #37720), osa (#7810), MyD88 (#25399) and Relish (#108469) UAS-RNAi lines, and the isogenized w¹¹¹⁸ flies (w^1118iso) that were used as controls, were obtained from the Vienna Drosophila Resource Center (www.vdrc.at). cactus UAS-RNAi flies (5848R-3) were obtained from the National Institute of Genetics Fly Stock Center in Japan. Relish^E20 mutant flies were a kind gift from prof. Dan Hultmark. The Imd overexpression line that overexpresses the Imd protein under the control of UAS, was originally a kind gift from prof. Jules Hoffmann. The constitutively active Toll^10b mutant [72] was originally obtained from the Bloomington Drosophila Stock Center at Indiana University. C564-GAL4 flies, driving the expression of a UAS-construct in the fat body [37,38,73] and some other tissues, were a kind gift from Prof. Bruno Lemaitre (Global Health Institute, EPFL, Switzerland). The Daughterless-GAL4 (Da-GAL4) flies drive the expression of a UAS-construct ubiquitously [74]. The combination of the Hml^Δ-GAL4 (w¹¹¹⁸; P{Hml-GAL4.Δ}2P{wUAS-2xEGFP}AH2) driver [75] and the He-GAL4 (P{He-GAL4.Z}) driver [76](HH-GAL4) was used to drive the expression of the UAS-constructs in hemocytes [77]. The GAL4 drivers were backcrossed into the w¹¹¹⁸ background that was used as a control in crosses without a GAL4-driver. The hemocyte reporter lines eaterGFP (for plasmatocytes) [78] and MSNF9mo-mCherry (for lamellocytes, hereafter called msnCherry) [79] were obtained from Robert Schulz’s laboratory. The lines were recombined to create the msnCherry,eaterGFP reporter line. The msnCherry,eaterGFP reporter was further crossed with C564-GAL4 to obtain msnCherry,eaterGFP;C564-GAL4 (MeC564> for short). msnCherry, eaterGFP; Hml^Δ-GAL4; the He-GAL4 (MeHH>) line was a kind gift from I. Anderl.

To create lincRNA-IBIN overexpressing fly lines, the full-length gene for lincRNA-IBIN was cloned into the EcoRI and BcuI (SpeI) restriction sites in the pUAST vector using the following primers (with restriction sites underlined): CR44404_F: TAAGCAGAATTCCACAATCTAAAGTTAACTTGCC and CR44404_R: CACACAACTAGTGTTTATTTTCTTTCTATGGTTG. The produced plasmids were injected into the w¹¹¹⁸ background in Best Gene Inc., USA (thebestgene.com). Ten lines producing red-eyed transformants were generated, and two lines (lincRNA-IBIN¹ and lincRNA-IBIN⁷) with good overexpression of lincRNA-IBIN were selected for experiments.

For the experiments, 10–15 virgin females were crossed with 5–7 males per vial containing mashed-potato, syrup and yeast-based fly food medium. Crosses were kept at +25°C and flies transferred daily into fresh vials. The vials with eggs were transferred to +29°C after one day of egg laying and kept there until the experiments at the larval or adult stage unless otherwise stated. Test groups and controls were kept at the same conditions at all times. After testing that target genes of the Toll pathway were induced in a similar manner in the progeny male and female flies, male flies were used for the transcriptome analysis with and without a M. luteus infection. The expression of CR44404 was tested in both female and male flies and found to be equivalent, after which male flies were used in all of the subsequent experiments.

For the lifespan experiment, lincRNA-IBIN overexpressing flies (lincRNA-IBIN¹ and lincRNA-IBIN⁷ lines) were crossed with C564> driver flies at +25°C. After one day, the eggs were transferred to develop at +29°C for a maximum lincRNA-IBIN overexpression for the entire lifespan of the flies. Twice a week, the number of the flies was recorded and the flies transferred to fresh food.

