Figures
Abstract
Deletions at chromosome 2p25.3 are associated with a syndrome consisting of intellectual disability and obesity. The smallest region of overlap for deletions at 2p25.3 contains PXDN and MYT1L. MYT1L is expressed only within the brain in humans. We hypothesized that single nucleotide variants (SNVs) in MYT1L would cause a phenotype resembling deletion at 2p25.3. To examine this we sought MYT1L SNVs in exome sequencing data from 4, 296 parent-child trios. Further variants were identified through a genematcher-facilitated collaboration. We report 9 patients with MYT1L SNVs (4 loss of function and 5 missense). The phenotype of SNV carriers overlapped with that of 2p25.3 deletion carriers. To identify the transcriptomic consequences of MYT1L loss of function we used CRISPR-Cas9 to create a knockout cell line. Gene Ontology analysis in knockout cells demonstrated altered expression of genes that regulate gene expression and that are localized to the nucleus. These differentially expressed genes were enriched for OMIM disease ontology terms “mental retardation”. To study the developmental effects of MYT1L loss of function we created a zebrafish knockdown using morpholinos. Knockdown zebrafish manifested loss of oxytocin expression in the preoptic neuroendocrine area. This study demonstrates that MYT1L variants are associated with syndromic obesity in humans. The mechanism is related to dysregulated expression of neurodevelopmental genes and altered development of the neuroendocrine hypothalamus.
Author summary
Intellectual disability is defined by having an intelligence quotient of less than 70 points, and it affects about 2–3 people in every 100. Obesity is defined as having a body mass index of over 30 in adults or over the 95th centile in children. Both of these conditions are major public health concerns in Western countries. Genetic studies have shown that small missing pieces of chromosome (deletions, which remove many genes) and changes to the lettering of genes (which stop the gene from working, mutations) can cause intellectual disability or obesity. Here we identified 9 children with intellectual disability and obesity who have mutations in a gene called MYT1L. This gene is thought to give an important instruction for brain development. To find out what the effect of loss of MYT1L is on brain development we reduced the levels of MYT1L (using a special chemical) in an experimental zebrafish. This showed that loss of MYT1L in zebrafish causes a problem with the development of the hypothalamus, which may explain how MYT1L mutations cause obesity in humans. In the zebrafish there was also reduction of a brain hormone called oxytocin which is involved in thought processes, which may explain why MYT1L mutations cause intellectual disability. We have identified a new genetic condition caused by MYT1L mutations, further study of this gene will help us understand, and treat, intellectual disability and obesity.
Citation: Blanchet P, Bebin M, Bruet S, Cooper GM, Thompson ML, Duban-Bedu B, et al. (2017) MYT1L mutations cause intellectual disability and variable obesity by dysregulating gene expression and development of the neuroendocrine hypothalamus. PLoS Genet 13(8): e1006957. https://doi.org/10.1371/journal.pgen.1006957
Editor: Zornitza Stark, Murdoch Childrens Research Institute, AUSTRALIA
Received: May 12, 2017; Accepted: August 4, 2017; Published: August 31, 2017
Copyright: © 2017 Blanchet et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Data Availability: All microarray data (clariom S array) data are available from the University of Sheffield open access data repository: https://doi.org/10.15131/shef.data.5319118.
Funding: Funding for the project was provided by the Wellcome Trust. We declare that those who collected data and deposited it in the DECIPHER database bear no responsibility for its use and interpretation in the current work. The DDD study presents independent research commissioned by the Health Innovation Challenge Fund (grant number HICF-1009-003), a parallel funding partnership between the Wellcome Trust and the Department of Health, and the Wellcome Trust Sanger Institute (grant number WT098051). The cell biology part of the study was funded by a grant from BDF Newlife SG/15-16/07 (AM). This work was supported by grants from the US National Human Genome Research Institute (NHGRI; UM1HG007301) and the National Cancer Institute (NCI; R01CA197139). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: The authors have declared that no competing interests exist.
Introduction
Intellectual disability (ID) is defined by having a full-scale intelligence quota (IQ) of under 70, causing difficulties with day to day functioning [1]. ID affects 2–3% of people and is a significant public health concern as it is associated with substantial morbidity and mortality [1]. Obesity is defined as a body mass index (BMI) of over 30 in adults or greater than the 95th centile in children (CDC definition) [2]. Obesity affects around 30% of adults in the United States of America and 10–20% of Europeans [2]. Obesity is associated with cardiovascular disease and certain cancers [2].
Copy number variants (CNVs) and single nucleotide variants (SNVs) are a well-recognized cause of ID [3]. 10–30% of individuals with ID will have a pathogenic CNV [3]. Exome sequencing can detect pathogenic SNVs in around 30% of people with ID without a CNV [4]. Pathogenic CNVs and SNVs are also found in obesity, usually in association with a syndromic presentation [5]. For example, both CNVs and SNVs of SIM1 are associated with obesity in humans [6, 7]. In SIM1 deletion heterozygous mice there is impaired development of the paraventricular nucleus of the hypothalamus, with reduced melanocortin-4 receptor and oxytocin expression, in association with hyperphagic obesity [8, 9].
Deletions at 2p25.3 are associated with a syndrome consisting of ID and obesity [10,11,12,13,14]. The smallest region of overlap contains the PXDN and myelin transcription factor-1 like (MYT1L) genes [10]. Bi-allelic SNVs in PXDN are associated with congenital cataracts [15]. No CNVs containing only PXDN have been reported in DECIPHER in association with ID. Thus PXDN is not a strong candidate gene for the phenotype associated with 2p25.3 deletions. SNVs in MYT1L have been reported in 2 children with ID [10]. MYT1L is a member of the myelin transcription factor family, which is defined by the presence of a unique cystein-cystein-histidine-cystein zinc finger domain [16]. MYT1L is a pro-neuronal transcription factor, and, in combination with other transcription factors can re-program fibroblasts into neurons [17]. In vitro studies indicate that MYT1L functions as a transcriptional repressor [16]. The role of MYT1L in brain development is not well understood. However, myelin transcription factor-1 (MYT1) has been shown to repress transcription in neuronal progenitor cells, hence blocking Notch signaling and promoting neuronal differentiation [18]. Based upon its biological function MYT1L is a strong candidate gene for ID.
Within certain deletion regions, there are single genes in which SNVs recapitulate the deletion phenotype. For example, we recently demonstrated that 2p25.2 deletions and SNVs in SOX11 present with Coffin-Siris syndrome [19]. Here we utilized exome-sequencing data from 4,296 parent-child trios in the Deciphering Developmental Disorders (DDD) study to demonstrate that SNVs in MYT1L are associated with a phenotype resembling that of 2p25.3 deletions with ID and obesity [4]. Through gene expression profiling of an MYT1L null cell line we show that MYT1L regulates a network of transcription factors involved in neurodevelopmental disorders. Knockdown of MYT1L orthologues in zebrafish resulted in altered hypothalamic oxytocin expression, providing a potential mechanism for the obesity phenotype in humans.
Results
Exome sequencing identifies MYT1L variants in individuals with intellectual disability
We identified 4 individuals with heterozygous de novo MYT1L variants through trio exome sequencing performed as part of the Deciphering Developmental Disorders study and an additional 5 individuals with heterozygous de novo MYT1L variants through a genematcher facilitated collaboration (https://genematcher.org/)[20]. Table 1 and Fig 1 summarize the clinical and genetic findings.
The heatmap depicts the frequency of various clinical features in MYT1L variant carriers.
Patient 1 (DECIPHER ID 268494) is a 10 year old girl with intellectual disability and autism. She was born at 31 weeks of gestation with bilateral talipes equinovarus and camptodactyly of the ring and middle fingers. Up until 5 years of age she had troublesome gastro-esophageal reflux. She first sat at 12 months old. From age 6 years she could take single steps with support. She requires a wheelchair and has never walked independently. She first said single words at 5–6 years old and at 10 years old speaks in simple sentences. She has dysarthria. She has had surgery for bilateral strabismus. Her parents reported hyperphagia and her BMI was greater than the 99th centile. Comparative genomic hybridization (CGH) and SNRPN 15q methylation (for Prader-Willi syndrome) were normal. Exome sequencing demonstrated a frameshift variant in MYT1L (g.1926242CA>C, p.Leu381fs).
