Mice, parasites and cell lines

In this work, different groups of inbred mice from the BALB/c and C3H/HeN strains were used for immunization protocols. Mice breeding was carried out in the animal facilities of the “Instituto de Microbiología y Parasitología Médica” (IMPaM, UBA-CONICET). Experiments with animals were approved by the Review Board of Ethics of the School of Medicine (UBA, Argentina) and conducted in accordance with the guidelines established by the National Research Council [9]. Animal sample size was estimated by a power-based method [10].

T. cruzi bloodstream trypomastigotes (from RA, K98 or β-galactosidase- expressing Tulahuen strains) were obtained from blood of CF1 infected mice. Culture-derived epimastigotes were used to obtain the soluble fraction of a parasite lysate (F105) as described [11].

BHK-21 (ATCC CCL-10) cells were used to induce rTc80 expression on eukaryotic cells and Vero cells (ATCC CCL-81) were used for T. cruzi in vitro infection. Both cell lines were maintained in RPMI 1640 medium (Gibco) and routinely tested for Mycoplasma spp. infection with DAPI stain.

Tc80 cloning, expression and purification

Tc80 gene was amplified by PCR from genomic DNA of T. cruzi strain RA as described [8]. For expression in bacteria, the forward primer (5’- GAGCCATATGCGCAGCGTTTACCC-3’) included NdeI restriction site (underlined) and the translation start codon (ATG, bold). Reverse primer (5’-GATACTCGAGTCAGTGATGGTGATGGTGATGCTCTTTCCACGAAGCATTGA-3’) included XhoI restriction site (underlined), translation stop codon (bold) and 6 his tag coding sequence (bold and underlined). Tc80 amplicon was cloned in the expression vector pET23a⁺ and the construct was used for transforming chemically competent Escherichia coli BL21 (DE3).

Recombinant Tc80 (rTc80) was induced for 18 h with 0.5 mM isopropyl-β-D-thiogalactopyranoside at 20°C and then purified in native conditions with a Ni²⁺-NTA-agarose resin. Purified rTc80 was dialyzed against phosphate-buffered saline (PBS) with 10% glycerol and LPS was removed with polimixin B-agarose (Sigma). Residual LPS was determined using HEK-Blue LPS Detection Kit (Invivogen) and it presented a concentration below the quantification limit: 0.3 ng/ml.

Additionally, for DNA vaccination, Tc80 gene was cloned in the eukaryotic plasmid pcDNA3.1⁺. In this case, the amplification was performed with the followings primers: forward primer: 5’-GAATAAGCTTGCCACCATGCGCAGCGTTTACCC-3’, including HindIII restriction site (underlined), the kozak sequence (double underlined) and the translation start codon (ATG, bold). The reverse primer: 5’-GCTCCTCGAGTCACTCTTTCCACGAAGCATTGA-3’ contained a XhoI restriction site (underlined) and the translation stop codon (bold). Tc80-pcDNA3.1 plasmid was used for transforming electrocompetent bacteria Salmonella enterica serovar Typhimurium aroA SL7207 which were used as DNA-delivery system.

PCRs were performed with ZymoTaq DNA polymerase (Zymo Research) with an initial denaturation 95°C for 5 min, 30 cycles of denaturation (95°C, 1 min)–annealing (59.3°C, 1 min)–extension (72°C, 2 min) and a final extension 72°C, 10 min.

Immunization protocols

Four groups of 7-week-old C3H/HeN (H2-K^k haplotype) mice (n = 5–6 animals per group) were immunized with four doses separated by ten days. Group I (GI): rTc80im, was immunized intramuscularly in the quadriceps muscles with 10 μg of rTc80 adjuvanted with 10 μg of ODN-CpG 1826 (Invivogen). GII: STc80, received 4 doses of attenuated Salmonella carrying a Tc80-coding eukaryotic plasmid via oral (1x10⁹ CFU/mouse). GIII: Prime boost group (Pboost) was a combination of the two previous groups. Animals received two doses of Tc80 DNA delivered by the attenuated Salmonella (1x10⁹ CFU/mouse) followed by two doses of 10 μg rTc80 + 10 μg CpG-ODN by intramuscular route. As control group (SaroA), mice were intramuscularly injected twice with PBS + 10 μg CpG-ODN and then two doses of attenuated Salmonella carrying an empty plasmid pcDNA3.1 by oral route [12].