Culturing bacteria for infections

Micrococcus luteus (M. luteus) was cultured on Luria-Bertani (LB) agar plates under Streptomycin selection (final concentration 100 μg/ml) and left to grow at 29°C for 2–3 days. Enterobacter cloacae (E. cloacae) was cultured on LB agar plates under Nalidixic acid selection (final concentration 15 μg/ml) and the plates were incubated overnight at 37°C. The concentrated bacterial culture used for pricking the flies was prepared by collecting the colonies from the plate into 100μl of 50% glycerol in phosphate buffered saline (PBS; 137 mmol/l NaCl, 2.7 mmol/l KCl, 10 mmol/l Na₂HPO₄, 1.8 mmol/l KH₂PO₄).

Enterococcus faecalis (E. faecalis) was cultured in Brain-Heart-Infusion (BHI) medium and incubated at 37°C with shaking (225 rpm) overnight. The absorbance of the E. faecalis bacterial culture grown overnight was measured with a spectrophotometer at 600nm after which it was diluted 1:25 in 5 ml of BHI medium and left to grow for 2–3 hours at 37°C with shaking (225 rpm) until the absorbance at 600nm was 0.75. Then 2 ml of the bacterial culture was centrifuged at 700 x g for 5 min and the supernatant was discarded. The pellet was resuspended into 100 μl of 50% glycerol in PBS and the bacterial concentrate was used for pricking the flies.

Fly infections

For bacterial infections, 0–2 day old male flies were collected and placed at +29°C for 48h, after which a septic injury to the flies was caused by pricking them in the thorax with a thin sharp tungsten wire dipped into a concentrated bacterial culture. For the activation of the Toll pathway, flies were infected with M. luteus (Gram-positive bacteria) and incubated for 24h at 25°C. For measuring AMP expression levels, infected flies and non-infected controls were incubated at 25°C for the duration of the infection, harvested, and their RNAs were extracted as described below. For survival experiments, M. luteus infected flies (24h, 25°C) were subsequently infected with E. faecalis and incubated at RT. The survival of the flies was monitored for 48h, as described earlier [39]. To activate the Imd pathway, the flies were infected with the Gram-negative bacterium E. cloacae, and the flies were incubated at 25°C for the duration of the infection.

Infecting Drosophila larvae with Leptopilina boulardi wasps

2^nd instar larvae were infected with strain G486 of L. boulardi parasitoid wasps by placing 20 female wasps in vials with larvae. After two hours at room temperature, the wasps were removed and the larvae were transferred back to +29°C. 48 hours later the larvae were dissected to collect the hemocytes, plasma and fat bodies. The infection status of the larvae was checked by visually confirming the presence of L. boulardi eggs or larvae.

Transcriptome analysis from total RNA (RNA sequencing)

For the first transcriptome analysis (Fig 1A and 1B), total RNAs from uninfected or M. luteus -infected (24h p.i.) w, osa^IR male flies were extracted with the TRI reagent. For the second transcriptome analysis (Fig 4), total RNAs were extracted from uninfected male flies with lincRNA-IBIN overexpression (C564>lincRNA-IBIN⁷), uninfected controls (w¹¹¹⁸,lincRNA-IBIN⁷), M. luteus -infected lincRNA-IBIN OE and control flies (24 h p.i.) and E. cloacae -infected lincRNA-IBIN OE and control flies (6 h p.i.). All the sample groups were crossed at the same time and kept in the same conditions until collection. The resulting RNA samples were DNase treated with the RapidOut DNA removal kit (Thermo Scientific). The quality of the total RNA samples was ensured with the Advanced Analytical Fragment Analyzer and found to be good. Total RNA samples were pure, intact and all samples were of similar quality.