Patient 2 (DECIPHER 279017) is a 9 year old boy with intellectual disability who attends a special needs school. Pregnancy and birth were unremarkable. He first spoke single words at 15 months. On examination he was noted to have posterior plagiocephaly, 5th finger clinodactyly and an ataxic gait. He was not dysmorphic. His parents described him as having hyperphagia and his BMI was on the 96th centile. At age 9 he wears clothes for an 11–12 year old. CGH was normal and brain magnetic resonance imaging (MRI) demonstrated cerebral atrophy. Exome sequencing demonstrated a missense variant in MYT1L (g.1915795C>T, p.Arg569Gln).
Patient 3 (DECIPHER ID 279061) is a 10 year old boy with intellectual disability, Attention Deficit Hyperactivity Disorder (ADHD) and verbal dyspraxia. He sat at 18 months and walked first at 2.5 years. He first said single words at 4–5 years old. At 10 years old he uses 2 word phrases, but mainly communicates with sign language. He wears glasses for anioshypermetropiic astigmatism. He was described as having hyperphagia and his BMI was on the 85th centile. CGH, fragile X, PWS testing and brain MRI were normal. Exome sequencing demonstrated an MYT1L missense variant (g.1915823G>A, p.His560Tyr)
Patient 4 (DECIPER ID 276823) is a 28 year old woman with severe intellectual disability, autism, self-injurious behavior and ADHD. She was born at 42 weeks of gestation with spina bifida. She developed hydrocephalus in the first week of life. She has a ventricular shunt and has required several procedures for shunt blockage. She sat at 18 months. She smiled at 3 weeks. She said single words at 4–5 years. She requires a wheelchair because of spastic paraparesis due to spina bifida. She is not dysmorphic. Her behavior is reported to be challenging, including episodes of biting and pinching, triggered by excessive stimuli such as noise or crowding. She has limited verbal communication, and uses communication aids. She can comprehend short (3 key phrases) sentences. Due to her level of disability she does not request or seek food. However, when given food at mealtimes, she was noted to have a tendency to fill her mouth excessively with food while eating. It was not possible to obtain weight or height. However, she wears UK dress size 22 clothes (equivalent to dress size 20 in United States of America, dress size 50 in Europe and dress size 24 in Australia). CGH was normal. Exome sequencing demonstrated an MYT1L splice donor variant (g.1915791C>T).
Patient 5 is a 17 year old woman with intellectual disability and autism. She was born at 41 weeks gestation with no birth complications. Gross motor, fine motor and speech delay was noted at 2 and 4 years old. She is noted to have dyslexia. She was not dysmorphic. She had complex partial seizures from the age of 11 years old. She was reported to have hyperphagia and BMI was greater than the 99th centile. CGH and brain MRI were normal. Whole genome sequencing demonstrated an MYT1L missense variant (g.1921036A>G, p.Leu520Pro).
Patient 6 is a 15 year old girl with intellectual disability who attends a special needs school. She first walked at 22 months old and had delayed speech. She was not dysmorphic. She did not have hyperphagia and her BMI was on the 74th centile. CGH was normal. Exome sequencing demonstrated an MYT1L frameshift variant (g.1895856_1895865del, p.Thr741fs).
Patient 7 is a 5 year old girl with intellectual disability who required additional help at school. She was born at term with no birth complications. She first sat at 9 months. She walked first at 19 months. She required physiotherapy. She had speech delay, speaking single words after 2 years of age. At 5 years old she had ongoing speech and language delay and was reported to be clumsy. She was not dysmorphic. Eye examination demonstrated hyperopia and strabismus. She had hyperphagia and her BMI was greater than the 99th centile. CGH demonstrated a 20p12 duplication, inherited from her phenotypically normal father. Exome sequencing demonstrated an MYT1L nonsense variant (g.1890345G>A, p.Arg839Ter).
Patient 8 is a 3 year old girl with global developmental delay and autistic behaviour. She was born at term with no pregnancy or birth complications. She had global hypotonia during the first few months of life. She had global developmental delay. She first sat at 9 months of age, walked independently at 2 years of age. At age 3 she had not developed speech, but used sign language. At age 3 she was beginning to learn to run. She could draw a line and a circle. She had absence seizures. Her BMI was on the 75th centile and hyperphagia was not present. MRI brain demonstrated thinning of the corpus callosum. Exome sequencing demonstrated an MYT1L missense variant (g.1921025G>T, p.His524Asn).
Patient 9 is a 13 year old boy with global developmental delay and ADHD. Pregnancy and birth were unremarkable. Hypotonia and poor sleep were noted in the neonatal period. He first sat at 12 months of age and walked at 22 months. He spoke single words at 29 months of age. At 5 years old he knew 20 words, but had pronunciation difficulties. At 7 years old he knew 50 words and was using 2-word sentences. At the age of 13 he was unable to read, write or count. He attends a special educational needs school. His BMI was on the 68th centile. A next generation sequencing gene panel test demonstrated an MYT1L missense variant (c.1579G>A, p.Gly527Arg).
The MYT1L gene is constrained for missense and protein truncating variants
Protein truncating variants (PTV) in developmentally crucial genes should occur less frequently than predicted in individuals without developmental disorders. The expected frequency of PTV in human genes has been reported in the ExAC database based upon parameters such as mutation rates for given nucleotide bases [21]. We identified only a single loss of function variant in MYT1L in the ExAC database (accessed March 2017) [21]. This is compared to an expected number of 33 loss of function variants, giving a probability of loss of function intolerance score of 1.0 (a probability of loss of function intolerance score>0.9 indicates intolerance to loss of function). In addition, 205 missense variants were reported, compared to an expected 402.5 missense variants (Z score = 4.81, indicating constraint on variation). The Provean (median -5.2 [interquartile range -6.0 - -3.85] vs -1.1 [interquartile range -2.59 - -0.43], Mann-Whitney U-test, u = 344, z = -2.96, p = 0.012) and SIFT (median 0.001 [interquartile range 0.005–0.28] vs 0.068 [interquartile range 0.0003–0.003], Mann-Whitney U-test, u = 569, z = -2.61, p = 0.025) scores for the missense variants in our patients were significantly higher than the scores for ExAC missense variants (Fig 2A). This indicates substantial constraint on both PTV and missense variants. This supports a pathogenic role for PTV and missense variants in the reported phenotype. In addition, an in silico model of the structural effects of the MYT1L missense variants indicated that they were likely to interfere with DNA binding (Fig 2B).
(A)Schematic diagram of MYT1L protein, the yellow boxes indicate zinc finger domains. The missense variants are indicated by arrows. (B)Model of the 2nd and 3rd zinc fingers of MYT1L bound to DNA. This is based upon the structure of the 4th and 5th zinc fingers of MYT1 (protein data bank file 2mf8), which have high sequence similarity to the 2nd and 3rd zinc fingers of MYT1L. The second zinc finger is in magenta, and the third finger in green. The beige spheres represent the zinc ions, with the CCHC zinc ligands shown in cyan. Replacement of L520 by proline is expected to disrupt the structure of the protein by preventing the formation of a tight turn. H524 and G527 are a zinc ligands, so replacement will also disrupt the structure. H560 and R569 are conserved residues directly involved in DNA binding. Image created using Pymol.
The phenotype of MYT1L variant carriers resembles that of 2p25.3 microdeletion patients
To examine the hypothesis that haploinsufficiency for MYT1L drives the 2p25.3 deletion syndrome, we compared the phenotype of 2p25.3 deletion carriers with those of MYT1L single nucleotide variant (SNV) carriers. The phenotypes associated with deletion of 2p25.3 were defined by a literature review [10, 11, 12, 13, and 14] and we report an unpublished case (patient 10 in Table 1). The smallest region of overlap contains PXDN and MYT1L. No PXDN SNVs were identified in the DDD exome dataset. Using Fischer’s exact test there was no significant difference between the proportions of deletion or SNV patients with the following phenotypes: intellectual disability, gross motor delay, speech delay, autism, overweight/obese or hyperphagia. This supports our hypothesis that MYT1L haploinsufficiency is central to the 2p25.3 deletion phenotype.
