Figures
Abstract
Wnt/β-catenin signaling is an ancient pathway in metazoans and controls various developmental processes, in particular the establishment and patterning of the embryonic primary axis. In vertebrates, a graded Wnt activity from posterior to anterior endows cells with positional information in the central nervous system. Recent studies in hemichordates support a conserved role for Wnt/β-catenin in ectoderm antero-posterior patterning at the base of the deuterostomes. Ascidians are marine invertebrates and the closest relatives of vertebrates. By combining gain- and loss-of-function approaches, we have determined the role of Wnt/β-catenin in patterning the three ectoderm derivatives of the ascidian Ciona intestinalis, central nervous system, peripheral nervous system and epidermis. Activating Wnt/β-catenin signaling from gastrulation led to a dramatic transformation of the ectoderm with a loss of anterior identities and a reciprocal anterior extension of posterior identities, consistent with studies in other metazoans. Surprisingly, inhibiting Wnt signaling did not produce a reciprocal anteriorization of the embryo with a loss of more posterior identities like in vertebrates and hemichordate. Epidermis patterning was overall unchanged. Only the identity of two discrete regions of the central nervous system, the anteriormost and the posteriormost regions, were under the control of Wnt. Finally, the caudal peripheral nervous system, while being initially Wnt dependent, formed normally. Our results show that the Ciona embryonic ectoderm responds to Wnt activation in a manner that is compatible with the proposed function for this pathway at the base of the deuterostomes. However, possibly because of its fast and divergent mode of development that includes extensive use of maternal determinants, the overall antero-posterior patterning of the Ciona ectoderm is Wnt independent, and Wnt/β-catenin signaling controls the formation of some sub-domains. Our results thus indicate that there has likely been a drift in the developmental systems controlling ectoderm patterning in the lineage leading to ascidians.
Author summary
The Wnt/β-catenin pathway is a system of cell-cell communication. It has an ancient origin in animals and plays multiple roles during embryogenesis and adult life. In particular, it is involved in determining, in the vertebrate embryo, the identity of the different parts of the body and their relative positions along the antero-posterior axis. We have investigated in an ascidian (or sea squirt) species, a marine invertebrate that is closely related to vertebrates, whether this pathway had a similar role. Like in vertebrates, activating Wnt/β-catenin led to a posteriorization of the embryo with a loss of anterior structures. By contrast, unlike vertebrates, ascidian embryos formed rather normally following Wnt/β-catenin inactivation. Since hemichordates (or acorn worms), earlier divergent invertebrates, use Wnt/β-catenin in a manner comparable to vertebrates, it is in the ascidian lineage that changes have occurred. Consequently, ascidians build an antero-posterior axis, very similarly organized to that of vertebrates, but in a different way.
Citation: Feinberg S, Roure A, Piron J, Darras S (2019) Antero-posterior ectoderm patterning by canonical Wnt signaling during ascidian development. PLoS Genet 15(3): e1008054. https://doi.org/10.1371/journal.pgen.1008054
Editor: Marianne E. Bronner, California Institute of Technology, UNITED STATES
Received: October 23, 2018; Accepted: February 28, 2019; Published: March 29, 2019
Copyright: © 2019 Feinberg et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Data Availability: All relevant data are within the manuscript and its Supporting Information files.
Funding: The work was supported by CNRS, Sorbonne Université, the Réseau André Picard by JC internship support (ANR-11-IDEX-0004-02 to Sorbonne Université) and a grant from the Agence Nationale de la Recherche (ANR-11-JSV2-007-01) to SD. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: The authors have declared that no competing interests exist.
Introduction
Ascidians belong to the tunicates, the sister group of the vertebrates. Together with the cephalochordate (amphioxus) and vertebrate phyla they form the super-phylum of chordates whose specific body plan includes a notochord and a dorsal hollow neural tube during embryonic life. Comparative developmental studies between these three phyla is essential for elaborating evolutionary scenarios explaining the emergence of chordates and their diversification [1–4]. Ascidians are particularly puzzling organisms since they took a significantly different evolutionary path from other chordates resulting in divergent morphological, embryological and genomic features. Their development is fast and stereotyped with very few cells; and ascidian genomes have undergone compaction and extensive rearrangements when compared to vertebrates and amphioxus. This raises the question of whether developmental mechanisms controlling typical chordate structure formation are conserved between ascidians and other chordates. In particular, ascidian embryos are the emblematic examples for the concept of mosaic development. However, it is well known that cell-cell communication is involved in cell fate determination, yet possibly at only short distances (i.e. neighboring cells) [5–7].
Wnt signaling, one of the pathways present in animals, allows cells to communicate through the secretion of the Wnt ligands that bind to their cognate Frizzled receptors. It is involved in a wide range of biological processes during embryogenesis and adult homeostasis [8,9]. The canonical Wnt pathway (cWnt) that uses the protein β-catenin as a central mediator to control target gene transcription is extensively involved in axis formation during the development of many metazoans [10,11]. Three discrete developmental processes contribute to antero-posterior (AP) axis formation in bilaterians: germ layer specification, AP patterning and posterior growth. During cleavage/blastula stages, nuclear accumulation of β-catenin in the vegetal hemisphere specifies endomesoderm in several phyla (nemerteans, echinoderms, hemichordates and ascidians) [12–15]. A similar function for the specification of the endoderm at the oral pole of cnidarians suggests that this constitutes an ancient function at the base of metazoans [16,17]. In vertebrates, a posterior to anterior gradient of activity provides cells with positional information and patterns the central nervous system (CNS) [18–21]. A recent study in hemichordates demonstrated that this function for cWnt is conserved at the base of the deuterostomes [22]. Finally, in both insects and vertebrates, Wnt signaling controls body elongation during posterior growth [23].
Posterior growth does not exist in ascidians since the embryo elongation at the improperly named tailbud stages occurs through cell division and rearrangement without proper addition of new tissue from a growth zone [24]. Embryonic axes are determined very early and can be identified in the fertilized egg before first cleavage [5]. cWnt participates in endomesoderm formation along the animal-vegetal axis [13,25]. The AP axis is orthogonal and determined following ooplasmic movements that localize asymmetric cleavage determinants to the posterior. A consequence for AP patterning is that anterior (so called a-line) and posterior (b-line) ectoderm precursors have intrinsically different potentials in response to neural induction as soon as they arise at the 8-cell stage [26]. Interestingly, not only the CNS but also the epidermis is patterned along the AP axis; and this patterning also involves signals from vegetal tissues [27]. The transcription factor FoxA-a is the anterior determinant that establishes the early a-line versus b-line potentials [28,29]. Since direct transcriptional FoxA-a targets are Wnt antagonists–a-line expressed Sfrp1/5 and Ror genes–there is a potential role for Wnt signaling in ectoderm AP patterning. Moreover, the AP identity of the two sensory pigment cells within the CNS is controlled by Wnt signaling [30]. However, a global function for Wnt in ectoderm AP patterning has not been investigated; and this is the topic of the present manuscript.
Sequencing and annotation of the ascidian Ciona robusta (formerly known as C. intestinalis type A) has revealed a complement for Wnt signaling compatible with a functional pathway [31–34]. A recent phylogenetic analysis has shown that the ten Wnt ligands found in the Ciona genome correspond to 10 out of the 13 families present at the base of chordates, with the loss of Wnt1, Wnt4 and Wnt8 [35]. Their spatio-temporal expression has been described throughout embryogenesis for eight of them, but only a few show a restricted pattern (Wnt3, Wnt5, Wnt6 and Wnt7) [35–39]. In particular, they do not display a staggered expression in the posterior of the embryo as observed for many metazoans including vertebrates and amphioxus (reviewed in [10], [35]). The only possible similarity would be the expression of the four above mentioned ligands in caudal muscle at cleavage/gastrula stages and the epidermal expression of Wnt5 at the posterior tip of the forming tail. At the opposite pole of the embryo, the Wnt antagonists, Sfrp1/5 and Ror genes, are expressed in the anterior ectoderm as described above [28,29,36,37]. The C. robusta genome contains five Frizzled receptors [33]. The expression pattern is known for three of them (Frizzled1/2/7 and Frizzled5/8 are maternally and ubiquitously expressed; Frizzled4 is expressed in the ectoderm from the 16-cell stage and later in various discrete regions), but does not allow us to predict where and when Wnt signaling is active [36].
In the present study, we have combined ectopic activation and down-regulation of the cWnt pathway to assess the effects on AP patterning of the C. intestinalis embryonic ectoderm. Activating cWnt from gastrulation leads to a loss of anterior ectoderm that is converted in posterior ectoderm. By contrast, inhibiting cWnt has varying effects depending on the ectoderm derivatives. Epidermis AP patterning is unchanged. The CNS is largely unaffected, except for its anterior and posterior ends, suggesting a function of cWnt in refining a global AP pattern that is defined by other means. Finally, the early definition of the caudal peripheral nervous system (PNS) requires cWnt signaling but redundant mechanisms allow proper differentiation of this tissue. Consequently, while the Ciona ectoderm displays a sensitivity to cWnt activation that is compatible with the expected function for cWnt at the base of deuterostomes, cWnt is only marginally required for ectoderm AP patterning.