Enzyme-linked immunosorbent assay (ELISA) for determination of Tc80-specific antibody titers

Tc80-specific antibody titers (IgG, IgG₁ and IgG_2a) were determined as previously described [13]. Briefly, 96-well polyvinyl chloride plates (Nunc, Thermo Scientific) were coated with 0.2 μg rTc80/well for 1 h at 37°C. Then, non-specific binding sites were blocked with 3% BSA in PBS for 2 h at 37°C. Plates were washed three times with 0.05% Tween-20 in PBS and two-fold serial dilutions (in 1% BSA-PBS) of immunized or T. cruzi infected mice sera were added and incubated for overnight at 4°C. Next day, 3 washes were performed and anti-IgG-HRP (Sigma B6398) antibody (1/10000 dilution), or biotin-conjugated anti-IgG1 or anti-IgG2a antibody (Pharmingen Becton Dickinson) diluted 1/2000, were added as secondary antibodies and incubated for 1 h at 37°C. When biotinylated antibodies were used, an additional incubation with streptavidin-HRP (BD Biosciences) was carried out at 37°C for 30 min. Reactions were revealed with TMB (tetramethylbenzidine, BD OptEIA) and stopped with 4 N H₂SO₄. Absorbance at 450 nm was determined on an ELISA plate reader (Labsystems Multiscan EX). Antibody end-point titer was calculated as the reciprocal of the dilution with a DO_450nm = 0.5

Evaluation of cell invasion inhibition by Tc80-specific antibodies

The ability of rTc80-specific antibodies to block parasite infection was assessed as previously described [14]. Briefly, T. cruzi blood trypomastigotes (Tulahuen strain) expressing E. coli β-galactosidase were pre-incubated with the sera of immunized mice (1/10 dilution) and subsequently used to infect Vero cells (5x10⁴ parasites/5x10³ cells). After an overnight incubation at 37°C, 5% CO_2, cells were washed with PBS to remove non-infecting trypomastigotes and the culture was maintained for 4 more days. Cells were lysed with Nonidet P40 (1% v/v) and β-galactosidase activity was spetrophotometrically measured against the chromogenic substrate chlorophenol red β-D-galactopyranoside (CPRG). Inhibition percentage was calculated as follows: {1 - [(ABS_595nm of cells infected with parasites in presence of immunized mice serum)/(ABS_595nm of cells infected with parasites in presence of non-immunized mice serum)]} x 100.

Enzymatic activity inhibition assay

Recombinant Tc80 (4 nM) was pre-incubated with 1/10 dilutions of sera from immunized mice. Then, residual prolyl oligopeptidase activity was determined in the presence of the dipeptide Z-Gly-Pro-AMC (Bachem), the fluorogenic substrate. The formation of the 7-amino-4-methyl coumarin (AMC) product was monitored by fluorometry (λ_excitation = 355 nm and λ_emission = 460 nm). Reactions were carried out at 37°C in a final volume of 100 μl reaction buffer (25 mM Tris, 250 mM NaCl, 2.5 mM DTT, pH 7.5) in a 96-well black plate (Costar Corning). Fluorescence measurements were made on a PerkinElmer Victor³ fluorimeter.

The AMC formation was recorded over time in relative fluorescence units (RFU) and the slope (ΔRFU/Δtime) from the linear region of the curve was used for the calculation of initial reaction velocity (Vi).

Intracellular cytokine staining

Splenocytes from immunized mice (1x10⁶/200 μL) were incubated in the presence or absence of rTc80 (10 μg/ml) with complete RPMI medium in 96-well U-bottom plates. After 4 h of incubation, brefeldin A was added at 10 μg/ml and 12 h later, surface and intracellular cytokine staining was carried out.

Splenocytes were incubated with an APC-labeled anti-mouse CD4 antibody (eBioscience Inc.) for 45 min at 4°C, fixed with 2% PFA for 15 min at RT and incubated for 45 min at 4°C in permeabilization buffer with PE-labeled anti-IFN-γ and PE-Cy7-labeled anti-TNF-α antibodies (eBioscience Inc).

To perform suitable data acquisition and analysis, autofluorescence, single-stained and FMO (fluorescence minus one) controls were included. Stained cells were passed through the BD FACSaria II flow cytometer.

