There is an incorrect sequence listed in the Microinjections section of the Materials and Methods. The corrected section is: Fertilized one-cell zebrafish embryos were injected with 6 ng miR-30 morpholino in 1 nl (TGCACCAGCTTCCAGTCAAGGATGTTTACAG), 50 pg of miR-30 duplex RNA and 50 pg in vitro-transcribed capped GFP mRNAs. Zebrafish smoothened 3′UTR sequence was amplified by RT-PCR and subcloned downstream of the GFP ORF that was inserted into vector pCS2+. A morpholino designed against smoothened was used to determine antibody specificity, (GAGGACATCTTGGAGACGCAACAAA) and injected at 2.5 ng per embryo (Fig. S3). The smoothened target protector sequence was GTGTATGTAAACACCATAAACTGAC and was injected at 9 ng/embryo.
Citation: Ketley A, Warren A, Holmes E, Gering M, Aboobaker AA, Brook JD (2013) Correction: The miR-30 MicroRNA Family Targets smoothened to Regulate Hedgehog Signalling in Zebrafish Early Muscle Development. PLoS ONE 8(11): 10.1371/annotation/4e68e9f8-74c0-4c45-828f-7d51786c13e2. https://doi.org/10.1371/annotation/4e68e9f8-74c0-4c45-828f-7d51786c13e2
Published: November 6, 2013
Copyright: © 2013 . This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Competing interests: No competing interests declared.