Results
Timing of cWnt activity on ectoderm patterning
LiCl or small molecule inhibitors of Gsk3β have been previously used in ascidian embryos to activate the cWnt pathway [13,25,40]. We have further developed such treatments using two distinct inhibitors, 1-azakenpaullone and BIO [41,42]. These inhibitors were tested at two doses (5 and 10 μM for 1-azakenpaullone; 1 and 2.5 μM for BIO). The results presented here correspond to the highest dose for each molecule, conditions leading to fully penetrant and identical phenotypes for both inhibitors. As expected, early treatments led to ectopic endoderm formation as revealed by staining for endoderm specific endogenous alkaline phosphatase activity (S1 Fig). Treatments starting at the 32-cell stage or later produced embryos with a dramatically abnormal morphology but without ectopic endoderm, allowing us to determine effects on ectoderm patterning without interfering with germ layer formation. A previous report has suggested that activating the cWnt pathway interferes with epidermal sensory neuron (ESN) formation along the AP axis in the tail [40]. We reproduced the reported results: a loss of anterior ventral ESN formation (revealed by the expression of Etr at late tailbud stages) when the treatment was initiated at early neurula stages (stage 14) and an absence of effect when the treatment was initiated at initial tailbud stages (stage 17) (Fig 1D–1G). However, when the treatment was initiated at the onset of gastrulation (stage 10), we observed ectopic ESNs located in the ventral trunk midline (Fig 1B and 1C). Caudal ESNs are known to arise from a neurogenic territory characterized by the expression of Klf1/2/4 [43]. The presence of ectopic ESNs in the trunk upon cWnt activation was accompanied by the ectopic expression of Klf1/2/4 in the ventral trunk midline (Fig 1I–1L), suggesting that these ectopic ESNs arise from an ectopic neurogenic territory. Interestingly, Klf1/2/4 ectopic expression was also observed in treatments starting at stage 14 while Etr expression was repressed. To further investigate the apparent posteriorization of the ectoderm following cWnt activation, we determined the expression of Zf115, a gene with a marked restricted expression in the tail epidermis [44]. Zf115 was ectopically expressed in the entire trunk epidermis for both of our early treatments (Fig 1N–1Q) but not for the latest treatment (S2 Fig). To further delineate the sensitivity of the ectoderm to cWnt activation, we performed 30 min treatments at various developmental stages and assessed the expression of both Etr and Zf115. Ectopic expression of Etr in the ventral trunk was observed when such short treatments were performed during gastrulation (stages 10 to 13), but not later (S2 Fig). The loss of anterior ventral tail Etr expression described above was not observed in the pulse treatments suggesting a longer exposure time may be required. Ectopic Zf115 expression in the trunk was observed for all pulse treatments with a reducing effect as the treatment was delayed: treatment at the onset of gastrulation led to an ectopic expression in the entire trunk while later treatments led to an extension limited to the posterior trunk (S2 Fig).
Embryos were treated with 10 μM 1-azakenpaullone or 2.5 μM BIO from initial gastrula (stage 10; B, C, I, J, N and O), from early neurula (stage 14; D, E, K, L, P and Q) or from initial tailbud stages (stage 17; F and G) until fixation at late tailbud stages (stages 23/24). Expression of Etr (A-G), Klf1/2/4 (H-L) and Zf115 (M-Q) was determined by in situ hybridization. Black arrows point to palp neurons, white arrowheads indicate ectopic Etr staining in the ventral trunk epidermis midline. Embryos are oriented with dorsal to the top and anterior to the left. On the right side of each picture, a schematic embryo depicts our interpretation of the expression pattern according to each tissue: PNS (pink at the top) and epidermis (green in the middle). Number of experiments: one for B, C, F, G, K and L; two for A, D, E, H, I, J and M to Q.
Above results suggest that cWnt activation converts trunk ectoderm into tail ectoderm with a maximum sensitivity during early gastrulation.
cWnt activation using small molecule inhibitors posteriorizes the ectoderm
In this section, we will determine what are the effects of activating cWnt from gastrulation on all three ectoderm derivatives: the epidermis, the peripheral and the central nervous system. We have thus examined by in situ hybridization the expression of a panel of AP markers for the ectoderm at early tailbud stages (stage 19/21) following 1-azakenpaullone or BIO treatment from initial gastrula (stage 10). Both drugs led to similar effects (Figs 2 and S3). Interestingly, while we observed a dose response on the morphology of embryos treated with 1-azakenpaullone, the effect on the AP markers examined remained consistent for all doses (S4 Fig). We did not observe a graded effect similar to what was observed when the treatment was staggered over timed intervals (S2 Fig).
Embryos were treated with 10 μM 1-azakenpaullone from stage 10 (initial gastrula), fixed at stage 19/20 (early tailbud) and processed for in situ hybridization to determine the expression pattern of Msxb (A), Nk4 (B), Islet (C), Otx (D), FoxF (E), Hox1 (F), Cdx (G), Six3/6 (H), Trp (I), Mytf (J) and Hox12 (K). DMSO-treated control embryos (i) and 1-azakenpaullone-treated embryos (ii). Embryos are oriented with dorsal to the top and anterior to the left. On the right side of each picture, a schematic embryo depicts our interpretation of the expression pattern according to each tissue: PNS (pink at the top), epidermis (green in the middle) and CNS (orange at the bottom). Number of experiments: one for Islet, FoxF, Hox1, Cdx, Trp, Mytf and Hox12; two for Msxb, Nk4, Otx and Six3/6.
Peripheral nervous system.
As described previously, ectopic ESN formation in the ventral midline of the trunk ectoderm following cWnt activation is accompanied by the formation of an ectopic neurogenic territory. This result is confirmed by the ectopic expression at early tailbud stages of the transcription factor coding gene Msxb that is necessary and sufficient for neurogenic territory and ESN formation [45] (Figs 2A and S3). Ectopic ventral "tail midline" in the trunk led to a loss of trunk ventral ectoderm identity as revealed by the loss of expression of several markers such as Nk4, Nkx-A, Bmp2/4 and Smad6/7 (Figs 2B and S3). A similar situation was not observed on the dorsal side, the neurogenic markers, Msxb and Klf1/2/4, and the neuronal marker Etr did not extend anteriorly (Figs 1B–1L and 2A and S3).
At the very anterior end of the embryo, peripheral sensory neurons of the palps express the genes Etr and Islet (Figs 1A and 2C). Expression of both genes was lost following cWnt activation (Figs 1B, 1C and 2C and S3). Accordingly, anterior epidermal expression of Ror-a and Otx that delineates the palps territory was also abolished (Figs 2D and S3).
Epidermis.
The loss of anterior identity was not limited to the anteriormost ectoderm that is epidermal and neurogenic (palp neurons). FoxF, that marks the entire trunk epidermis except the anteriormost part, was also lost following cWnt activation (Fig 2E). Epidermal expression of Hox1 at the trunk/tail junction and in the anterior tail was also suppressed (Fig 2F). In contrast, expression of the two tail epidermis markers, Zf115 and Cdx, was extended to the entire trunk epidermis (Figs 1M–1Q and 2G and S3). The epidermal expression of the very posterior gene Hox12 was weakly extended anteriorly (Fig 2K). However, such weak ectopic expression did not demonstrate that the epidermis acquired posteriormost identity. In summary, we conclude that trunk epidermis acquired a tail epidermis identity when cWnt was activated.
Central nervous system.
We have observed different gene behaviors in response to cWnt activation according to the AP level where they are normally expressed. For example, Six1/2 and Six3/6 expression at the anteriormost edge of the CNS (sensory vesicle) has expanded anteriorly (Figs 2H and S3 and S4). Expression of other genes in the sensory vesicle, Etr, Ror-a, Otx, Trp, Gbe1 and Mytf, was maintained albeit possibly at weaker levels (Figs 1A–1C, 2D and 2I–2J and S3). The tail nerve cord was still present as revealed by the expression of KH.C7.391 (S3 Fig), but its patterning was modified. While Hox1, normally expressed in the anterior nerve cord, was not expressed, Hox12, a marker for the posterior tip of the nerve cord, was ectopically expressed anteriorly (Fig 2F and 2K).
Non-ectodermal derivatives.