Expression of MYT1L occurs in brain regions relevant to the human disease phenotype
Given the phenotype of intellectual disability and predisposition to overweight/obesity we reasoned that MYT1L should be expressed in relevant neuroanatomical structures. We first confirmed that MYT1L expression is confined to the brain and pituitary in humans using the GTEx Portal (accessed March 2017) [22]. We then utilized the Allen Brain atlas to examine the spatial expression pattern of MYT1L in human brain [23].
In keeping with a role in cognition/intellectual disability, MYT1L is expressed at significantly higher levels in the adult cerebral cortex than in the hippocampus, basal ganglia and hypothalamus (Mann-Whitney U-test, P<0.001)(Fig 3A). We could not demonstrate significant expression of MYT1L in hypothalamic structures relevant to appetite and obesity in the adult brain.
(A) MYT1L expression levels are significantly higher in the frontal cortex than hippocampus, basal ganglia or hypothalamus in adult brain (p<0.001). Data presented as median z-score +/- 95% confidence interval. (B) MYT1L expression levels in the developing hypothalamus are significantly higher at 15–16 post conception weeks than 21 post conception weeks (p<0.001). The labels on the x-axis with 21 indicate expression at 21 post conception weeks, the x-axis labels without 21 indicate expression at 15–16 weeks. Data presented as median z-score +/- 95% confidence interval AHN = anterior hypothalamic nucleus. DMHN = dorsomedial hypothalamic nucleus. LHA = lateral hypothalamic area. MMN = medial mammillary nucleus. PHN = posterior hypothalamic nucleus. PVN = paraventricular nucleus. VMHN = venteromedial hypothalamic nucleus.
We then hypothesized that MYT1L might be expressed in hypothalamic structures relevant to appetite and obesity during brain development. Data from the prenatal LMD microarray from the Brainspan atlas of the developing human brain demonstrated that MYT1L was expressed in multiple hypothalamic structures at 15–16 post conception weeks (pcw), with significant reduction in expression at 21 pcw (Mann-Whitney U-test, p<0.001)(Fig 3B). This suggests that MYT1L principally plays a role in hypothalamic development rather than postnatal hypothalamic function.
Loss of MYT1L expression dysregulates expression of genes involved in neurodevelopmental disorders
To study the transcriptional consequence of loss of MYT1L function we created a Human Embryonic Kidney (HEK) null cell line using CRISPR-Cas9. Sanger sequencing of genomic DNA confirmed creation of homozygous premature stop codons in MYT1L. Gene expression profiling using the Clariom S array identified 955 differentially expressed genes (2-fold expression change, false discovery rate 2%). Enrichment analysis (using Enrichr http://amp.pharm.mssm.edu/Enrichr/) [24]demonstrated that the differentially expressed gene set was enriched for the Gene Ontology Biological Process 2015 term gene expression (GO:0010467, adjusted p-value 0.00077, Z-score -2.34, combined score 16.77)(Fig 4A) and Gene Ontology Cellular Component 2015 terms nucleolus (GO: 0005730, adjusted p-value 0.0023, Z-score -2.21, combined score 13.43) and nucleoplasm (GO: 0005654, adjusted p-value 0.005853, Z-score -2.08, combined score 11.4) (Fig 4B). The gene set was also enriched for the Reactome 2016 pathways Gene Expression_Homo Sapiens_R-HAS-74160 (adjusted p-value 2.2 x 10–7, Z-score -2.16, combined score 33) and Generic Transcription Pathway_Homo Sapiens_R-HAS-212436 (adjusted p-value 0.01586, Z-score -2.26, combined score 9.35)(Fig 4C). The differentially expressed genes were also enriched for genes from the OMIM disease ontology term mental retardation (p-value 0.045, adjusted p-value 0.38, Z-score -1.32, combined score 1.27)(Fig 4D). This suggests that MYT1L regulates a network of genes that control transcription, and which have themselves been implicated in the etiology of neurodevelopmental disorders.
(A)Enrichment analysis demonstrates enrichment for Gene Ontology Biological Process 2015 term gene expression (GO:0010467, adjusted p-value 0.00077, Z-score -2.34, combined score 16.77). (B)Enrichment analysis demonstrates enrichment for Gene Ontology Cellular Component 2015 terms nucleolus (GO: 0005730, adjusted p-value 0.0023, Z-score -2.21, combined score 13.43) and nucleoplasm (GO: 0005654, adjusted p-value 0.005853, Z-scre -2.08, combined score 11.4). (C)Enrichment analysis demonstrates enrichment for Reactome 2016 pathways Gene Expression_Homo Sapiens_R-HAS-74160 (adjusted p-value 2.2 x 10–7, Z-score -2.16, combined score 33) and Generic Transcription Pathway_Homo Sapiens_R-HAS-212436 (adjusted p-value 0.01586, Z-score -2.26, combined score 9.35). (D)Enrichment analysis demonstrates enrichment for OMIM disease term mental retardation (p-value 0.045, adjusted p-value 0.38, Z-score -1.32, combined score 1.27).
The zebrafish MYT1L orthologs (myt1la and myt1lb) are expressed only in the central nervous system
Given the obesity phenotype in patients with MYT1L SNVs we hypothesized that loss of MYT1L function may interfere with development of the neuroendocrine hypothalamus. We sought to explore this by creating a zebrafish knockdown model. MYT1L has two orthologs in zebrafish: myt1la and myt1lb. By using whole mount in situ hybridization (WISH) we demonstrate that both orthologs are expressed diffusely within the zebrafish central nervous system, including the hypothalamus, and not within any extra-neuronal tissues (Fig 5A). This resembles the expression pattern in humans.
(A)Whole mount in situ hybridization demonstrating that MYT1L orthologs myt1la and myt1lb are expressed throughout the zebrafish central nervous system. T = telencephalon, te = tectum, hy = hypothalamus, h = hindbrain. (B)Whole mount in situ hybridization demonstrating loss of myt1la expression in arnt2 mutant zebrafish, top panel shows control fish and bottom panel arnt2 mutant fish. The embryos are heavily over-stained to show the low-level expression of myt1la in the ventral diencephalon. The arrow indicates the region of the neuroendocrine preoptic area where oxytocin expressing neurons are located. (C)Whole mount in situ hybridization demonstrating that knockdown of myt1la and myt1lb, alone or in combination, results in loss of oxytocin expression in the neuroendocrine preoptic area. Arrows indicate neuroendocrine preoptic area. (D)Bar chart quantifying loss of oxytocin expression in neuroendocrine preoptic area. WISH for oxytocin was quantified as follows: ~30 cells = wild type expression, 5–15 cells = reduced, 1–4 = highly reduced, 0 = no expression (E)Whole mount in situ hybridization demonstrating that knockdown of myt1la/b results in loss of arginine vasopressin expression in the neuroendocrine preoptic region (indicated by arrow) but not the ventral hypothalamus (indicated by arrowhead). (F) Bar chart quantifying loss of arginine vasopression expression in myt1la/b morphants. WISH for arginine vasopressin was quantified as follows: ~30 cells = wild type expression, 5–15 cells = reduced, 1–4 = highly reduced, 0 = no expression.
Loss of sim1 function results in reduced myt1la expression in zebrafish
ANRT2 encodes a dimerization partner required for SIM1 function in hypothalamic development. To examine the role of SIM1-ARNT2 in regulating myt1la/mytl1b we performed WISH for myt1la in the previously described homozygous arnt2hi2639Tg null zebrafish [25]. In the mutant zebrafish myt1la was undetectable in the hypothalamus (Fig 5B). This shows a role for SIM1-ARNT2 dimers in regulating myt1la expression in the hypothalamus. These experiments demonstrate that MYT1L lies downstream of SIM1-ARNT2 in the leptin-melanocortin-SIM1 pathway, and, in turn, MYT1L regulates OXT expression in the hypothalamus.