The preparation of the RNA libraries and Illumina HiSeq 2500 sequencing were carried out in the Finnish Microarray and Sequencing Centre (Turku, Finland). The RNA libraries were prepared according to the Illumina TruSeq Stranded mRNA Sample Preparation Guide (part # 15031047): Firstly, the poly-A containing RNA molecules were purified using a poly-T oligo attached to magnetic beads. Following purification, the RNA was fragmented into small pieces using divalent cations under an elevated temperature. The cleaved RNA fragments were copied into first strand cDNA using reverse transcriptase and random primers. Strand specificity was achieved by replacing dTTP with dUTP in the Second Strand, followed by second strand cDNA synthesis using DNA Polymerase I and RNase H. The incorporation of dUTP in second strand synthesis quenches the second strand during amplification, because the polymerase used in the assay is not incorporated past this nucleotide. The addition of Actinomycin D to First Stand Synthesis Act D mix (FSA) prevents spurious DNA-dependent synthesis, while allowing RNA-dependent synthesis, improving strand specificity. These cDNA fragments then have the addition of a single 'A' base and subsequent ligation of the adapter: the Unique Illumina TruSeq indexing adapter was ligated to each sample during the adapter ligation step for later pooling of several samples in one flow cell lane. The products were then purified and enriched with PCR to create the final cDNA library. Typically, the RNAseq library fragments are in the range of 200–700 bp and the average size of the fragments is 250–350 bp. The samples were normalized, pooled for the automated cluster preparation and sequenced with an Illumina HiSeq 2500 instrument using TruSeq v3 sequencing chemistry. Paired-end sequencing with a 1 x 50 bp read length was used, followed by a 6 bp index run. The technical quality of the HiSeq 2500 run was good and the cluster amount was as expected.

In both transcriptome analyses, the reads obtained were aligned against the Drosophila melanogaster reference genome (BDGP6 assembly, downloaded from the Illumina iGenomes website and originally derived from Ensembl). The reads were associated with known genes based on RefSeq annotations derived from UCSC database and the number of reads associated with each gene was counted using the featureCount method. The counts were normalized using the TMM normalisation method of the edgeR R/Bioconductor package. The number of reads is represented as RPKM values (Reads Per Kilobase of exon per Million reads mapped). RPKM = total gene reads / [mapped reads (millions) x total length of gene exons (kb)]. Genes with expression values (read number) of less than 0.125 across the treatments were considered to be expressed at low levels and excluded from the analysis.

Tissue preparation for RNA extraction

For extracting RNA from whole flies or larvae, 3 x 5 individuals per phenotype were collected and snap-frozen on dry ice or in liquid nitrogen. For RNA extraction from the fat body, fat bodies from 3^rd instar larvae were dissected with forceps under a stereomicroscope and washed by dipping them three times into a 20 μl drop of 1 x PBS. In total, three biological replicates were prepared and pools of whole fat bodies from ten larvae per each biological replicate were used. Samples were snap-frozen in liquid nitrogen and stored at -80°C until RNA extraction. For RNA extraction from hemocytes and plasma, 55–60 larvae per replicate were washed, placed in a drop of 1 x PBS on a multiwell glass slide and dissected with forceps to release hemolymph. To separate hemocytes and plasma from hemolymph, suspensions were centrifuged at 2500 x g for 10 min, after which the plasma was carefully pipetted into a clean tube. Hemocytes and plasma samples were snap-frozen in liquid nitrogen and stored at -80°C until RNA extraction. For RNA extraction from adult guts, flies were dipped in 70% ethanol and dissected on a glass slide in 15 μl of 1 x PBS. The midgut region of the gut was separated and washed in a second drop of 1 x PBS. Guts from 10 flies per sample were pooled and centrifuged at 2000 x g for 2 min, after which PBS was removed and guts snap-frozen in liquid nitrogen and stored at -80°C until extraction.