We have seen that the endoderm formed somewhat normally following cWnt activation after cleavage stages (S1 Fig), however, its patterning was affected. Cdx, which is normally expressed in the tail endoderm (the endodermal strand), was ectopically expressed in the ventral trunk endoderm; while ventral endodermal trunk expression of Nk4, Nkx-A and Bmp2/4 was lost (S3 Fig). Mesodermal derivatives appeared to form normally since expression of FoxF in cardiopharyngeal progenitors (the trunk ventral cells), Ferritin in the tail muscle, and Brachyury and Tgf-β in the notochord were maintained (Figs 2E and S3 and S4). Notochord AP patterning was likely modified. Endogenous alkaline phosphatase activity is found in the trunk endoderm and posteriormost notochord in swimming larvae (S4 Fig). This activity was observed throughout the notochord following 1-azakenpaullone treatment. Similarly, Tgf-β, whose normal expression increases anteriorly to posteriorly in the notochord, was found to have a uniform pattern following cWnt activation (S4 Fig). Thus, the formation of both endodermal and mesodermal derivatives appears to be largely unaffected by cWnt activation, although they are likely posteriorized.
cWnt activation using overexpression posteriorizes the ectoderm
To verify the specificity towards Wnt/β-catenin signaling of the above results, we overexpressed Wnt5, a ligand normally restricted to the posterior ectoderm [36], throughout the ectoderm using DNA electroporation. This led to ectopic expression of the tail midline markers Msxb, Klf1/2/4 and Nkx-C in the ventral trunk epidermis (S5 Fig). However, the embryo morphology was severely affected, making gene expression analysis tedious. We turned to overexpression of ΔN-β-catenin, a version of β-catenin that is deleted from the N-terminal domain (containing Gsk3β phosphorylation sites) and that behaves as a dominant active form [40]. We could reproduce the results obtained using Gsk3 inhibitor treatments: ectopic expression of Six1/2, Six3/6, Msxb and Klf1/2/4 (Figs 3B, 3D and 3L and S5), and repression of the epidermal expression of Hox1, Islet and Ror-a (Fig 3F, 3H and 3J). The CNS expression of Hox1 was not affected since we targeted the ectoderm using the promoter of the Fucosyl transferase gene [40]; CNS Hox1 positive cells originate from vegetal lineages and do not express this gene. These observations strengthen our findings that AP patterning defects result from direct action of Wnt/β-catenin signaling.
Embryos were electroporated and fixed for in situ hybridization at initial tailbud stages (stage 18, K and L) and early tailbud stages (stage 21, A to J). Control pFog>Venus-electroporated embryos (A, C, E, G, I and K) and pFt>ΔN-β-catenin-electroporated embryos (B, D, F, H, J and L). Following ΔN-β-catenin overexpression, note the anterior extension of Six1/2 (B) and Six3/6 (D), the repression of epidermal expression of Hox1 (F), the repression of Islet (H) and Ror-a (J) in the palp forming region, and the ectopic expression of Msxb (L) in the ventral trunk epidermis. Embryos are oriented with dorsal to the top and anterior to the left. On the right side of each picture, a schematic embryo depicts our interpretation of the expression pattern according to each tissue: PNS (pink at the top), epidermis (green in the middle) and CNS (orange at the bottom). Number of experiments: one for Hox1, Islet and Ror-a; two for Six1/2, Six3/6 and Msxb.
Overlap between cWnt and Bmp signals defines the tail ventral midline
In previous results, we observed that activating cWnt led to the formation of an ectopic neurogenic territory in the ventral trunk epidermis. It is known that Bmp signaling is required to specify the tail ventral midline and that Bmp signaling is active throughout the ventral epidermis, both in the trunk and the tail [43,46]. We thus expressed Noggin, a secreted Bmp antagonist, together with ΔN-β-catenin. As predicted, ectopic expression of Klf1/2/4 and Msxb was suppressed (Figs 4E and S6). As previously reported, when Bmp signaling was activated, Klf1/2/4 and Msxb were ectopically expressed throughout the tail epidermis (Figs 4C and S6) [43,46]. Activation of cWnt signaling in addition to Bmp led to ectopic activation of both genes in the trunk epidermis as well (Figs 4F and S6), suggesting that combining cWnt and Bmp signals is sufficient to launch the tail ventral neurogenic program (Fig 4G).
(A) Control unelectroporated embryo. Embryos were electroporated with pFog>Noggin (B), pFog>Admp (C), pFt>ΔN-β-catenin (D), pFog>Noggin + pFt>ΔN-β-catenin (E), and pFog>Admp + pFt>ΔN-β-catenin (F), and fixed for in situ hybridization at initial tailbud stages (stage 18) for Klf1/2/4. Ectopic staining is highlighted by the white arrowheads. (G) Schematic proposing that the tail ventral neurogenic midline territory forms where both Wnt and Bmp pathways are active. One experiment was performed.
cWnt activity is dispensable for epidermis patterning
We have used the overexpression of two different proteins to block Wnt signaling. TcfΔC is a dominant negative form of the transcription factor Tcf that normally regulates transcription, together with β-catenin, downstream of the binding of a Wnt ligand to a Frizzled receptor. It contains a C-terminal deletion that eliminates the DNA binding domain of Tcf and has been previously used in Ciona to inhibit β-catenin nuclear activity during endomesoderm formation [25,47]. Sfrp1/5 is a naturally secreted antagonist of Wnt signaling that acts by sequestering Wnt ligands and thus preventing them from binding to Frizzled receptors [48]. Both molecules were overexpressed in the entire ectoderm using the promoters of the Friend of gata (Fog) or Fucosyl transferase (Ft) genes [40,49]. The following combinations produced the strongest phenotypes and were used in subsequent experiments: pFog>TcfΔC and pFt>Sfrp1/5.
We first determined the efficiency of our constructs by testing their ability to counteract the effect of Gsk3 inhibitor treatment. Overexpression of TcfΔC was sufficient to suppress the ectopic activation of both Six3/6 and Klf1/2/4 triggered by 1-azakenpaullone treatment (Fig 5A–5D). We could not perform the same assay for Sfrp1/5 since it acts upstream of Gsk3 inhibitors in the cWnt pathway. However, its overexpression had similar effects as TcfΔC overexpression did.
Embryos were electroporated with pFog>Venus (i), pFog>TcfΔC (ii), or pFt>Sfrp1/5 (iii), treated with DMSO (A, C) or 10 μM 1-azakenpaullone from stage 10 (initial gastrula) (B, D), and fixed for in situ hybridization at early tailbud stages (stage 21) for Six3/6 (A, B and H), Klf1/2/4 (C and D), Islet (E), Ror-a (F), Six1/2 (G), Hox1 (I), Cdx (J) and Hox12 (K). Inset in Hii shows the trunk region of the same embryo in dorsal view (anterior to the left), with a remaining unilateral patch of expression resulting from the mosaic inheritance of the pFog>TcfΔC plasmid. Embryos are in dorsal view (A, B and Hii inset), ventral view (C and D) or lateral view oriented with dorsal to the top (E-K, except Hii inset) and anterior to the left. On the right side of pictures E to K, a schematic embryo depicts our interpretation of the expression pattern according to each tissue: PNS (pink at the top), epidermis (green in the middle) and CNS (orange at the bottom). Number of experiments: one for A to F; two for G and I; three or more for H, J and K.
Given the robust phenotypes on epidermal expression following cWnt activation, we expected a strong reciprocal effect for Wnt inhibition: loss of posterior markers and posterior extension of anterior marker expression. We were surprised to see that epidermal expression of Islet, Ror-a, Hox1 and Cdx was unchanged (Fig 5E, 5F, 5I and 5J), with possibly a weak reduction in levels of expression in the most affected embryos as depicted for Cdx on Fig 5J. The only clear difference we could detect was a repression of the epidermal expression of Hox12 using both constructs (Fig 5Kii and 5Kiii), but we did not detect a concomitant posterior extension of Cdx into the tail tip (Fig 5J). Consequently, with the exception of Hox12 and possibly the tail tip, epidermis AP patterning is largely unchanged following Wnt signaling inhibition.
A limited portion of the CNS requires cWnt activity
We have determined, at tailbud stages, the expression of CNS genes whose expression was modified following cWnt activation: Six1/2, Six3/6, Hox1 and Hox12. Both Six1/2 and Six3/6 were robustly repressed by pFog>TcfΔC, but only slightly downregulated by pFt>Sfrp1/5 in a minority of embryos (Fig 5G and 5H). This suggests that both genes could be positively regulated by cWnt signaling although in a ligand independent manner. Anterior tail nerve cord Hox1 expression was unchanged (Fig 5I). Expression of Hox12 in the posterior of the tail nerve cord was downregulated by pFt>Sfrp1/5 but unaffected by pFog>TcfΔC (Fig 5K). This difference possibly stems from the embryonic origin of the Hox12 expressing cells that may be of vegetal origin (A-line). Consequently, they do not express the promoters used and as such, do not express the transgenes. Since Sfrp1/5 is a secreted molecule it can prevent these cells from receiving Wnt signals.