Ex-vivo cytotoxicity assay

Cytotoxic ability of splenocytes from immunized mice (effector cells) to induce death on cells loaded with a Tc80 peptide (target cells) was studied. For target cells preparation, spleen cells from non-immunized C3H/HeN mice were incubated in the presence of 10 μM Tc80 peptide SEAELRKKI (H-2K^k) or a non-related peptide to Tc80 sequence (AEEAFRLSV) [15] for 4 h at 4°C. These cells were washed with PBS and stained with 5 μM CFSE (CellTrace CFSE, Invitrogen) as described by manufacturer. Effector cells (1x10⁶) obtained from immunized mice were co-incubated with 1x10⁵ target cells for 4 h at 37°C and 5% CO₂. Finally, the cells were washed with PBS and stained with 5 μg/ml propidium iodide (PI) to assess target cell death by flow cytometry (CFSE⁺PI ⁺ cells).

The percentage of specific death was calculated with the following formula [16]:

In-vivo cytotoxicity assay

Spleen cells from non-immunized C3H/HeN mice were incubated for 4 h at 4°C with Tc80 peptide (10 μM) and stained with 8 μM CFSE (CFSE_high population). Another group of splenocytes was loaded with a non-related peptide (AEEAFRLSV) and was stained with 3 μM CFSE (CFSE_low population). Equal amounts of both populations were mixed and 2x10⁷ cells were intravenously injected into immunized C3H/HeN mice in a volume of 100 μl. After 18 h, the splenectomy was performed, the spleens were disrupted and the splenocytes suspension was analyzed by flow cytometry (BD FACScanto).

The calculation of the specific lysis was done with the following formula[17]:

Lethal challenge with T. cruzi

Two weeks after last immunization, immunized female C3H/HeN mice were challenged intraperitoneally with 200 blood trypomastigotes of T. cruzi strain RA. Parasitemia was monitored by counting blood parasites every 2–3 days in a Neubauer chamber. For this purpose, a 1/5 dilution of blood in lysis buffer (0.75% NH4Cl, 0.2% Tris, pH 7.2) was made. Mice deaths were daily recorded.

Vaccine efficacy in a sub-lethal challenge

Two weeks after the last dose of vaccination protocols, immunized male C3H/HeN mice were challenged intraperitoneally with 2.5x10⁵ blood trypomastigotes of the sub-lethal T. cruzi strain K98. Parasitemias were recorded weekly during the acute phase. At 100 days post-infection (dpi), different parameters of disease outcome were assessed.

Serum levels of myopathy-associated enzymes

Target tissue damage was assessed at 100 dpi by determining serum activity of the creatine kinase (CK) and its cardiac isoform (CK-MB), glutamate oxalacetate transaminase (GOT), and lactate dehydrogenase (LDH). Enzyme activity determinations were performed by spectrophotometry at 340 nm with commercial kits following the instructions given by the manufacturer (Wiener Lab). Results were expressed as absorbance variation per minute (ΔABS/min).

Electrocardiograms (ECG)

Immunized and subsequently infected mice were anesthetized with ketamine-xylazine (100 mg ketamine and 16 mg xylazine/kg mouse) at 100 dpi and heart electrical activity was recorded with a Temis TM-300-V electrocardiograph. Corrected QT interval was calculated by the Bazett formula adapted for mouse [18].

Histological analysis of target tissues

At 100 dpi, skeletal (quadriceps) and heart muscles from immunized and subsequently infected mice were dissected and fixed with 4% formalin in PBS. Then the material was embedded in paraffin, sectioned and stained with hematoxylin and eosin. Finally, 10 microscopic fields (100x magnification) were analyzed in 10 sections of each sample. Inflammation was qualitatively evaluated according to the number and spreading of inflammatory foci. Samples were classified with the following score: (+) isolated foci; (++) multiple non-confluent foci; (+++) multiple confluent foci; and (++++) multiple diffuse foci [19,20].