Knockdown of myt1la/myt1lb causes altered hypothalamic development in zebrafish
Antisense morpholinos (MO) targeting myt1la or myt1lb, alone or in combination, were injected into zebrafish embryos at the 1- or 2-cell stage. The amount of MO injected was kept constant. WISH using probes against oxytocin (OXT) or arginine vasopression (AVP) was performed. MO targeting myt1la or myt1lb resulted in an almost complete loss of OXT in the neuroendocrine pre-optic area (Fig 5C and 5D). MO targeting myt1la or myt1lb also resulted in an almost complete loss of AVP in the neuroendocrine pre-optic area, but not in the ventral hypothalamus (Fig 5E and 5F). This suggests that myt1la and myt1lb may play a specific role in regulating the development of the neuroendocrine hypothalamus.
Discussion
Here we describe 9 individuals with de novo SNVs in MYT1L. These individuals shared several phenotypic features. All had global developmental delay or intellectual disability. Gross motor delay was present in all, and patient 1 had not walked independently by the age of 10 years old. Patient 4 also required a wheelchair, but this was related to spastic paraparesis secondary to spina bifida. No other individuals with CNVs or SNVs of MYT1L have been reported with a neural tube defect. The spina bifida in patient 4 is likely etiologically unrelated to the MYT1L SNV. Six of the MYT1L SNV carriers were overweight or obese based upon BMI centiles and patient 4 requires a dress size 22, implying obesity. Five of the patients had hyperphagia, but patient 4 did not have sufficient speech development or motor function to ask for or take food. Three had a diagnosis of an autism spectrum disorder. There was no shared, distinctive facial dysmorphology. Two MYT1L SNV carriers have been reported by De Rocker et al: patient 14 had developmental delay, autism and was described as obese (BMI not reported), patient 15 had developmental delay, autism and BMI >97th centile [10]. An autistic male with developmental delay and febrile seizures in association with an MYT1L nonsense mutation was reported by Wang et al [26], however BMI was not described in this paper. There was no significant difference in the frequency of phenotypic features between 2p25.3 deletion and MYT1L SNV carriers. This suggests that haploinsufficiency for MTY1L drives the 2p25.3 deletion phenotype. Our report confirms that CNVs and SNVs of MYT1L are associated with a syndromic presentation consisting of developmental delay/ID, hyperphagia and obesity.
The clinical presentation of MYT1L CNV and SNV carriers overlaps with other mendelian causes of obesity. Prader-Willi syndrome (PWS) is a well-recognized cause of hyperphagic obesity [27]. The presence of characteristic dysmorphology and hypogenitalism may help differentiate PWS from MYT1L SNV/CNV carriers [27]. Deletions and SNVs of SIM1 are associated with hyperphagic obesity [6, 7], with developmental delay associated with 6q14.1 deletions [7]. Bi-allelic SNVs of leptin (LEP) [28], leptin receptor (LEPR) [29], and pro-opiomelanocortin (POMC) [30] are also associated with hyperphagic obesity. LEP and LEPR can be distinguished from MYT1L due to the association of hypogonadotrophic hypogonadism with LEP and LEPR SNVs. Patients with POMC deficiency present with a range of endocrine problems not reported in association with MYT1L variants. There is also phenotypic overlap between certain microdeletion syndromes and MYT1L. Smith-Magenis syndrome (17p11.2 deletion) is associated with developmental delay and variable obesity [31]. Facial dysmorphology, sleep disturbance and self-injurious behavior reported in Smith-Magenis syndrome were not identified in our MYT1L cohort. 22q11.2 deletion carriers have increased rates of obesity [32], and the presence of cleft lip/palate, congenital heart disease or parathyroid disease can permit distinction from MYT1L variant carriers.
Our data supports the hypothesis that MYT1L SNVs cause loss of protein function and haploinsufficiency. Data from the ExAC indicated a loss of function intolerance score of one, which indicates that MYT1L is a haploinsufficient gene that will not tolerate heterozygous loss of function variants. Four of the SNVs we report were predicted to be PTV, which would result in loss of protein function. In silico modelling indicates that the 5 missense variants we report would be predicted to interfere with the binding of MYT1L to DNA. Both p.His560Tyr and p.Arg569Gln affect conserved amino acids that directly bind to DNA. These variants are likely to disrupt DNA binding. The p.Leu520Pro variant lies at a protein loop which is crucial for the correct folding of the second zinc finger domain; this missense variant is likely to disrupt protein structure and hence DNA binding. His524 and Gly527 are zinc ligands, and any change will disrupt protein structure. The fact that the phenotypes of 2p25.3 deletions and MYT1L SNVs overlap supports haploinsufficient loss of function of MYT1L as the disease mechanism. By GEP in an MYT1L HEK cell line with homozygous MYT1L frameshift variants, we demonstrate altered expression of multiple genes implicated in regulation of gene expression and transcription. Haploinsufficiency for MYT1L has clear potential to disrupt expression of critical genes during brain development and hence cause a neurodevelopmental disorder.
The expression pattern of MYT1L in the human brain reflects the clinical features of individuals with 2p25.3 deletions and MYT1L SNVs. The widespread expression of MYT1L in brain structures relevant to cognition supports a role for loss of function in the etiology of ID. This is in keeping with the fact that the overwhelming majority of ID and autism genes have widespread expression in the cerebral cortex [33]. The expression pattern of MYT1L in human brain also supports a role for the gene in appetite/obesity. MYT1L was expressed in multiple hypothalamic nuclei at 15–16 pcw, with significant reduction in expression at 21 pcw. This leads us to hypothesise that MYT1L may play a role in the development of the hypothalamus, and that MYT1L loss of function may be associated with obesity by impairing development of hypothalamic nuclei. Similar mechanisms operate for other obesity genes such as SIM1 [8, 9].
To investigate a role for myt1la/b in development of the neuroendocrine hypothalamus we generated a knockdown model in zebrafish. Injection of MO against myt1la or myt1lb, alone or in combination, resulted in a severe loss of expression of OXT in the neuroendocrine preoptic area. Knockdown of myt1la/b resulted in loss of AVP expression in the neuroendocrine preoptic area but not the ventral hypothalamus. This suggests that myt1la/b may influence the development of the neuroendocrine preoptic area, but not other regions of the hypothalamus. The neuroendocrine preoptic area is the functional equivalent of the paraventricular nucleus in humans [34]; lesions of which cause hyperphagic obesity [7, 8]. Thus, MYT1L CNVs and SNVs may lead to hyperphagic obesity by impairing hypothalamic development.
SIM1, functioning with its dimerization partner ARNT2, regulates the development of the paraventricular nucleus [7, 8]. SIM1 deletion heterozygous mice have hypocellularity of the paraventricular nucleus and hyperphagic obesity [7, 8]. To examine an interaction of SIM1 with MYT1L we performed WISH for myt1la in the homozygous arnt2hi2639Tgnull zebrafish, which has no functional arnt2 and hence disruption of sim1a/b function. The absence of myt1la expression in the neuroendocrine preoptic area demonstrates that MYT1L lies downstream of SIM1-ARNT2 in hypothalamic development. Our experiments also indicate that OXT is downstream of MYT1L. This suggests that loss of OXT may be a final common pathway in genetic forms of obesity, and represent a treatment target in multiple disorders.
In summary, we have identified a series of individuals with MYT1L de novo SNVs who present with a syndrome of ID and obesity. Genes involved in nucleosome remodeling, especially those of the neuron-specific Brg1/hBrm Associated Factor (nBAF) complex, have emerged as being central to the pathogenesis of ID [35]. However, MYT1L is not known to play a role in nucleosome remodeling, and GEP did not demonstrate that genetic pathways involved in nucleosome remodeling are dysregulated in MYT1L knockdown cells. This suggests that the ID observed in patients with MYT1L SNVs and CNVs is not related to altered nucleosome remodeling. The mechanism by which MYT1L loss of function results in ID is unclear. Murine studies of MYT1 demonstrate that it promotes neuronal differentiation of neuronal progenitor cells by inhibiting Notch signaling [18]. It seems reasonable to suggest that MYT1L may perform a similar function in the developing brain and that loss of MYT1L function will disrupt this process. The obesity phenotype with MYT1L loss of function is associated with disrupted development of the neuroendocrine hypothalamus in zebrafish, manifested by loss of OXT. This is similar to the effects of SIM1 [8, 9] and POU3F2 loss of function [24], both of which are associated with hyperphagic obesity. OXT is emerging as a key neurochemical in both autism and obesity pathogenesis. Polymorphisms in OXT and its receptor are associated with autism risk, and intranasal OXT improves autism symptoms and imaging abnormalities [36, 37]. OXT treatment reduces food intake in humans and in sim1 mutant mice [38, 39]. In conclusion, we identify MYT1Lmutations as a cause of syndromic obesity, and establish MYT1L as a member of the leptin-melanocortin-SIM1 pathway, with downstream loss of OXT associated with MYT1L mutations a potential therapeutic target.