In summary, CNS patterning is regulated by Wnt signaling at only the anteriormost and the posteriormost regions of the axis.
cWnt regulates medio-lateral anterior neural plate border patterning
The above results prompted us to test the effects of Wnt signaling modulations on the early formation of the CNS at the neural plate stage (stages 13/14) (Fig 6). Etr, whose expression is found in the CNS precursors (rows I to IV according to [50]) and in the palp forming region at the medial anterior neural plate border (rows V and VI; Fig 6Ai and 6D), displayed a loss of expression in this latter territory following cWnt activation (Fig 6Aii). This corroborates previous results obtained at later stages with the markers Ror-a, Otx and Islet. However, the loss of this marker does not correspond to a conversion into more posterior neural tissue since the expression of Six3/6, which is immediately posterior to the anterior neural plate border, was unchanged (row IV; Fig 6B). Moreover, Ap2-like2 expression was also unchanged and did not extend posteriorly (Fig 6C) suggesting that a conversion into epidermis had not occurred. When Wnt signaling was inhibited, Etr was ectopically expressed laterally in the anterior neural plate border (Fig 6Aiii and 6Aiv). These observations suggest that Wnt signaling regulates medio-lateral patterning of the anterior neural plate border. Importantly, as development proceeds, the medial part of the anterior neural plate border stained by Etr will form the very anterior palps region while the lateral part, Etr negative, will form the region immediately posterior containing anterior apical trunk ESNs (aATENs) (Fig 6D and 6E) [51,52].
(A-C) Embryos were electroporated with pFog>Venus (i), pFt>ΔN-β-catenin (ii), pFog>TcfΔC (iii), or pFt>Sfrp1/5 (iv), and fixed for in situ hybridization at early neurula stages (stages 13/14) for Etr (A), Six3/6 (B) and Ap2-like2 (C). Ectopic expression in the lateral anterior neural plate border is indicated by the white arrows. For each embryo, a schematic in the bottom right corner depicts the neural plate (rows I to IV) and the anterior neural plate border (rows V and VI) in grey, and gene expression according to tissue: PNS (pink), epidermis (green) and CNS (orange). The eight median cells expressing Etr in rows V and VI are the palp region precursors. Gene expression change is unilateral in Aii, Aiii and Aiv because of the mosaic inheritance of the electroporated plasmid. Embryos are in dorsal (neural plate) view with anterior to the top. (D-E) Schematic representation of the progeny of neural plate blastomeres (D) at tailbud stages (E): palp precursors in pink, aATENS precursors in grey and CNS precursors in orange (adapted from [52,69]). Dorsal view with anterior to the top in D, and lateral view with anterior to the top and ventral to the left in E. Number of experiments: one for Six3/6; two for Etr and Ap2-like2.
Posterior PNS formation is only initially dependent on cWnt
We next tested the requirement of Wnt signaling for tail PNS formation. In a reciprocal manner to their activation following cWnt activation (S5 Fig), the genes Msxb, Klf1/2/4 and Nkx-C were strongly downregulated following either TcfΔC or Sfrp1/5 overexpression (Figs 7C, 7D and S7). Of these, Msxb was the most affected gene and displayed a complete loss of expression by in situ hybridization for the strongest phenotypes (Figs 7C, 7D and S8). We next assessed ESN formation using Etr as a marker. To avoid confusion with CNS staining, we only scored ventral ESNs. The number and location of ESNs is stochastically determined and so varies from embryo to embryo [43]. For the control embryos electroporated with pFog>Venus, we counted 6.8 ESNs on average (n = 44 embryos). The numbers for the experimental embryos were as follows: 6.8 ESNs for pFt>Sfrp1/5 (n = 46) and 5.8 for pFog>TcfΔC (n = 42). This suggests that Wnt signaling is not essential for tail PNS formation. A possible explanation comes from the observation of Achaete-scute a-like2, a transcription factor expressed in the tail neurogenic midlines [45]. Contrary to the other three genes examined, Achaete-scute a-like2 expression was unchanged following either activation or inhibition of Wnt signaling (Fig 7E–7H). Achaete-scute a-like2 could thus compensate the downregulation of other transcription factors and allow tail PNS formation when Wnt signaling is blocked.
Embryos were electroporated with pFog>Venus (A, E), pFt>ΔN-β-catenin (B, F), pFog>TcfΔC (C, G), and pFt>Sfrp1/5 (D, H), and fixed for in situ hybridization at initial tailbud stages (stage 18) for Msxb (A-D) and Achaete-scute a-like2 (E-H). Msxb is positively regulated by cWnt signaling: ectopic expression in the ventral trunk epidermis upon activation (B) and downregulation in dorsal and ventral tail neurogenic regions upon inhibition (C, D). By contrast, Achaete-scute a-like2 expression is unchanged for both cWnt activation or inhibition (F-H). Embryos are oriented with dorsal to the top and anterior to the left. Number of experiments: one for Achaete-scute a-like2 and three or more for Msxb.
Discussion
The impacts of modulating cWnt activity on the AP pattern of the ectoderm are summarized in Fig 8. Activating cWnt using either pharmacological Gsk3 inhibitors or overexpression of a constitutively active β-catenin led to very dramatic modifications of the ectoderm AP axis. By analyzing the expression of markers that delineate broad AP domains of the epidermis and the neurogenic epidermis of the PNS (the anterior palp forming region and the caudal midlines), we observed a loss of anterior identity (Otx, Ror-a, Islet and Etr in the palp region; FoxF in the trunk; Bmp2/4, Smad6/7, Nkx-A and Nk4 in the ventral trunk; Figs 1–3 and S2–S4) and a concomitant anterior extension of posterior identity (Cdx, Zf115, Msxb, Klf1/2/4 and Nkx-C; Figs 1–3 and S2–S5), suggesting that the trunk epidermis was respecified as tail epidermis. In the CNS, the situation is less extreme: posteriorization was observed in the anteriormost region (ectopic expression anteriorly for Six1/2 and Six3/6; Figs 2 and 3 and S3 and S4) and within the tail nerve cord (loss of Hox1 in the anterior tail nerve cord and anterior ectopic expression of Hox12; Figs 2 and S3 and S4). Inhibition of cWnt led to downregulation of Msxb, Klf1/2/4 and Nkx-C but not of Achaete-scute a-like2 in the tail neurogenic midlines (Figs 7 and S7), and only to downregulation of Hox12 in the epidermis (Fig 5). In the CNS, the anteriormost and posteriormost regions were affected as revealed by the repression of Six1/2, Six3/6 and Hox12 (Fig 5). The above patterning defects triggered by cWnt are also possibly at play in the other germ layers, endoderm and mesoderm (Figs 2 and S3 and S4), as observed in some vertebrates [53,54].
Schematic representation of the results obtained in this study for the AP pattern of the PNS, the epidermis and the CNS following cWnt activation or inhibition. Red: anterior. Blue: posterior. Some of the key patterning genes whose expression has been determined in functional studies are listed above each domain.
Traces of ancestral cWnt patterning function are visible in ascidian embryos
Data from cWnt activation together with the expression of Wnt5 and Wnt6 posteriorly and of Wnt antagonists (Sfrp1/5, Ror-a and Ror-b) anteriorly fit with a global view of graded Wnt activity from posterior to anterior. These data are in agreement with the proposed ancient role for cWnt signaling in patterning the AP axis during early embryonic development, at least at the base of the deuterostomes [22]. In particular, the ascidian epidermis that contains neurogenic domains (forming ESNs) is highly regionalized along the AP axis. While we are not aware of similar organization in vertebrates, with the exception of specific regions such as the amphibian cement gland, similarities might be drawn with the hemichordate neurogenic ectoderm whose AP pattern is regulated by Wnt signaling [22].
Our results from cWnt activation are at first glance similar to what has been observed in other metazoans–repression of anterior identities and promotion of more posterior identities. We would like to discuss these observations by combining cWnt inhibition data and by restricting our comparisons to deuterostomes (Fig 9).
Schematic summary of data resulting from functional studies in vertebrates, amphioxus, echinoderms and hemichordate [10,18–22,55–59]. Note that the color code (red: anterior, orange: intermediate, blue: posterior) depicts regional domains along the AP axis and does not necessarily imply homology. Some of the key patterning genes whose expression has been determined in functional studies are listed above each domain.
Anterior repression.
The fact that anterior identity is incompatible with cWnt activity is well documented in deuterostomes (reviewed in [55]). Studies in different species from vertebrates, amphioxus, echinoderms and hemichordates have shown that cWnt activation abolishes anterior identity [18–22,56–59], as we observed for Ciona. While cWnt inhibition experiments have not been reported from amphioxus, data from vertebrates, echinoderms and hemichordates indicate that inhibiting cWnt is sufficient to enlarge the anterior of the embryo at the expense of more posterior territories (forebrain identity enlarged towards hindbrain in the vertebrate CNS). We did not detect such an effect when we examined anteriormost markers (Islet and Ror-a in Fig 5). This suggests that, in Ciona, cWnt inhibition is likely necessary but not sufficient to define the anterior identity. A tempting hypothesis involving inhibition of additional pathways will require further experimentation. However, analysis of Etr expression at neural plate stages (that labels the palp forming region; see Fig 6) was suggestive of an anteriorization upon cWnt inhibition (ectopic expression in lateral cells that are precursors of aATENs, ESNs located posterior to the palps at tailbud stages). This result needs to be confirmed with additional AP markers, a deeper scrutiny of the anterior ectoderm and lineage tracing experiments. If confirmed, this would indicate that patterning of the very anterior end of the Ciona embryo may be conserved with other deuterostomes.