Quantitative PCR (qPCR) for parasite burden

Parasite burden in skeletal (quadriceps) and heart muscle at 100 dpi was determined as described by Cummings et al. [21]. Briefly, total DNA was extracted from about 50–100 mg of muscle using a phenol-chloroform-isoamyl alcohol mixture (25:24:1 v/v, QuickDNA, Kalium Technologies). DNA concentration was adjusted to 25 ng/μL and it was used as template for DNA amplification with T. cruzi-specific primers (Pf: 5’- GGCGGATCGTTTTCGAG -3’, Pr: 5’- AAGCGGATAGTTCAGGG -3’). Samples were also amplified with mouse TNF-α-specific primers as normalizer gene (Pf: 5’- TCCCTCTCATCAGTTCTATGGCCCA -3’, Pr: 5’- CAGCAAGCATCTATGCACTTAGACCCC -3’). PCR reaction was performed using HOT FIREPol EvaGreen qPCR Mix Plus (Solis Biodyne).

To make the standard for parasite burden quantification, about 500 mg of muscle of non-infected mouse were mixed with 1x10⁸ T. cruzi epimastigotes. Total DNA was extracted and the concentration was also adjusted to 25 ng/μL. To construct standard curve, ten-fold serial dilution of the standard were made using non-infected mice muscle DNA (25 ng/μL) as diluent. Parasite burden was expressed as parasite equivalent/50 ng of total DNA.

Statistical analysis

Statistical analysis was performed using 1-way ANOVA along with the post-tests indicated in each trial. The homogeneity of variances was validated using the Levene test. Normality was verified using the Shapiro-Wilks test. The log-rank test (Mantel-Cox) was used to analyze the survival curves using the Prism 6.0 program (GraphPad, San Diego, CA). The statistical analyses were referred to the control group of each experiment, except when indicated. Values of p < 0.05 were considered significant.

Recombinant Tc80 expression

Tc80 gene was cloned in pET23a+ plasmid and the construct was used to transform E. coli BL21 (DE). Bacterial rTc80 expression was induced O.N. and the protein was purified with a Ni²⁺-NTA agarose resin (Fig 1A). As shown in Fig 1B, the recombinant protein showed prolyl oligopeptidase activity. The identity of the protein was confirmed by immunoblot, as rTc80-specific polyclonal antibody recognized the native protein in a parasite lysate (Fig 1C).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 1. Recombinant Tc80 expression, purification and characterization.

a) SDS-PAGE analysis of rTc80 expression and purification. Lane 1: MWM, lane 2: post-induction E. coli lysate, lane 3: Ni⁺⁺-NTA column flow through, lane 4: column wash, lanes 5–7: column rTc80 elution steps. b) Prolyl oligopeptidase activity against the substrate Z-Gly-Pro-AMC measured as relative fluorescent units (RFU) in the presence (red circles) or absence (green squares) of rTc80. A control without substrate was included (blue triangles). c) Immunoblot detection of rTc80 (lane 2) and native Tc80 in an epimastigote T. cruzi lysate (lane 3). Protein were transferred to a PVDF membrane and subsequently incubated with mouse anti-rTc80 antibodies and a peroxidase-conjugated anti-mouse IgG antibody. Lane 1: pre-stained MWM, lane 2: Purified rTc80 revealed with 4-Cl naphthol and lane 3: Native Tc80 revealed with an ECL substrate. d) Indirect immunofluorescence on BHK-21 cells transfected with Tc80-pcDNA3.1⁺ construction (I) or empty pcDNA3.1⁺ (II). Cells were permeabilized and incubated with mouse anti-rTc80 antibodies and subsequently with FITC-conjugated anti mouse IgG antibody.

https://doi.org/10.1371/journal.pntd.0006384.g001

To obtain a DNA vaccine for expression in mammals, the Tc80 gene was also cloned in the eukaryotic expression vector pcDNA3.1⁺_. After transfection of BHK21 cells with this construction, the recombinant protein was evidenced in an indirect immunofluorescence assay (Fig 1D).

Immunization with rTc80 plus CpG ODNs elicited a potent humoral immune response

To analyze the humoral immunity triggered by the immunization protocols, Tc80-specific antibody titers in serum were determined by ELISA at day 15 after last immunization dose. We observed that mice immunized at least twice with the recombinant protein (rTc80im and Pboost group) elicited antibody titers considerably higher than control group (SaroA) (p<0.001). By contrast, STc80 group which was immunized only with Tc80 DNA carried by Salmonella, did not elicit significant specific antibody titer comparing to SaroA (Fig 2A). Besides, antibodies isotypes reflected a Th1-biased response since IgG_2a levels were higher than IgG₁ (Fig 2B). Interestingly, Pboost group showed an IgG2a/IgG1 ratio about 25-fold higher than rTc80im group, indicating that STc80 priming accentuated the bias towards a Th1 response.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 2. Humoral immune response and functionality of anti-rTc80 antibodies.