RNA extraction

To start the RNA extraction, a sufficient amount of the TRI reagent (MRC, Fisher Scientific) was added to the frozen whole flies, larvae or tissues. Whole flies, larvae, fat body and gut tissues were quickly thawed and homogenized in the TRI reagent using a micropestle (Fisher Scientific). Hemocytes were homogenized in the TRI reagent by pipetting up and down for a minimum of ten times. Plasma samples were quickly thawed and suspended in the TRIzol LS reagent (Thermo Fisher Scientific) by pipetting up and down ten times. Thereafter, total RNAs were extracted according to the manufacturer’s (TRI reagent or TRIzol LS) instructions. RNA pellets were dissolved in nuclease-free water, and the RNA concentrations and the purity were determined by a Nano-Drop 2000 (Thermo Scientific) measurement.

Quantitative real-time PCR

Quantitative real-time PCR (qRT-PCR) was carried out with the iTaq Universal SYBR Green One-step kit (Bio-Rad, Hercules, CA, USA) using total RNAs (approximately 40 ng/sample) as templates. RpL32 or ND-39 was used as a housekeeping gene to normalize differences in RNA amounts between samples. In the experiments presented in Fig 3C, the amounts were standardized to 40 ng of total RNA/sample. This is because no products/mRNA from genes that are considered to have a housekeeping role are normally found in the plasma. Expression levels of genes in the test groups and controls were measured within the same qRT-PCR experiment. If the samples within an experiment did not fit in one 96-well plate, a reference sample was measured in all plates to make internal normalization between plates possible. In the qRT-PCR experimental figures, one uninfected control sample (indicated in the figure legend) was set to 1, to calculate fold-induction values. The primers used are listed in Table 1.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Table 1. qPCR primers.

https://doi.org/10.1371/journal.ppat.1007504.t001

Quantification of larval hemocytes with flow cytometry

Individual 3^rd instar wasp-infected and uninfected msnCherry,eaterGFP;C564>lincRNA-IBIN (MeC564>lincRNA-IBIN), msnCherry, eaterGFP; Hml^Δ>; He > lincRNA-IBIN (MeHH>lincRNA-IBIN) and control larvae were placed in a 20 μl drop of cold 8% BSA in 1 x PBS and dissected carefully with forceps. Carcasses were removed and the bled hemolymph was pipetted into a vial with 80 μl of 8% BSA in 1 x PBS. Ten larvae were dissected per cross and each cross was replicated three times. The samples were run with a BD Accuri C6 flow cytometer (BD, Franklin Lakes, NJ, USA), using a gating strategy established in [80]. In short, GFP-positive cells were detected in the FL1 (510/15 BP filter) and mCherry-positive cells in the FL3 (610/20 BP filter). GFP-only, mCherry-only and non-labelled hemocytes were used to establish the gates. Some of the GFP fluorescent signal was detected in the non-primary FL3 detector, and this was corrected for by subtracting 9% from the signal.

To check how well centrifuging separated the hemocyte and plasma fractions, five late 3^rd instar HH>GFP larvae were bled in 100 μl of 1 x PBS. The vials were centrifuged for 10 minutes at 2500 g at +4°C. The supernatant containing the plasma was pipetted into another vial (~90 μl) and the hemocyte pellet was re-suspended in 90 μl of 1 x PBS. Plasma and hemocyte samples were run with a flow cytometer and the numbers of GFP-positive hemocytes in both fractions were determined.

Imaging of Drosophila larvae

Late 3^rd instar larvae were gently washed in a drop of water with a brush, dried on a piece of tissue paper and placed on a glass slide dorsal side facing up in a drop of 70% ice-cold glycerol. A coverslip was placed on the larvae and they were stored at +4°C overnight. The next day, the immobilized larvae were imaged with a Zeiss AxioImager M2 with Apotome 2, with an EC Plan Neofluar 5x/0.16 objective. A Colibri LED light source was used to excite GFP (LED 470 nm) and mCherry (LED 555 nm) and images were captured with an AxioCam HRm CCD camera. Images were processed with ImageJ (Version: 2.0.0-rc-59/1.51j) and Adobe Photoshop CS4. Ten larvae per cross were imaged.