Posteriorization.
Posteriorization has been best studied in vertebrates and hemichordates where intermediate AP marker expression (hindbrain in vertebrates) is shifted anteriorly (in the fore-/mid-brain region in vertebrates) upon cWnt activation while more posterior markers (spinal cord in vertebrates) are not affected. The anterior extension of the Six1/2 and Six3/6 domains that we have observed in Ciona might be similar despite the fact that Six3 marks the territory whose formation is inhibited by cWnt in other deuterostomes. We have not performed lineage tracing experiments but our results (ectopic expression of Six1/2 and Six3/6 at tailbud stages in Figs 3 and S4; loss of Etr at neural plate stages in Fig 6) are suggestive of ectopic Six gene expression in the epidermis immediately anterior to the sensory vesicle and in the palp region. Reciprocally, Six1/2 and Six3/6 expression is Wnt dependent and their loss upon cWnt inhibition might be associated with an anteriorization as discussed above. A conservation of graded cWnt activity to pattern the anterior would thus be found with vertebrates/hemichordates, but without a strict correspondence between the AP domains regulated by cWnt. Interestingly, a recent study has elegantly described specification mechanisms for these two sub-domains of the anterior neural plate border: the palp precursor region (medial at neural plate stages, then at the anterior tip at tailbud stages) and the aATENs precursor region (lateral at neural plate stages, then posterior to the palps at tailbud stages) [52]. It has been shown that two transcription factors control formation of these domains, FoxC (palps) and Six1/2 (aATENs), and a reciprocal repression between them ensures proper fate segregation. cWnt could thus act before these interlocking regulatory interactions by specifying the aATENs domain.
By contrast, we do not consider that the posteriorization within the Ciona caudal nerve cord (ectopic Hox12 expression) is comparable to the vertebrate/hemichordate case where the initial definition of the posteriormost part of the embryo is Wnt independent. The cWnt requirement for Hox12 expression at the tip of the tail, both in the epidermis and in the nerve cord, where Wnt5 is expressed [24,40] might, however, bear some similarity with the regulation of the posterior ectoderm by Wnt5 in sea urchin [60].
What patterns the ascidian ectoderm AP axis?
The marked difference between activation (dramatic posteriorization phenotypes) and inhibition (discrete and limited phenotypes) of cWnt signaling was rather puzzling. An obvious explanation could be the incomplete inhibition of the pathway. TcfΔC has been previously used to inhibit endomesoderm formation in Ciona [25] and we have shown that it can suppress the action of the Gsk3 inhibitor 1-azakenpaullone (Fig 5); and Sfrp1/5 led to similar effects in the experiments presented here. The activation data that we have presented (Figs 1 and S2) show that the ectoderm is responsive to cWnt signaling for a prolonged period of time during gastrulation and neurulation, and cWnt signaling might consequently be ongoing during this time window (only around 4hrs in Ciona developing at 18°C [61]). We thus tested various combinations of the two ectodermal drivers (pFog and pFt), a strong ubiquitous driver (pEf1α [62,63]) as well as combinations of TcfΔC and Sfrp1/5 (S8 Fig). This did not lead to a dramatically stronger repression of the genes that we have tested. While we cannot rule out that cWnt is active in the ectoderm before our earliest driver (pFog: 16-cell stage), we conclude that a partial inhibition of cWnt is not the most likely explanation for the modest phenotypes that we have observed.
In addition to Wnt signaling, several pathways (Fgf, retinoic acid, Shh) participate in patterning the CNS of the vertebrate embryo [56,64–66]. In Ciona, while retinoic acid regulates AP identity of both the CNS and the epidermis at the level of the anterior tail, Fgf regulates tail tip identity of the epidermis but also CNS patterning at various places (tail tip, posterior sensory vesicle, pigment cells, anterior neural plate border) [24,40,67–70]. Fgf signaling is thus likely to interact with cWnt and may act as a redundant signal that compensates for the loss of Wnt signaling in our experiments; we aim at testing their respective functions in future experiments.
A major outcome of cWnt signaling is the regulation of gene expression and transcriptional reporters containing Tcf binding sites have been used as proxies to determine cWnt activity. We have used a reporter previously described in Ciona [40] and found the same global conclusions: reporter activity could be detected in endomesoderm derivatives and in the neurogenic tail ventral midline (S1 Table). We also detected activity in the posterior dorsal midline. In addition, our quantification of reporter activity showed that while endomesodermal activity was detected in a large majority of the embryos, epidermal activity was found, at best, in around 10% of the embryos. Furthermore, this reporter was not active in the CNS regions where we functionally uncovered a role for Wnt signaling. This suggests that cWnt activity in the ectoderm may be very low or possibly at levels undetectable by the reporter used, or that this reporter may not be a faithful readout of cWnt in the ectoderm.
Finally, a major explanation for the modest roles of cWnt in ectoderm AP patterning is likely to stem from the mosaic development of ascidians. In particular, it is well known that the binary AP difference in the ectoderm occurs as early as the 8-cell stage between the trunk and the tail ectoderm precursors, and that FoxA-a acts as an anterior determinant [26,28,71,72]. cWnt might thus be involved, possibly together or redundantly with other signals, in refining this basic pattern. For example, both Wnt5 and Wnt6 are expressed posteriorly and could participate in the definition of the posteriormost CNS and caudal PNS. Wnt6 is also expressed transiently in the anterior neural plate border similarly to Six3/6 and could play a role in the patterning of this region of the embryo [36,37]. Further combinatorial and targeted experiments will be required to definitively determine the precise function of Wnt signaling in ectoderm patterning.
cWnt as a new actor in caudal PNS formation
While cWnt is not essential for caudal PNS formation, we have uncovered two distinct functions. First, cWnt appears to interact with Bmp signaling to position within the embryo the ventral neurogenic midline, by regulating the expression of the gene Msxb (S6 Fig). This is not the only mechanism involved since the expression of Achaete-scute a-like2, another early midline gene, is Wnt independent. It would be interesting to uncover and compare the mechanisms that initiate the transcription of both genes in the tail ventral ectoderm through the study of their cis-regulatory DNAs. The timed activation of cWnt allowed us to uncover a later function for cWnt that is independent of the posteriorization; cWnt repressed ESN formation (Fig 1). It is well known that Notch signaling regulates the number of ESNs that form in the caudal midlines and launches a proneural transcriptional cascade [43,73–75]. It will thus be important to determine whether cWnt interacts with this GRN and at which level.
Methods
Embryo obtention and manipulation
Ripe adults of Ciona intestinalis (formerly referred to Ciona intestinalis type B [32]) were provided by the Centre de Ressources Biologiques Marines in Roscoff (EMBRC-France). Embryo obtention and electroporation were performed as described [72]: 50 μg of each plasmid DNA were used in a 350 μl electroporation volume placed in a 4 mm cuvette and a single pulse of 25V for 32 ms was applied using an ECM830 electroporator (BTX, Harvard Bioscience). Stock solutions of 1-azakenpaullone (191500, Calbiochem, Merck) and BIO (361550, Calbiochem, Merck) were prepared at 10 mM in DMSO. Dilutions were made in sea water just before use at the concentration indicated in the text. Embryo staging and neural plate description were performed according to [50,61].
Molecular constructs
We have used several previously reported constructs: pFog>Noggin, pFog>Admp and pFog>Venus [43], pFt>ΔN-β-catenin and p12xTcf>nlsLacZ [40]. The other constructs were generated using dedicated Gateway vectors [76]. The activity of the following promoters has been previously described: pFog (pan-ectodermal from the 16-cell stage) [49], pFt (pan-ectodermal from the 64-cell stage) [40] and pEf1α (ubiquitous from early gastrula stages) [62,63]. While the first two were available in Gateway vectors, the last one was introduced following PCR amplification (Forward primer: AAAAAGCAGGCTTTGCTTTACCATCGCGTGACG, reverse primer: AGAAAGCTGGGTTTTGGAAGGTTGGGGTTAACC) using pSPCiEF1α>Cas9 [77] as a template. We have used entry clones containing the coding sequence of ΔN-β-catenin (generated by a BP reaction from pFt>ΔN-β-catenin [40]), TcfΔC (generated by PCR from pRN3-TcfΔC [25]. Forward primer: AAAAAGCAGGCTCAGAAAAAATGCCTCAGTTAAACTCGGA, reverse primer: AGAAAGCTGGGTTCATGGCCGACTTGGTTTG), Sfrp1/5 (generated by RT-PCR from initial tailbud stages C. robusta RNA. Forward primer: CAGAAAAAATGGGATCGTGGATAAAAGGA, reverse primer: TTATCTCCCAGCAGAACCAGTG) and Wnt5 [78] (clone cien109569).