Methods
Exome sequencing
For probands and their parents in the DDD study, saliva samples were collected (Oragene DNA collection kits, DNA Genotek, Kanata, ON, Canada) and DNA extracted (QIAsymphony, Qiagen, Venlo, Netherlands). Exome sequencing was performed at the Wellcome Trust Sanger Institute with Agilent SureSelect 55MB Exome Plus with Illumina HiSeq to investigate single nucleotide variants (SNVs) and small insertion-deletions (indels) in coding regions of the genome. An automated variant pipleline was used as previously described [4]. Probands were identified with protein altering SNVs in MYT1L.
Genome sequencing
Blood samples were sent for sequencing at the HudsonAlpha Genomic Services Laboratory (http://gsl.hudsonalpha.org). Genomic DNA was isolated from peripheral blood and WGS was conducted to a mean depth of 35X, with >80% of bases covered at 20X. WGS was done on Illumina HiSeq Xs. Reads were aligned and variants called according to standard protocols [40, 41]. A robust relationship inference algorithm (KING) was used to confirm familial relationships [42]. Using filters related to call quality, allele frequency, and impact predictions, we searched for rare, damaging de novo variation, or inherited X-linked, recessive, or compound heterozygous variation in affected probands. WGS were carried out under a research protocol and were not completed within a CAP/CLIA laboratory. All variants found to be medically relevant and returnable were validated by Sanger sequencing in an independent CLIA laboratory (Emory Genetics Laboratory) before being returned to participants, although these validated variant results are not CLIA-compliant as the input DNA was originally isolated in a research laboratory. Ethics approval and consent to participate: Review boards at Western (20130675) and the University of Alabama at Birmingham (X130201001) approved and monitored this study. Consent for publication: A parent or legal guardian was required to give consent to participate in the study and inclusion of their data for publication, and assent was obtained from those children who were capable.
Ethics statement
The study has UK Research Ethics Committee approval (10/H0305/83, granted by the Cambridge South REC, and GEN/284/12 granted by the Republic of Ireland REC). Written consent taken from all participants and declaration of Helsinki followed.
In silico assessment of MYT1L variant pathogenicity
The predicted effect of the MYT1L missense variants was examined using SIFT and PolyPhen. Evolutionary conservation of mutated amino acids was assessed by aligning orthologs in Ensembl (http://www.ensembl.org/index.html). The presence of MYT1L variants in control populations and MYT1L constraint metrics were queried using the ExAC browser (http://exac.broadinstitute.org/gene/ENSG00000186487). SNVs are reported using MYT1L Isoform-1 (canonical sequence, 1 186 amino acids) and ensemble transcript ENST00000428368(http://www.ensembl.org/Homo_sapiens/Transcript/Summary?g=ENSG00000186487;r=2:1791242-2331116;t=ENST00000428368).
To investigate the structural effects of the MYT1L missense variants, we generated a 3-dimensional model of the 2nd and 3rd zinc finger domains of MYT1L bound to DNA. This was based upon the structure of MYT1 4th and 5th zinc finger domains. The amino acid sequence of MYT1 was first extracted from the report of Gamsjaeger et al [43]. The 4th and 5th zinc finger domains of MYT1 and 2nd and 3rd zinc finger domains of MYT1L aligned well, indicating that the structure of MYT1 is suitable to model the effects of MYT1L missense variants. A 3-dimensional model of the 4th and 5th zinc finger domains of MYT1 bound to DNA was then generated using Pymol (https://www.pymol.org/). The MYT1L missense variants were placed at the appropriate residues of this to visualize the structural and hence potential functional, consequences.
Generation of frameshift mutations in MYT1L using CRISPR in HEK cell line
Human embryonic kidney (HEK) cell line HEK-293 (HD PAR-617, ATCC CRL-1573) was confirmed to be triploid at the MYT1L locus using SNP 6.0 arrays. MYT1L transcript ENST00000399161 was targeted. A guide RNA (gRNA1240) was designed to bind at exon 9 of MYT1L, with an adjacent protospacer adjacent motif (PAM) site. HEK-293 cultures were transfected with gRNA1240. Colonies were then genotyped by PCR to identify those with homozygous out of frame variants at the gRNA1240 site. PCR sequencing of genomic DNA demonstrated a 1 base pair insertion of a thymidine base within the gRNA1240 site at allele 1 and 2. PCR sequencing demonstrated a 10 base pair deletion in allele 3. Long range PCR did not reveal any larger deletions across the gRNA site. These sequence variants are predicted to cause a downstream STOP codon at amino acid 115 and 170, respectively.
Gene expression profiling (GEP)
RNA was extracted using trizol and a standard column based system from the isogenic parental HEK-293 line and the knockout line, each in biological triplicate. Whole genome gene expression profiling was performed using the Clariom S array (affymetrix). Differentially expressed genes were defined as those showing a 2 fold or greater change in expression with a false discovery rate of 2% using the Affymetrix Transcriptome analysis console. Enrichment analysis was performed using Enrichr (http://amp.pharm.mssm.edu/Enrichr/) with a crisp gene set (i.e. no fold change expression assigned to each gene) [24].
In silico assessment of MYT1L expression pattern in human brain
The expression pattern of MYT1L in adult brain was examined using the Allen brain atlas (microarray data using Agilent 8x60K cDNA chip) [23]. Expression data (Z score normalized) were downloaded for 6 adult brains (donor id 9861, 10021, 12876, 14380, 15496 and 15697) for the frontal cortex, hippocampus, basal ganglia and hypothalamus (at least 3 regions from each anatomical site). Expression levels were compared between each anatomical site using Mann-Whitney U-tests. The expression pattern of MYT1L in developing human brain was examined using the brainspan atlas. Microarray data (Z score normalized) was downloaded from 2 donor brains at 15–16 post conception weeks (pcw) (donor id 12840 and 14751) and 2 donor brains at 21 pcw (donor id 12566 and 12690) for the paraventricular nucleus, anterior hypothalamic nucleus, lateral hypothalamic area, dorsomedial hypothalamic area, venteromedial hypothalamic area, posterior hypothalamic nucleus and medial mammillary nucleus. Mann-Whitney U-tests were used to compare median MYT1L expression in each hypothalamic nucleus at 15–16 pcw and 21 pcw.
Generation of zebrafish myt1la/b knockdown
Zebrafish (Danio rerio) were raised, maintained and crossed as described [43]]. Development of embryos was at 28°C, and staging was determined by both hours post fertilization (hpf) and morphological characteristics [44]. Embryos were genotyped for the arnt2hi2639cTg allele as previously described [25]. All procedures were in accordance with NIH guidelines on the care and use of animals and were approved by the Georgetown University Institutional Animal Care and Use Committee, Protocol 11–008.
Templates, probes and Whole-Mount In Situ Hybridization (WISH)
Whole-Mount In Situ Hybridization (WISH) using DIG-labeled riboprobes was performed as previously described [44]. Zebrafish myt1la and myt1lb templates were generated by PCR amplification from 2 dpf zebrafish cDNA and then cloned into pJET1.2 vectors in “backwards” direction. The myt1a exon 5 primers were 1aF:CACCACGACAATTATTCTAGTG, and 1aR:CTTTAGGGTAGTAAGCTC. The myt1b exon four primers were 1bF: AGAGTGACCATATGAATTGCA, and 1bR: CTGCTGCTGGTTATTGTTGAG. The plasmids were linireized with XbaI and probe was synthesized using T7 RNA polymerase and reagents from the DIG labeling kit (Roche).