Cellular localization of lincRNA-IBIN with RNA FISH in the larval hemocytes

For detecting the cellular localization of lincRNA-IBIN, the RNA fluorescence in situ hybridization (RNA FISH) method with Cy3-tagged probes labeling the lincRNA-IBIN molecules was used. Late 3^rd instar male larvae were washed in a drop of water with a brush and the hemolymph of two larvae per sample type (four biological replicates) was carefully bled out from the larvae in 20 μl of ice-cold 1 x PBS on a multiwell glass slide well, avoiding contamination from other tissues. Hemocytes were left to adhere for one hour in a humidified chamber at RT. Samples were fixed with cold 3.7% paraformaldehyde in 1 x PBS for 5–10 min and washed with 1 x PBS for 3 x 5 min. Samples were permeabilized with 1 x PBS + 0.1% Triton X-100 for 5 minutes and washed with 1 x PBS until there was no foam, and the mask around the wells was dried carefully with a tissue paper. The samples were blocked with 3% BSA in 1 x PBS at +4°C o/n. The RNA FISH protocol was performed by using the QuantiGene ViewRNA Assay (Affymetrix) and the probes for lincRNA-IBIN and RpL32 for Drosophila are now available in their catalog. For the hybridization of lincRNA-IBIN and RpL32 probes (control) and a negative “no probe” control, pre-warmed diluents and humidified chambers were used, and the incubator temperature (+40°C) was monitored. The Working Probe Set Solution was prepared by diluting each probe set 1:100 in Probe Set Diluent QF: 20 μl drops were prepared for each sample by combining 0.2 μl of Probe Set and 19.8 μl of Probe Set diluent QF. The previous solution was aspirated from the wells and replaced with 20 μl of the Working Probe Set Solution and the samples were incubated in humidified chambers for three hours at +40°C. Working Probe Set Solution was aspirated and the wells were washed three times with Wash Buffer (this was used in all the washes). 20 μl of PreAmplifier Mix solution per sample was prepared by diluting PreAmplifier Mix 1:25 in Amplifier Diluent QF and added to samples and incubated at +40°C for 30 min. After washing three times, Amplifier Mix solution was prepared by diluting Amplifier mix 1:25 in pre-warmed Amplifier Diluent QF, added to the samples and incubated at +40°C for 30 min. After three washes, the Label Probe Mix Solution was prepared by diluting Label Probe Mix 1:25 in Label Probe diluent QF, added to the samples and incubated at +40°C for 30 min. Samples were washed three times and were left for 10 min in the wash buffer for the final wash. The samples were mounted with 20 μl of ProLong Gold Antifade Mountant with DAPI (Thermo Fisher Scientific). Cover glasses were pressed on and the slides were left to harden overnight in the dark, transferred to +4°C for a day and imaged.

The samples were imaged with a Zeiss LSM 780 confocal microscope with a Plan Apochromat 63 x/1.4 oil immersion objective. A pulsed diode laser was used to excite DAPI (405 nm) and a diode laser (561 nm) was used to excite Cy3 for imaging lincRNA-IBIN and RpL32. Images were captured using a Quasar spectral GaAsP PMT array detector and camera allowing fast spectral imaging. Images were processed with ImageJ (Version: 2.0.0-rc-59/1.51j) and Adobe Photoshop CS4.