In situ hybridization, alkaline phosphatase, and X-gal staining
Whole mount in situ hybridization and X-gal staining (detection of β-galactosidase activity following p12xTcf>nlsLacZ electroporation) were performed as previously described [26,79]. Dig-labeled probes were synthesized from C. robusta clones described in previous publications [26,80,81], obtained from cDNA libraries [78,82] or generated by cloning RT-PCR products (from initial tailbud stages embryonic RNA) into pGEM-T Easy (Promega) (S2 Table). Effects on gene expression were analyzed for each marker on 15–40 embryos for inhibitor treatments and 40–70 electroporated embryos (the number of independent experiments is indicated in the figure legend). Embryos treated with DMSO or electroporated with pFog>Venus were used as controls.
Colorimetric detection of endogenous alkaline phosphatase activity was adapted from [13]: embryos were fixed 10 min at room temperature in sea water containing 5% formaldehyde, washed twice 10 min in TMNTw (100 mM NaCl, 50 mM MgCl2, 100 mM Tris pH 9.5, 0.1% Tween20) and stained in TMNTw containing 3.3 μl/ml of NBT (50 mg/ml) and 1.75 μl/ml of BCIP (50 mg/ml).
All pictures were taken from embryos in PBTw using a Zeiss Discovery V20 dissecting scope equipped with an AxioCam ERc5s digital camera. Image panels and figures were constructed with Adobe Photoshop and Adobe Illustrator.
Gene model identifiers
The genes described in this study are represented by the following gene models in the KH2012 C. robusta assembly: genes whose expression has been analyzed by in situ hybridization (see S2 Table), Fog (KH.C10.574), Ft (KH.C11.299), Ef1α (KH.C14.52), Noggin (KH.C12.562), Admp (KH.C2.421), β-catenin (KH.C9.53) Tcf (KH.C6.71), Sfrp1/5 (KH.L171.5), and Wnt5 (KH.L152.45).
Supporting information
S1 Fig. Ectopic endoderm formation following cWnt activation.
Embryos were treated with 10 μM 1-azakenpaullone (AZA) at the stage indicated on the picture and left to develop until late tailbud stages (stages 24/25) when endogenous alkaline phosphatase staining was performed to reveal endoderm formation. Compared to control DMSO-treated embryos (A), 1-azakenpaullone-treated embryos at the 8-cell (B) and the 16-cell (C) stages presented ectopic staining; unstained cells are presumably muscle cells. Later treatments (D-F) did not lead to ectopic endoderm formation although the shape of the embryos was strongly affected. Embryos are oriented with dorsal to the top and anterior to the left. Experiment performed once.
https://doi.org/10.1371/journal.pgen.1008054.s001
(PDF)
S2 Fig. Timing of ectoderm sensitivity to cWnt activation.
Embryos were treated with DMSO (A), 10 μM 1-azakenpaullone (B) or 2.5 μM BIO (C) from initial tailbud stages (stage 17) until fixation at late tailbud stages (stage 24). Expression of Zf115 was determined by in situ hybridization and was found unchanged by activating cWnt. (D-S) Embryos were treated with 10 μM 1-azakenpaullone for 30 minutes at the stage indicated on the left of the figure before being extensively washed in seawater. They were then fixed at late tailbud stages (stage 24) and the expression of Etr (D-K) and Zf115 (L-S) was analyzed by in situ hybridization. Robust ectopic Etr expression in the ventral trunk (white arrowheads) was observed for treatments at stages 10 and 11. Far fewer ectopic Etr positive cells were observed for treatments at stages 12 and 13, and no ectopic staining was observed for later treatments. Anterior palp neuron staining (black arrows) was abolished for all treatments except the last one for which a strong downregulation was observed (H). Zf115 was ectopically expressed in trunk epidermis for all treatments but its anterior limit (red arrow) was shifted posteriorly as the treatment was delayed. The Zf115 negative region in M corresponds to the open neural tube. Embryos are oriented with dorsal to the top and anterior to the left. Experiment performed once.
https://doi.org/10.1371/journal.pgen.1008054.s002
(PDF)
S3 Fig. Effects of activating cWnt using small molecule inhibitors on a collection of markers at early tailbud stages.
Embryos were treated with 10 μM 1-azakenpaullone or 2.5 μM BIO from stage 10 (initial gastrula), fixed at stage 19/20 (early tailbud) and processed for in situ hybridization to determine the expression pattern of the genes indicated on the left of each panel. The embryos presented in Fig 2 are included in this figure. Embryos are oriented with dorsal to the top and anterior to the left. Number of experiments: one for Smad6/7, Nkx-A, Islet, Ror-a, Trp, Mytf, Gbe1, Hox1, KH.C7.391, Hox12, FoxF, Zf115, Bra and Ferritin; two for Klf1/2/4, Msxb, Nk4, Bmp2/4, Otx and Six3/6.
https://doi.org/10.1371/journal.pgen.1008054.s003
(PDF)
S4 Fig. Effects of increasing concentrations of 1-azakenpaullone.
Embryos were treated with various concentrations (indicated on the figure) of 1-azakenpaullone (AZA) from stage 10 (initial gastrula) to early tailbud stages (stages 20/21) for in situ hybridization or swimming larval stages for alkaline phosphatase histochemistry. Embryos are oriented with dorsal to the top and anterior to the left. Experiment performed once.
https://doi.org/10.1371/journal.pgen.1008054.s004
(PDF)
S5 Fig. Overexpression of Wnt5 or ΔN-β-catenin promotes ectopic posterior marker expression in the trunk.
Embryos were electroporated with either pFog>Wnt5 or pFt>ΔN-β-catenin and fixed at early tailbud stages (stages 18/19) to analyze Msxb, Klf1/2/4 and Nkx-C expression by in situ hybridization. In all cases, ectopic expression was detected in the trunk ventral midline (white arrowheads). Experiment performed once for pFog>Wnt5 and twice or more for pFt>ΔN-β-catenin for each probe.
https://doi.org/10.1371/journal.pgen.1008054.s005
(PDF)
S6 Fig. Regulation of Msxb expression by the combined action of Wnt and Bmp signals.
(A) Control unelectroporated embryo. (B-F) Embryos were electroporated with pFog>Noggin (B), pFog>Admp (C), pFt>ΔN-β-catenin (D), pFog>Noggin + pFt>ΔN-β-catenin (E) and pFog>Admp + pFt>ΔN-β-catenin (F), and fixed for in situ hybridization at initial tailbud stages (stage 18) for Msxb. Ectopic staining is highlighted with the white arrowheads. Experiment performed once.
https://doi.org/10.1371/journal.pgen.1008054.s006
(PDF)
S7 Fig. Tail PNS genes require active Wnt signaling.
Embryos were electroporated with pFog>Venus (A, D), pFt>Sfrp1/5 (B, E) and pFog>TcfΔC (C, F), and fixed for in situ hybridization at initial tailbud stages (stage 18) for Nkx-C (A-C) and at early mid tailbud stages (stage 21) for Klf1/2/4 (D-F). Expression of both genes is downregulated when Wnt signaling is inhibited. Embryos are oriented with dorsal to the top and anterior to the left. Experiment performed four times or more for both probes.
https://doi.org/10.1371/journal.pgen.1008054.s007
(PDF)
S8 Fig. Effects of plasmid co-electroporation on gene expression.
Each graph represents a single electroporation experiment analyzed by in situ hybridization for the gene and at the stage indicated at the top. Embryos were scored for change in gene expression pattern as "normal" (blue) or "repression" (grey).
https://doi.org/10.1371/journal.pgen.1008054.s008
(PDF)
S1 Table. cWnt reporter activity.
Embryos were electroporated with the p12xTcf>nlsLacZ reporter construct [40] and fixed at the indicated stage for X-gal staining. Embryos were scored according to the location of the staining.
https://doi.org/10.1371/journal.pgen.1008054.s009
(PDF)
S2 Table. List of cDNA clones used for in situ hybridization.
https://doi.org/10.1371/journal.pgen.1008054.s010
(PDF)
Acknowledgments
We thank the CRBM of the Roscoff marine station (EMBRC-France) for providing animals and N. Trouillard (Banyuls marine station) for taking care of them. We thank Y. Satou, N. Satoh, Y.Kohara, P. Lemaire, U. Rothbächer, C. Hudson, H. Yasuo, R. De Santis and Y. Sasakura for sharing constructs.
References
- 1. Lemaire P. Evolutionary crossroads in developmental biology: the tunicates. Development. 2011;138: 2143–52. pmid:21558365
- 2.
Satoh N. Developmental genomics of ascidians. Hoboken, New Jersey: John Wiley & Sons, Inc; 2014.
- 3. Satoh N, Rokhsar D, Nishikawa T. Chordate evolution and the three-phylum system. Proc R Soc B Biol Sci. 2014;281: 20141729–20141729. pmid:25232138
- 4. Kourakis MJ, Smith WC. An organismal perspective on C. intestinalis development, origins and diversification. eLife. 2015;4: e06024.