Morpholino oligonucleotide (MO) injections
MO injections for sim1 were used as previously published [45]. For the myt1la and myt1lb genes, two MOs for each gene were used to knockdown these proteins. One MO was designed to block translation and the other was designed to block splicing. The following MOs were synthesized by Gene-Tools, LCC: myt1la ATG MO, 5’-ACCTCCATCTGAATGCAGTGGTTGA; myt1la Splice MO, 5’-GGACAGCTGGAGACAAGAGAAATAA; myt1lb ATG MO, 5’-CATCTGCTACATCCACCTCCATCTG; myt1lb Splice MO, 5’-ATATTTGTGCCCTCACCTATTTCAT; and tp53 MO, 5’- GCGCCATTGCTTTGCAAGAATTG. The Standard Control MO from Gene Tools was used as control. Solutions consisting of 4 ng/nl MO plus 0.5% tetramethyl rhodamine dextran in dH20 were microinjected into one to four cell stage embryos.
Images were acquired using a Zeiss Axioplan2 microscope fitted with an AxioCam camera using AxioVision software, or, with a Zeiss stereoscope fitted with a Canon Oneshot digital camera. Digitized images were imported into PhotoShop CS (Adobe Systems Inc, San Jose, CA), contrast and brightness adjusted as necessary. WISH for myt1la/b expression was quantified using an ordinal scale: 0 = no staining, 1 = dramatically reduced staining, 2 = normal staining. WISH for oxytocin was quantified as follows: ~30 cells = wild type expression, 5–15 cells = reduced, 1–4 = highly reduced, 0 = no expression.
Statistical analysis
Statistical differences in green fluorescent protein (GFP) expression in 2 somite embryos was determined using ANOVA, followed by Tukey post-hoc tests for individual groups. Significance of MO induced phenotype categories was evaluated by Ordinal Logistic Regression. The statistical analyses utilized SPSS (version 22) from IBM.
Internet resources
Decipher (https://decipher.sanger.ac.uk/)
Exome aggregation consortium (http://exac.broadinstitute.org/)
Allen Brain Atlas (http://www.brain-map.org/)
SIFT (http://sift.jcvi.org/)
Provean (http://provean.jcvi.org/index.php)
Ensembl (http://www.ensembl.org/index.html)
Enrichr (http://amp.pharm.mssm.edu/Enrichr/)
Pymol (https://www.pymol.org/)
GTEx portal (https://www.gtexportal.org/home/)
Acknowledgments
We thank the families who kindly agreed to be part of this study. This study makes use of data generated by the DECIPHER Consortium. A full list of centres who contributed to the generation of the data is available from http://decipher.sanger.ac.uk and via email from decipher@sanger.ac.uk. The research team acknowledges the support of the National Institute for Health Research, through the Comprehensive Clinical Research Network. We are grateful to the patients and their families who contributed to this study. We would like to thank members of the HudsonAlpha CSER team, especially Shirley Simmons, Kelly East, Whitley Kelley, Kevin Bowling, Susan Hiatt, Candice Finnila, David Gray, James Lawlor, and Michelle Amaral, for help with sequencing data analysis. The research team acknowledges the support of the National Institute for Health Research, through the Comprehensive Clinical Research Network.
Members of the Deciphering Developmental Disorders Consortium:
McRae JF, Clayton S, Fitzgerald TW, Kaplanis J, Prigmore E, Rajan D, Sifrim A, Aitken S, Akawi N, Alvi M, Ambridge K, Barrett DM, Bayzetinova T, Jones P, Jones WD, King D, Krishnappa N, Mason LE, Singh T, Tivey AR, Ahmed M, Anjum U, Archer H, Armstrong R, Awada J, Balasubramanian M, Banka S, Baralle D, Barnicoat A, Batstone P, Baty D, Bennett C, Berg J, Bernhard B, Bevan AP, Bitner-Glindzicz M, Blair E, Blyth M, Bohanna D, Bourdon L, Bourn D, Bradley L, Brady A, Brent S, Brewer C, Brunstrom K, Bunyan DJ, Burn J, Canham N, Castle B, Chandler K, Chatzimichali E, Cilliers D, Clarke A, Clasper S, Clayton-Smith J, Clowes V, Coates A, Cole T, Colgiu I, Collins A, Collinson MN, Connell F, Cooper N, Cox H, Cresswell L, Cross G, Crow Y, D'Alessandro M, Dabir T, Davidson R, Davies S, de Vries D, Dean J, Deshpande C, Devlin G, Dixit A, Dobbie A, Donaldson A, Donnai D, Donnelly D, Donnelly C, Douglas A, Douzgou S, Duncan A, Eason J, Ellard S, Ellis I, Elmslie F, Evans K, Everest S, Fendick T, Fisher R, Flinter F, Foulds N, Fry A, Fryer A, Gardiner C, Gaunt L, Ghali N, Gibbons R, Gill H, Goodship J, Goudie D, Gray E, Green A, Greene P, Greenhalgh L, Gribble S, Harrison R, Harrison L, Harrison V, Hawkins R, He L, Hellens S, Henderson A, Hewitt S, Hildyard L, Hobson E, Holden S, Holder M, Holder S, Hollingsworth G, Homfray T, Humphreys M, Hurst J, Hutton B, Ingram S, Irving M, Islam L, Jackson A, Jarvis J, Jenkins L, Johnson D, Jones E, Josifova D, Joss S, Kaemba B, Kazembe S, Kelsell R, Kerr B, Kingston H, Kini U, Kinning E, Kirby G, Kirk C, Kivuva E, Kraus A, Kumar D, Kumar VK, Lachlan K, Lam W, Lampe A, Langman C, Lees M, Lim D, Longman C, Lowther G, Lynch SA, Magee A, Maher E, Male A, Mansour S, Marks K, Martin K, Maye U, McCann E, McConnell V, McEntagart M, McGowan R, McKay K, McKee S, McMullan DJ, McNerlan S, McWilliam C, Mehta S, Metcalfe K, Middleton A, Miedzybrodzka Z, Miles E, Mohammed S, Montgomery T, Moore D, Morgan S, Morton J, Mugalaasi H, Murday V, Murphy H, Naik S, Nemeth A, Nevitt L, Newbury-Ecob R, Norman A, O'Shea R, Ogilvie C, Ong KR, Park SM, Parker MJ, Patel C, Paterson J, Payne S, Perrett D, Phipps J, Pilz DT, Pollard M, Pottinger C, Poulton J, Pratt N, Prescott K, Price S, Pridham A, Procter A, Purnell H, Quarrell O, Ragge N, Rahbari R, Randall J, Rankin J, Raymond L, Rice D, Robert L, Roberts E, Roberts J, Roberts P, Roberts G, Ross A, Rosser E, Saggar A, Samant S, Sampson J, Sandford R, Sarkar A, Schweiger S, Scott R, Scurr I, Selby A, Seller A, Sequeira C, Shannon N, Sharif S, Shaw-Smith C, Shearing E, Shears D, Sheridan E, Simonic I, Singzon R, Skitt Z, Smith A, Smith K, Smithson S, Sneddon L, Splitt M, Squires M, Stewart F, Stewart H, Straub V, Suri M, Sutton V, Swaminathan GJ, Sweeney E, Tatton-Brown K, Taylor C, Taylor R, Tein M, Temple IK, Thomson J, Tischkowitz M, Tomkins S, Torokwa A, Treacy B, Turner C, Turnpenny P, Tysoe C, Vandersteen A, Varghese V, Vasudevan P, Vijayarangakannan P, Vogt J, Wakeling E, Wallwark S, Waters J, Weber A, Wellesley D, Whiteford M, Widaa S, Wilcox S, Wilkinson E, Williams D, Williams N, Wilson L, Woods G, Wragg C, Wright M, Yates L, Yau M, Nellåker C, Parker M, Firth HV, Wright CF, FitzPatrick DR, Barrett JC, Hurles ME.