Measuring glucose, trehalose and glycogen from adult hemolymph

lincRNA-IBIN overexpressing (C564>lincRNA-IBIN⁷) and control flies (w¹¹¹⁸,lincRNA-IBIN⁷) were allowed to eclose for 2 days, collected in fresh vials and kept at 29°C for two days prior to collecting the hemolymph. For experiments with infected and uninfected flies, w¹¹¹⁸ flies were collected as above. w¹¹¹⁸ flies were kept in fresh vials at 25°C for one day, after which half of them were infected by septic injury with a E. cloacae -contaminated needle. Flies were kept at 25°C for another 24 h prior to collecting the hemolymph. The hemolymph was collected by pricking the flies in the thorax with a thin sharp tungsten wire sterilized in 70% ethanol. Pools of 50 pricked flies were collected on ice in 0.5 ul microtubes with small holes punctured in them and placed in 1.5 μl microtubes. The flies were centrifuged at 5000 x g for 5 min, after which 0.8 μl of hemolymph was collected from the bottom of the 1.5 ml tube and diluted 1:100 in Trehalase Buffer (TB; 5 mM Tris pH 5.5, 137 mM NaCl, 2.7 mM KCl). The samples were snap-frozen in liquid nitrogen and stored at -80°C. Glucose and trehalose were analyzed using a colorimetric assay (Sigma Glucose (GO) assay kit, GACO20) based on the glucose oxidase (GO) enzyme following the protocol described in [81]. First, a trehalase stock was prepared by diluting 3 μl of porcine trehalase (Sigma-Aldrich; T8778-1UN) with 1 ml of TB. Samples were heat-inactivated for 5 min at 70°C, and divided into two 40 μl aliquots; one treated with an equal amount of trehalase stock to break down trehalose into free glucose, and the other left untreated by adding an equal amount of TB only. The samples were then incubated at 37°C overnight. Glucose standards were prepared by diluting 16 μl of a 1 mg/ml glucose stock solution with 84 μl of TB. 2-fold standard dilution curves were generated. Next morning, a 30 μl aliquot of each sample, the dilution series and a blank were loaded onto a 96-well plate and 100 μl of the GO reagent (GAGO20 Glucose assay kit, Sigma-Aldrich) was added. The plate was sealed with parafilm and incubated at 37°C for one hour. To stop the reaction, 100 μl of 12 N sulfuric acid (H₂SO₄) was added on the samples, after which the absorbance at 540 nm was measured using the Wallac Envision 2104 Multilabel Reader (PerkinElmer). The amount of glucose and trehalose (glucose + trehalose—glucose) in the samples were determined according to the glucose standard curve.

C564-GAL4 expression in the gut

To verify that the C564-GAL4 driver is expressed in the guts of adult flies, C564>GFP males and females were dissected in a drop of 1 x PBS and their guts were removed. The guts were checked for GFP expression using a stereomicroscope fluorescence adapter (NIGHTSEA, MA, USA) with a Royal blue LED (440–460 nm) for excitation and a 500 nm long-pass filter. Images were captured with Nikon DS-Fi2 camera.

Statistical analyses

The first transcriptome analysis (Fig 1A and 1B) data was analyzed using the R package Limma. The package uses a modified t-test to generate an FDR (false discovery rate) corrected p-value (adjusted p-value) for each comparison. In the second transcriptome data analysis, the comparison between lincRNA-IBIN overexpression and controls (Fig 4A, S4 Table and S5 Table) was done using a two-tailed t-test (unequal variances assumed) with a 5% false discovery rate (FDR) correction using the Benjamini-Hochberg method [82]. In Fig 4B, genes that had a normalized read number >10 in the treatment of interest and an expression fold change >2 were included in the cluster analysis performed with the DAVID Bioinformatics resources 6.8 (https://david.ncifcrf.gov) [83,84] online tool. For Fig 4C and 4D, pairwise comparisons between uninfected control sample and different treatments were carried out using a two-tailed t-test assuming unequal variances.

Statistical analyses of gene expression by qRT-PCR results were carried out using a two-tailed t-test for two samples assuming equal variances. Statistical analyses of fly survival experiments were carried out using the log-rank (Mantel-Cox) test with Prism 6 (GraphPad). Data on hemocyte quantifications and types were plotted and analyzed with R version 3.3.2 (2016-10-31), Copyright 2015 The R Foundation for Statistical Computing. Data were analyzed using analysis of variance (ANOVA) followed by Tukey’s HSD post hoc test when requirements for normality and homoscedasticity were met, and in other cases a non-parametric Kruskal-Wallis rank sum test followed by Dunn’s post hoc test were applied. The level of statistical significance was established as p < 0.05.