- 5. Nishida H. Specification of embryonic axis and mosaic development in ascidians. Dev Dyn. 2005;233: 1177–93. pmid:15973692
- 6. Tassy O, Daian F, Hudson C, Bertrand V, Lemaire P. A quantitative approach to the study of cell shapes and interactions during early chordate embryogenesis. Curr Biol. 2006;16: 345–58. pmid:16488868
- 7. Nishida H, Stach T. Cell Lineages and Fate Maps in Tunicates: Conservation and Modification. Zoolog Sci. 2014;31: 645–652. pmid:25284383
- 8. Logan CY, Nusse R. THE WNT SIGNALING PATHWAY IN DEVELOPMENT AND DISEASE. Annu Rev Cell Dev Biol. 2004;20: 781–810. pmid:15473860
- 9. MacDonald BT, Tamai K, He X. Wnt/β-Catenin Signaling: Components, Mechanisms, and Diseases. Dev Cell. 2009;17: 9–26. pmid:19619488
- 10. Petersen CP, Reddien PW. Wnt signaling and the polarity of the primary body axis. Cell. 2009;139: 1056–68. pmid:20005801
- 11. Niehrs C. On growth and form: a Cartesian coordinate system of Wnt and BMP signaling specifies bilaterian body axes. Development. 2010;137: 845–57. pmid:20179091
- 12. Wikramanayake AH, Huang L, Klein WH. beta-Catenin is essential for patterning the maternally specified animal-vegetal axis in the sea urchin embryo. Proc Natl Acad Sci U A. 1998;95: 9343–8.
- 13. Imai K, Takada N, Satoh N, Satou Y. (beta)-catenin mediates the specification of endoderm cells in ascidian embryos. Development. 2000;127: 3009–20. pmid:10862739
- 14. Henry JQ, Perry KJ, Wever J, Seaver E, Martindale MQ. Beta-catenin is required for the establishment of vegetal embryonic fates in the nemertean, Cerebratulus lacteus. Dev Biol. 2008;317: 368–79. pmid:18387602
- 15. Darras S, Gerhart J, Terasaki M, Kirschner M, Lowe CJ. {beta}-Catenin specifies the endomesoderm and defines the posterior organizer of the hemichordate Saccoglossus kowalevskii. Development. 2011;138: 959–70. pmid:21303849
- 16. Wikramanayake AH, Hong M, Lee PN, Pang K, Byrum CA, Bince JM, et al. An ancient role for nuclear beta-catenin in the evolution of axial polarity and germ layer segregation. Nature. 2003;426: 446–50. pmid:14647383
- 17. Momose T, Houliston E. Two oppositely localised frizzled RNAs as axis determinants in a cnidarian embryo. PLoS Biol. 2007;5: e70. pmid:17355179
- 18. Kiecker C, Niehrs C. A morphogen gradient of Wnt/beta-catenin signalling regulates anteroposterior neural patterning in Xenopus. Development. 2001;128: 4189–201. pmid:11684656
- 19. Nordström U, Jessell TM, Edlund T. Progressive induction of caudal neural character by graded Wnt signaling. Nat Neurosci. 2002;5: 525–532. pmid:12006981
- 20. Lekven AC, Thorpe CJ, Waxman JS, Moon RT. Zebrafish wnt8 encodes two wnt8 proteins on a bicistronic transcript and is required for mesoderm and neurectoderm patterning. Dev Cell. 2001;1: 103–114. pmid:11703928
- 21. Kim S-H, Shin J, Park H-C, Yeo S-Y, Hong S-K, Han S, et al. Specification of an anterior neuroectoderm patterning by Frizzled8a-mediated Wnt8b signalling during late gastrulation in zebrafish. Development. 2002;129: 4443–4455. pmid:12223403
- 22. Darras S, Fritzenwanker JH, Uhlinger KR, Farrelly E, Pani AM, Hurley IA, et al. Anteroposterior axis patterning by early canonical Wnt signaling during hemichordate development. PLOS Biol. 2018;16: e2003698. pmid:29337984
- 23. Martin BL, Kimelman D. Wnt signaling and the evolution of embryonic posterior development. Curr Biol. 2009;19: R215–9. pmid:19278640
- 24. Ikuta T, Satoh N, Saiga H. Limited functions of Hox genes in the larval development of the ascidian Ciona intestinalis. Development. 2010;137: 1505–13. pmid:20335361
- 25. Hudson C, Kawai N, Negishi T, Yasuo H. β-Catenin-driven binary fate specification segregates germ layers in ascidian embryos. Curr Biol CB. 2013;23: 491–495. pmid:23453950
- 26. Hudson C, Lemaire P. Induction of anterior neural fates in the ascidian Ciona intestinalis. Mech Dev. 2001;100: 189–203. pmid:11165477
- 27. Wada S, Katsuyama Y, Saiga H. Anteroposterior patterning of the epidermis by inductive influences from the vegetal hemisphere cells in the ascidian embryo. Development. 1999;126: 4955–63. pmid:10529414
- 28. Lamy C, Rothbacher U, Caillol D, Lemaire P. Ci-FoxA-a is the earliest zygotic determinant of the ascidian anterior ectoderm and directly activates Ci-sFRP1/5. Development. 2006;133: 2835–44. pmid:16835437
- 29. Auger H, Lamy C, Haeussler M, Khoueiry P, Lemaire P, Joly JS. Similar regulatory logic in Ciona intestinalis for two Wnt pathway modulators, ROR and SFRP-1/5. Dev Biol. 2009;329: 364–73. pmid:19248777
- 30. Abitua PB, Wagner E, Navarrete IA, Levine M. Identification of a rudimentary neural crest in a non-vertebrate chordate. Nature. 2012;492: 104–107. pmid:23135395
- 31. Dehal P, Satou Y, Campbell RK, Chapman J, Degnan B, De Tomaso A, et al. The draft genome of Ciona intestinalis: insights into chordate and vertebrate origins. Science. 2002;298: 2157–67. pmid:12481130
- 32. Brunetti R, Gissi C, Pennati R, Caicci F, Gasparini F, Manni L. Morphological evidence that the molecularly determined Ciona intestinalis type A and type B are different species: Ciona robusta and Ciona intestinalis. J Zool Syst Evol Res. 2015;53: 186–193.
- 33. Hino K, Satou Y, Yagi K, Satoh N. A genomewide survey of developmentally relevant genes in Ciona intestinalis. VI. Genes for Wnt, TGFbeta, Hedgehog and JAK/STAT signaling pathways. Dev Genes Evol. 2003;213: 264–72. pmid:12739142
- 34. Blanchoud S, Rutherford K, Zondag L, Gemmell NJ, Wilson MJ. De novo draft assembly of the Botrylloides leachii genome provides further insight into tunicate evolution. Sci Rep. 2018;8: 5518. pmid:29615780
- 35. Somorjai IML, Martí-Solans J, Diaz-Gracia M, Nishida H, Imai KS, Escrivà H, et al. Wnt evolution and function shuffling in liberal and conservative chordate genomes. Genome Biol. 2018;19: 98. pmid:30045756
- 36. Imai KS, Hino K, Yagi K, Satoh N, Satou Y. Gene expression profiles of transcription factors and signaling molecules in the ascidian embryo: towards a comprehensive understanding of gene networks. Development. 2004;131: 4047–58. pmid:15269171
- 37. Imai KS, Levine M, Satoh N, Satou Y. Regulatory blueprint for a chordate embryo. Science. 2006;312: 1183–7. pmid:16728634
- 38. Oda-Ishii I, Kubo A, Kari W, Suzuki N, Rothbächer U, Satou Y. A Maternal System Initiating the Zygotic Developmental Program through Combinatorial Repression in the Ascidian Embryo. PLoS Genet. 2016;12: e1006045. pmid:27152625
- 39. Yagi K, Satoh N, Satou Y. Identification of downstream genes of the ascidian muscle determinant gene Ci-macho1. Dev Biol. 2004;274: 478–489. pmid:15385173
- 40. Pasini A, Manenti R, Rothbacher U, Lemaire P. Antagonizing retinoic acid and FGF/MAPK pathways control posterior body patterning in the invertebrate chordate Ciona intestinalis. PLoS ONE. 2012;7: e46193. pmid:23049976
- 41. Meijer L, Skaltsounis A-L, Magiatis P, Polychronopoulos P, Knockaert M, Leost M, et al. GSK-3-Selective Inhibitors Derived from Tyrian Purple Indirubins. Chem Biol. 2003;10: 1255–1266. pmid:14700633
- 42. Kunick C, Lauenroth K, Leost M, Meijer L, Lemcke T. 1-Azakenpaullone is a selective inhibitor of glycogen synthase kinase-3 beta. Bioorg Med Chem Lett. 2004;14: 413–6. pmid:14698171
- 43. Pasini A, Amiel A, Rothbacher U, Roure A, Lemaire P, Darras S. Formation of the Ascidian Epidermal Sensory Neurons: Insights into the Origin of the Chordate Peripheral Nervous System. PLoS Biol. 2006;4: e225. pmid:16787106