Members of the Clinical Sequencing Exploratory Research Study Consortium:
Michelle Amaral, Laura Amendola, Paul S. Appelbaum, Samuel J. Aronson, Shubhangi Arora, Danielle R. Azzariti, Greg S. Barsh, E.M. Bebin, Barbara B. Biesecker, Leslie G. Biesecker, Sawona Biswas, Carrie L. Blout, Kevin M. Bowling, Kyle B. Brothers, Brian L. Brown, Amber A. Burt, Peter H. Byers, Charlisse F. Caga-anan, Muge G. Calikoglu, Sara J. Carlson, Nizar Chahin, Arul M. Chinnaiyan, Kurt D. Christensen, Wendy Chung, Allison L. Cirino, Ellen Clayton, Laura K. Conlin, Greg M. Cooper, David R. Crosslin, James V. Davis, Kelly Davis, Matthew A. Deardorff, Batsal Devkota, Raymond De Vries, Pamela Diamond, Michael O. Dorschner, Noreen P. Dugan, Dmitry Dukhovny, Matthew C. Dulik, Kelly M. East, Edgar A. Rivera-Munoz, Barbara Evans, Barbara, James P. Evans, Jessica Everett, Nicole Exe, Zheng Fan, Lindsay Z. Feuerman, Kelly Filipski, Candice R. Finnila, Kristen Fishler, Stephanie M. Fullerton, Bob Ghrundmeier, Karen Giles, Marian J. Gilmore, Zahra S. Girnary, Katrina Goddard, Steven Gonsalves, Adam S. Gordon, Michele C. Gornick, William M. Grady, David E. Gray, Stacy W. Gray, Robert Green, Robert S. Greenwood, Amanda M. Gutierrez, Paul Han, Ragan Hart, Patrick Heagerty, Gail E. Henderson, Naomi Hensman, Susan M. Hiatt, Patricia Himes, Lucia A. Hindorff, Fuki M. Hisama, Carolyn Y. Ho, Lily B. Hoffman-Andrews, Ingrid A. Holm, Celine Hong, Martha J. Horike-Pyne, Sara Hull, Carolyn M. Hutter, Seema Jamal, Gail P. Jarvik, Brian C. Jensen, Steve Joffe, Jennifer Johnston, Dean Karavite, Tia L. Kauffman, Dave Kaufman, Whitley Kelley, Jerry H. Kim, Christine Kirby, William Klein, Bartha Knoppers, Barbara A. Koenig, Sek Won Kong, Ian Krantz, Joel B. Krier, Neil E. Lamb, Michele P. Lambert, Lan Q. Le, Matthew S. Lebo, Alexander Lee, Kaitlyn B. Lee, Niall Lennon, Michael C. Leo, Kathleen A. Leppig, Katie Lewis, Michelle Lewis, Neal I. Lindeman, Nicole Lockhart, Bob Lonigro, Edward J. Lose, Philip J. Lupo, Laura Lyman Rodriguez, Frances Lynch, Kalotina Machini, Calum MacRae, Teri A. Manolio, Daniel S. Marchuk, Josue N. Martinez, Aaron Masino, Laurence McCullough, Jean McEwen, Amy McGuire, Heather M. McLaughlin, Carmit McMullen, Piotr A. Mieczkowski, Jeff Miller, Victoria A. Miller, Rajen Mody, Sean D. Mooney, Elizabeth G. Moore, Elissa Morris, Michael Murray, Donna Muzny, Richard M. Myers, David Ng, Deborah A. Nickerson, Nelly M. Oliver, Jeffrey Ou, Will Parsons, Donald L. Patrick, Jeffrey Pennington, Denise L. Perry, Gloria Petersen, Sharon Plon, Katie Porter, Bradford C. Powell, Sumit Punj, Carmen Radecki Breitkopf, Robin A. Raesz-Martinez, Wendy H. Raskind, Heidi L. Rehm, Dean A. Reigar, Jacob A. Reiss, Carla A. Rich, Carolyn Sue Richards, Christine Rini, Scott Roberts, Peggy D. Robertson, Dan Robinson, Jill O. Robinson, Marguerite E. Robinson, Myra I. Roche, Edward J. Romasko, Elisabeth A. Rosenthal, Joseph Salama, Maria I. Scarano, Jennifer Schneider, Sarah Scollon, Christine E. Seidman, Bryce A. Seifert, Richard R. Sharp, Brian H. Shirts, Lynette M. Sholl, Javed Siddiqui, Elian Silverman, Shirley Simmons, Janae V. Simons, Debra Skinner, Nancy B. Spinner, Elena Stoffel, Natasha T. Strande, Shamil Sunyaev, Virginia P. Sybert, Jennifer Taber, Holly K. Tabor, Peter Tarczy-Hornoch, Deanne M. Taylor, Christine R. Tilley, Ashley Tomlinson, Susan Trinidad, Ellen Tsai, Peter Ubel, Eliezer M. Van Allen, Jason L. Vassy, PankajVats, David L. Veenstra, Victoria L. Vetter, Raymond D. Vries, Nikhil Wagle, Sarah A. Walser, Rebecca C. Walsh, Karen Weck, Allison Werner-Lin, Jana Whittle, Ben Wilfond, Kirk C. Wilhelmsen, Susan M. Wolf, Julia Wynn, Yaping Yang, Carol Young, Joon-Ho Yu, and Brian J. Zikmund-Fisher.
References
- 1. Emerson E, Hatton C, Baines S, Robertson J. The physical health of British Adults with intellectual disability: cross sectional study. Int J Equity Heatlh. 2016; 15: 11.
- 2. Van der Klaauw AA, Farooqi IS. The hunger genes: pathways to obesity. Cell. 2015;161(1): 119–132. pmid:25815990
- 3. Rosenfeld JA, Patel A. Chromosomal microarrays: understanding genetics of neurodevelopmental disorders and congenital anomalies. J Pediatr Genet. 2017; 6 (1): 42–50. pmid:28180026
- 4. Wright CF, Fitzgerald TW, Jones WD, Clayton S, McRae JF, Kogelenberg MV, et al. Genetic diagnosis of developmental disorders in the DDD study: a scalable analysis of genome-wide research data. Lancet. 2015; 385 (9975): 1305–1314. pmid:25529582
- 5. Kaur Y, de Souza RJ, Gibson WT, Meyre D. A systematic review of genetic syndromes with obesity. Obes Rev. 2017; pmid:28346723
- 6. Ramachandrappa S, Raimondo A, Cali AM, Keogh JM, Henning E, Saeed S, et al. Rare variants in single-minded 1 (SIM1) are associated with severe obesity. J Clin Invest. 2013; 123 (7): 3042–3050. pmid:23778139
- 7. Wentzel C, Lynch SA, Stattin EL, Sharkey FH, Anneren G, Thuresson AC. Interstitial deletions at 6q14.1-q15 associated with obesity, developmental delay and a distinct clinical phenotype. Mol Syndromol. 2010; 1 (2): 75–81. pmid:21045960
- 8. Tolson KP, Gemelli T, Gautron L, Elmquist JK, Zinn AR, Kublaoui BM. Postnatal SIM1 deficiency causes hyperphagic obesity and reduced Mc4r and oxytocin expression. J Neurosci 2010; 30(10): 3803–3812. pmid:20220015
- 9. Michaud JL, Bouchre F, Melnyk A, Gauthier F, Goshu E, Levy E, et al. Sim1 haploinsufficiency causes hyperphagia, obesity and reduction of the paraventricular nucleus of the hypothalamus. Hum Mol Genet 2001; 10 (14): 1465–1473. pmid:11448938
- 10. De Rocker N, Vergult S, Koolen D, Jacobs E, Hoischen A, Zeesman S, et al. Refinement of the critical 2p25.3 deletion region: the role of MYT1L in intellectual disability and obesity. Genet Med. 2015; 17 (6): 460–466. pmid:25232846
- 11. Bonaglia MC, Giorda R, Zanina S. A new patient with a terminal de novo deletion of 1.9 Mb associated with early onset obesity, intellectual disabilities and hyperkinetic disorder. Mol Cytogenet. 2014;7:53. pmid:25126114
- 12. Doco-Fenzy M, Leroy C, Schneider A, Petit F, Delrue MA, Andrieux J, et al. Early-onset obesity and paternal 2pter deletion encompassing the ACP1, TMEM18 and MYT1L genes. Eur J Hum Genet 2014; 22 (4): 471–479. pmid:24129437
- 13. Rio M, Royer G, Gobin S, de Blois MC, Oziliou C, Bernheim A, et al. Monozygotic twins discordant for submicroscopic chromosomal anomalies in 2p25.3 region detected by array CGH. Clin Genet 2013; 84 (1): 31–36. pmid:23061379
- 14. Stevens SJC, van Ravenswaaij-Arts CMA, Jannsen JWH, Wassink-Ruiter JSK, van Essen AJ, Dijkhuizen T, et al. MYT1L is a candidate gene for intellectual disability in patients with 2p25.3 (2pter) deletions. Am J Med Genet. 2011; 155A(11): 2739–2745. pmid:21990140
- 15. Khan K, Rudkin A, Parry DA, Burdon KP, McKibbin M, Logan CV, et al. Homozygous mutations in PXDN cause congenital cataract, corneal opacity and developmental glaucoma Am J Human Genet 2011; 89 (3): 464–473.