a) ELISA for IgG anti-rTc80. Titer was calculated as the reciprocal of the dilution with a DO_450nm = 0.5. b) Tc80-specific IgG_2a/IgG₁ titer ratio determined by indirect ELISA using an isotype-specific secondary antibody. c) Biotin-Streptavidin amplification ELISA for rTc80-sepecific antibodies detection in STc80 group. d) Neutralization of T. cruzi non-phagocytic cell infection by sera from immunized mice. e) Prolyl oligopeptidase activity inhibition by rTc80-specific antibodies. f) Ability of Tc80-specific antibodies to mediate complement-dependent cytotoxicity (CDC). The percentage of lysis was calculated as {1 - [(No. of live parasites pre-incubated with sera from immunized mice)/(No. of live parasites pre-incubated with normal mouse serum)]} × 100. Results are expressed as mean ± SEM (n = 5–6 per group) and are representative of at least three independent experiments. *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001. One-way ANOVA plus Dunnett’s post-test(a, d, e, f) and Student’s t-test (b, c).

https://doi.org/10.1371/journal.pntd.0006384.g002

Antibodies against rTc80 in STc80 group were only differentiated from control in an ELISA using a biotin-streptavidin signal amplification (Fig 2C). This observation is concordant with our previous experience in DNA immunization with attenuated Salmonella as carrier, that showed detectable, functional, but modest titers of specific antibodies [22,23].

Antibodies anti-rTc80 mediated different functions for effective parasite control

As the antigen-specific B-cell response plays a role in protection [24,25], we assessed not only the magnitude but also the functionality of antibodies from immunized animals.

Neutralization of trypomastigotes cell infection was detected in sera from all vaccinated animals (Fig 2D). However, higher neutralization capacity was observed in rTc80im and Pboost groups that showed greater antibody titers. These groups were able to block nearly 50% of T. cruzi infection (Fig 2D). Moreover, anti-Tc80 antibodies from immunized animals were able to inhibit almost a 100% of the prolyl-oligopeptidase enzyme activity (Fig 2E), a fact that also correlated with the level of Tc80-specific antibodies.

Furthermore, antibodies from all the immunized mice were able to trigger trypomastigotes lysis in a complement-dependent cytotoxicity assay. Nearly 40% of parasite lysis was detected upon addition of a complement source independently of the vaccination protocol (Fig 2F).

Immunization with STc80 triggered a strong antigen-specific cell-mediated immune response

To assess in vivo cell-mediated immunity, a delayed-type hypersensitivity (DTH) reaction was carried out on mice footpad. We found that all immunized groups developed a strong antigen-specific cellular response compared with SaroA control group. Among them, STc80 group showed the highest DTH reaction (Fig 3A). This result correlated with the proliferation of spleen cells that was evaluated ex vivo upon antigen re-stimulation where a similar pattern was obtained with STc80 group showing the highest response (Fig 3B).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 3. Overall cell-mediated immune response and CD4⁺ cells functionality in immunized mice.

a) DTH reaction. Fifteen days after the last immunization, mice were subcutaneously injected in the hind footpad with rTc80. Footpad thickness was measured before and 48 h after rTc80 administration. The result was expressed as the difference between the two measurements. b) Antigen-specific proliferation. Splenocytes from immunized mice were stimulated with rTc80 and proliferation was assessed by 3H-thymidine uptake. Results were expressed as proliferation index: [cpm (counts per minute) in the presence of the antigen/cpm in the absence of the antigen]. c) Cytokines secretion by splenocytes from immunized mice upon antigen recall (I) IL-2 and (II) IFN-γ, determined by capture ELISA. d) Representative dot plots of intracellular cytokine production by CD4⁺ T cells. (I); Percentage of IFN-γ (II) or TNF-α (III) producing CD4⁺ cells. e) Analysis of CD4⁺ T cells polyfunctionality. I) Percentage of CD4⁺ T cells producing simultaneously IFN-γ and TNF-α. II) Proportion of CD4⁺ T cells with different degrees of functionality. f) Cytokine producing ability of mono and polyfunctional CD4⁺ cells for IFN-γ (I) and TNF-α (II), expressed as mean fluorescence intensity (MFI). Results are expressed as mean ± SEM (n = 5–6 per group) and are representative of at least three independent experiments. *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001. One-way ANOVA plus Tukey’s post-test (a-e) and Student’s t-test (f).

https://doi.org/10.1371/journal.pntd.0006384.g003

Furthermore, splenocytes from all immunized mice were able to secrete IL-2 and IFN-γ upon antigen recall, being these differences significant in STc80 and Pboost compared with SaroA (Fig 3C-I and II).