- 44. Miwata K, Chiba T, Horii R, Yamada L, Kubo A, Miyamura D, et al. Systematic analysis of embryonic expression profiles of zinc finger genes in Ciona intestinalis. Dev Biol. 2006;292: 546–54. pmid:16519883
- 45. Roure A, Darras S. Msxb is a core component of the genetic circuitry specifying the dorsal and ventral neurogenic midlines in the ascidian embryo. Dev Biol. 2016;409: 277–287. pmid:26592100
- 46. Waki K, Imai KS, Satou Y. Genetic pathways for differentiation of the peripheral nervous system in ascidians. Nat Commun. 2015;6: 8719. pmid:26515371
- 47. Martin BL, Kimelman D. Canonical Wnt Signaling Dynamically Controls Multiple Stem Cell Fate Decisions during Vertebrate Body Formation. Dev Cell. 2012;22: 223–232. pmid:22264734
- 48. Kawano Y, Kypta R. Secreted antagonists of the Wnt signalling pathway. J Cell Sci. 2003;116: 2627–2634. pmid:12775774
- 49. Rothbacher U, Bertrand V, Lamy C, Lemaire P. A combinatorial code of maternal GATA, Ets and beta-catenin-TCF transcription factors specifies and patterns the early ascidian ectoderm. Development. 2007;134: 4023–32. pmid:17965050
- 50. Nicol D, Meinertzhagen IA. Development of the central nervous system of the larva of the ascidian, Ciona intestinalis L: I. The early lineages of the neural plate. Dev Biol. 1988;130: 721–736. pmid:3197929
- 51. Abitua PB, Gainous TB, Kaczmarczyk AN, Winchell CJ, Hudson C, Kamata K, et al. The pre-vertebrate origins of neurogenic placodes. Nature. 2015;524: 462–465. pmid:26258298
- 52. Horie R, Hazbun A, Chen K, Cao C, Levine M, Horie T. Shared evolutionary origin of vertebrate neural crest and cranial placodes. Nature. 2018;560: 228–232. pmid:30069052
- 53. Kimelman D, Griffin KJ. Vertebrate mesendoderm induction and patterning. Curr Opin Genet Dev. 2000;10: 350–6. pmid:10889062
- 54. Zorn AM, Wells JM. Vertebrate Endoderm Development and Organ Formation. Annu Rev Cell Dev Biol. 2009;25: 221–251. pmid:19575677
- 55. Range R. Specification and positioning of the anterior neuroectoderm in deuterostome embryos: Wnts and Anterior Neuroectoderm Positioning. genesis. 2014;52: 222–234. pmid:24549984
- 56. Schier AF, Talbot WS. Molecular genetics of axis formation in zebrafish. Annu Rev Genet. 2005;39: 561–613. pmid:16285872
- 57. Onai T, Lin HC, Schubert M, Koop D, Osborne PW, Alvarez S, et al. Retinoic acid and Wnt/beta-catenin have complementary roles in anterior/posterior patterning embryos of the basal chordate amphioxus. Dev Biol. 2009;332: 223–33. pmid:19497318
- 58. Range RC, Angerer RC, Angerer LM. Integration of Canonical and Noncanonical Wnt Signaling Pathways Patterns the Neuroectoderm Along the Anterior–Posterior Axis of Sea Urchin Embryos. Niehrs C, editor. PLoS Biol. 2013;11: e1001467. pmid:23335859
- 59. Onai T, Akira Takai, Setiamarga DHE, Holland LZ. Essential role of Dkk3 for head formation by inhibiting Wnt/β-catenin and Nodal/Vg1 signaling pathways in the basal chordate amphioxus: Axial patterning in amphioxus. Evol Dev. 2012;14: 338–350. pmid:22765205
- 60. McIntyre DC, Seay NW, Croce JC, McClay DR. Short-range Wnt5 signaling initiates specification of sea urchin posterior ectoderm. Development. 2013;140: 4881–4889. pmid:24227654
- 61. Hotta K, Mitsuhara K, Takahashi H, Inaba K, Oka K, Gojobori T, et al. A web-based interactive developmental table for the ascidian Ciona intestinalis, including 3D real-image embryo reconstructions: I. From fertilized egg to hatching larva. Dev Dyn. 2007;236: 1790–1805. pmid:17557317
- 62. Sasakura Y, Suzuki MM, Hozumi A, Inaba K, Satoh N. Maternal factor-mediated epigenetic gene silencing in the ascidian Ciona intestinalis. Mol Genet Genomics. 2010;283: 99–110. pmid:19946786
- 63. Stolfi A, Gandhi S, Salek F, Christiaen L. Tissue-specific genome editing in Ciona embryos by CRISPR/Cas9. Development. 2014;141: 4115–4120. pmid:25336740
- 64. Carron C, Shi D-L. Specification of anteroposterior axis by combinatorial signaling during Xenopus development. Wiley Interdiscip Rev Dev Biol. 2016;5: 150–168. pmid:26544673
- 65. Wurst W, Bally-Cuif L. Neural plate patterning: Upstream and downstream of the isthmic organizer. Nat Rev Neurosci. 2001;2: 99–108. pmid:11253000
- 66. Vieira C, Pombero A, Garcia-Lopez R, Gimeno L, Echevarria D, Marti-nez S. Molecular mechanisms controlling brain development: an overview of neuroepithelial secondary organizers. Int J Dev Biol. 2009;54: 7–20. pmid:19876817
- 67. Imai KS, Stolfi A, Levine M, Satou Y. Gene regulatory networks underlying the compartmentalization of the Ciona central nervous system. Development. 2009;136: 285–93. pmid:19088089
- 68. Wagner E, Levine M. FGF signaling establishes the anterior border of the Ciona neural tube. Dev Camb Engl. 2012;139: 2351–2359. pmid:22627287
- 69. Hudson C. The central nervous system of ascidian larvae: Nervous system development in ascidians. Wiley Interdiscip Rev Dev Biol. 2016;5: 538–561. pmid:27328318
- 70. Squarzoni P, Parveen F, Zanetti L, Ristoratore F, Spagnuolo A. FGF/MAPK/Ets signaling renders pigment cell precursors competent to respond to Wnt signal by directly controlling Ci-Tcf transcription. Development. 2011;138: 1421–1432. pmid:21385767
- 71. Rose SM. Embryonic induction in the ascidia. Biol Bull. 1939;77: 216–232.
- 72. Roure A, Lemaire P, Darras S. An Otx/Nodal Regulatory Signature for Posterior Neural Development in Ascidians. Desplan C, editor. PLoS Genet. 2014;10: e1004548. pmid:25121599
- 73. Akanuma T, Hori S, Darras S, Nishida H. Notch signaling is involved in nervous system formation in ascidian embryos. Dev Genes Evol. 2002;212: 459–72. pmid:12424517
- 74. Chen JS, Pedro MS, Zeller RW. miR-124 function during Ciona intestinalis neuronal development includes extensive interaction with the Notch signaling pathway. Dev Camb Engl. 2011;138: 4943–4953. pmid:22028027
- 75. Joyce Tang W, Chen JS, Zeller RW. Transcriptional regulation of the peripheral nervous system in Ciona intestinalis. Dev Biol. 2013;378: 183–193. pmid:23545329
- 76. Roure A, Rothbacher U, Robin F, Kalmar E, Ferone G, Lamy C, et al. A multicassette Gateway vector set for high throughput and comparative analyses in ciona and vertebrate embryos. PLoS ONE. 2007;2: e916. pmid:17878951
- 77. Sasaki H, Yoshida K, Hozumi A, Sasakura Y. CRISPR/Cas9-mediated gene knockout in the ascidian Ciona intestinalis. Dev Growth Differ. 2014;56: 499–510. pmid:25212715
- 78. Gilchrist MJ, Sobral D, Khoueiry P, Daian F, Laporte B, Patrushev I, et al. A pipeline for the systematic identification of non-redundant full-ORF cDNAs for polymorphic and evolutionary divergent genomes: Application to the ascidian Ciona intestinalis. Dev Biol. 2015;404: 149–163. pmid:26025923
- 79. Bertrand V, Hudson C, Caillol D, Popovici C, Lemaire P. Neural tissue in ascidian embryos is induced by FGF9/16/20, acting via a combination of maternal GATA and Ets transcription factors. Cell. 2003;115: 615–27. pmid:14651852
- 80. Corbo JC, Levine M, Zeller RW. Characterization of a notochord-specific enhancer from the Brachyury promoter region of the ascidian, Ciona intestinalis. Development. 1997;124: 589–602. pmid:9043074
- 81. Giuliano P, Marino R, Pinto MR, De Santis R. Identification and developmental expression of Ci-isl, a homologue of vertebrate islet genes, in the ascidian Ciona intestinalis. Mech Dev. 1998;78: 199–202. pmid:9858732
- 82. Satou Y, Takatori N, Fujiwara S, Nishikata T, Saiga H, Kusakabe T, et al. Ciona intestinalis cDNA projects: expressed sequence tag analyses and gene expression profiles during embryogenesis. Gene. 2002;287: 83–96. pmid:11992726