- 16. Romm E, Nielsen JA, Kim JG, Hudson LD. Myt1 family recruits histone deacetylase to regulate neural transcription. J Neurochem. 2005; 93 (6): 1444–1453. pmid:15935060
- 17. Vierbuchen T, Ostermeier A, Pang ZP, Kokubu Y, Sudhof TC, Wernig M. Direct conversion of fibroblasts to functional neurons by defined factors. Nature. 2010; 463 (7284): 1035–1041. pmid:20107439
- 18. Vasconcelos FF, Sessa A, Laranjeira C, Raposo AASF, Teixeira V, Hagey DW, et al. MyT1 counteracts the neural progenitor program to promote vertebrate neurogenesis. Cell Rep. 2016; 17 (2): 469–483. pmid:27705795
- 19. Hempel A, Pagnamenta AT, Blyth M, Mansour S, McConnell V, Kou I, et al. Deletions and de novo mutations of SOX11 are associated with a neurodevelopmental disorder with features of Coffin-Siris syndrome. J Med Genet. 2016; 53 (3): 152–162. pmid:26543203
- 20. Sobreira N, Schiettecatte F, Valle D, Hamosh A. GeneMatcher: a matching tool for connecting investigators with an interest in the same gene. Hum Mut. 2015; 36 (10): 928–930. pmid:26220891
- 21. Lek M, Karczewski KJ, Minikel EV, Samocha KE, Banks E, Fennell T, et al. Analysis of protein-coding genetic variation in 60,706 humans. Nature. 2016; 536 (7616): 285–291. pmid:27535533
- 22. GTEx consortium. The Genotype-Tissue Expression (GTEx) project. Nat Genet. 2013; 45(6): 580–585. pmid:23715323
- 23. Hawrylycz MJ, Lein ES, Guillozet-Bongaarts AL, Shen EH, Ng L, Miller JA, et al. An anatomically comprehensive atlas of the adult human brain transcriptome. Nature. 2012; 489 (7416): 391–399. pmid:22996553
- 24. Kuleshov MV, Jones MR, Rouillard AD, Fernandez NF, Duan Q, Wang Z, et al. Enrichr: a comprehensive gene set enrichment analysis web server 2016 update. Nucleic Acid Res. 2016; 44 (w1): W90–97. pmid:27141961
- 25. Kasher PR, Schertz KE, Thomas M, Jackson A, Annunziata S, Ballesta-Martinez MJ, et al. Small 6q16.1 deletions encompassing POU3F2 cause susceptibility to obesity and variable developmental delay with intellectual disability. Am J Hum Genet. 2016; 98(2): 363–372. pmid:26833329
- 26. Wang T, Guo H, Xiong B, Stessman HA, Wu H, Coe BP, et al. De novo genic mutations among a Chinese autism spectrum disorder cohort. Nat Commun 2016; 7: 13316. pmid:27824329
- 27. Khan MJ, Gerasimidis K, Edwards CA, Shaikh MG. Mechanisms of obesity in Prader-Willi syndrome. Pediatr Obes. 2016 Nov 10. pmid:27863129
- 28. Montague CT, Farooqi IS, Whitehead JP, Soos MA, Rau H, Wareham NJ, et al. Congenital leptin deficiency is associated with severe early-onset obesity in humans. Nature. 1997; 387(6636): 903–908. pmid:9202122
- 29. Krude H, Biebermann H, Luck W, Horn R, Brabant G, Grüters A. Severe early-onset obesity, adrenal insufficiency and red hair pigmentation caused by POMC mutations in humans. Nat Genet. 1998; 19(2): 155–157. pmid:9620771
- 30. Farooqi IS, Wangensteen T, Collins S, Kimber W, Matarese G, Keogh JM, et al. Clinical and molecular genetic spectrum of congenital deficiency of the leptin receptor. N Engl J Med 2007; 356(3): 237–247. pmid:17229951
- 31. Elsea SH, Williams SR. Smith-Magenis syndrome: haploinsufficiency of RAI1 results in altered gene regulation in neurological and metabolic pathways. Exper Rev Mol Med. 2011; 13: e14.
- 32. Voll SL, Boot E, Butcher NJ, Cooper S, Heung T, Chow EW, et al. Obesity in adults with 22q11.2 deletion syndrome. Genet Med. 2017; 19(2): 204–208. pmid:27537705
- 33. Shohat S, Ben-David E, Shifman S. Varying intolerance of gene pathways to mutational classes explain genetic convergence across neuropsychiatric disorders. Cell Rep. 2017; 18(9): 2217–2227. pmid:28249166
- 34. Herget U, Ryu S. Coexpression analysis of nine neuropeptides in the neurosecretory preoptic area of larval zebrafish. Front Neuroanat. 2015; 9: 2. pmid:25729355
- 35. Ronan JL, Wu W, Crabtree GR. From neural development to cognition: unexpected roles for chromatin. Nat Rev Genet. 2013; 14(5):347–359. pmid:23568486
- 36. Zhang R, Zhang HF, Han JS, Han SP. Genes related to oxytocin and arginine-vasopressin pathways: associations with autism spectrum disorders. Neurosci Bull. 2017; 33(2): 238–246. pmid:28283809
- 37. Watanabe T, Abe O, Kuwabara H, Yahata N, Takano Y, Iwashiro N, et al. Mitigation of sociocommunicational deficits of autism through oxytocin-induced recovery of medial prefrontal activity: a randomized trial. JAMA Psychiatry. 2014;71(2): 166–175. pmid:24352377
- 38. Maejima Y, Iwasaki Y, Yamahara Y, Kodaira M, Sedbazar U, Yada T. Peripheral oxytocin treatment ameliorates obesity by reducing food intake and visceral fat mass. Aging. 2011; 3(12): 1169–1177. pmid:22184277
- 39. Kublaoui BM, Gemelli T, Tolson KP, Wang Y, Zinn AR. Oxytocin deficiency mediates hyperphagic obesity of Sim1 haploinsufficient mice. Mol Endocrinol. 2008; 22(7): 1723–1734. pmid:18451093
- 40. Li H, Durbin R. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics. 2009;25(14):1754–60. pmid:19451168
- 41. DePristo MA, Banks E, Poplin R, Garimella KV, Maguire JR, Hartl C, et al. A framework for variation discovery and genotyping using next-generation DNA sequencing data. Nat Genet. 2011;43(5):491–8. pmid:21478889
- 42. Manichaikul A, Mychaleckyj JC, Rich SS, Daly K, Sale M, Chen WM. Robust relationship inference in genome-wide association studies. Bioinformatics. 2010;26(22):2867–73 pmid:20926424
- 43. Gamsjaeger R, O’Connell MR, Cubeddu L, Shepher NE, Lowry JA, Kwan AH, et al. A structural analysis of DNA binding by myelin transcription factor 1 double zinc fingers. J Biol Chem. 2013; 288(49): 35180–35191. pmid:24097990
- 44. Kimmel CB, Ballard WW, Kimmel SR, Ullmann B, Schilling TF. Stages of embryonic development of the zebrafish. Dev. Dyn. 1995;203(3):253–310. pmid:8589427
- 45.
Westerfield M. University of Oregon Press; Eugene, Oregon: 1995. The Zebrafish Book.