STc80 immunization stimulated the generation of polyfunctional CD4⁺ T cells

By flow cytometric analysis we found that all immunized groups presented a higher percentage of IFN-γ or TNF-α producing CD4⁺ T cells compared with SaroA group, though it was only significantly higher only in STc80 (Fig 3D). Moreover, the frequency of antigen-specific polyfunctional CD4⁺ cells that simultaneously produced both IFN-γ and TNF-α was significantly increased in STc80 group (Fig 3E-I), representing more than 60% percent of the cytokine-producing cells within this group (Fig 3E-II). These polyfunctional populations were also associated with a high extent of cytokine production compared with single cytokine-producing cells (Fig 3F). In that way, mean fluorescent intensity (MFI) of IFN-γ channel indicates that double positive CD4⁺ lymphocytes produced 2 times more IFN-γ compared to that of single positive cells. Similarly, a 300-fold increase was detected in the TNF-α production of these cells.

Immunized mice showed CTL activity against target cells presenting a Tc80 epitope

In order to assess the immune response mediated by cytotoxic T lymphocytes (CTL), we searched for Tc80 H2-K^k epitopes with different algorithms: SYFPEITHI [26], RANKPEP [27–29] and IEDB [30]. From peptide prediction results (S1 Dataset) we selected and synthesized the one with the highest MHC-I binding score: SEAELRKKI.

CTL activity against the predicted H-2K^k nonapeptide was then evaluated ex vivo and in vivo. In the ex vivo approach, splenocytes from immunized mice induced death of target cells loaded with Tc80 peptide. We observed that the cytotoxic activity of STc80 group was significantly higher than the control group (Fig 4A). This result was further confirmed with an in vivo citotoxicity assay. Nonapeptide-pulsed and CFSE-labelled target cells were transferred to immunized mice and 16 h later, specific cell lysis was evaluated in the spleen by flow cytometry. Vaccinated mice presented higher in vivo CTL activity compared to control group since immunized animals showed a reduced frequency of peptide-pulsed cell population (CFSE_high) with respect to the non-specific lysis subset (CFSE_low) (Fig 4B-I). Similar to what we observed for the CD4⁺ population, STc80 group presented the highest level of CTL functionality between immunized animals (Fig 4B-II). Taken together, these results show that immunization with the Tc80 antigen was able to elicited specific CTL response that may contribute to the elimination of T. cruzi infected cells.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 4. Tc80-specific CTL activity in immunized mice.

a) Ex vivo CTL activity. Splenocytes from immunized mice were incubated with cells loaded with the SEAELRKKI peptide (target cells, CFSE⁺). Later on, cell death was assessed with propidium iodide by flow cytometry and lysis percentage was calculated according to the following formula: {[(%CFSE⁺PI⁺/CFSE⁺)_loaded/(%CFSE⁺PI⁺/CFSE⁺)_non-loaded]-1}*100. b) In vivo CTL activity. Nonapeptide-pulsed and CFSE_high-labelled target cells were transferred to immunized mice and 16 h later, target cell lysis was evaluated in splenocytes by flow cytometry. Mice were also administered with non-loaded and CFSE_low-labelled cells for non-specific cell lysis control. (I) Representative histograms gated on CFSE positive cells showing CFSE_low and CFSE_high populations and (II) bar chart expressing the percentage of lysis as {1-[(%CFSE_high/%CFSE_low)_immunized/(%CFSE_high/%CFSE_low)_SaroA]}*100. Results are expressed as mean ± SEM (n = 4–5 per group) and are representative of three independent experiments. *p<0.05. One-way ANOVA plus Dunnett’s post-test.

https://doi.org/10.1371/journal.pntd.0006384.g004

Tc80 immunization conferred protection against a lethal T. cruzi challenge

To evaluate if the immunization protocols were able to confer protection, vaccinated mice were challenged with the highly virulent T. cruzi RA strain. All immunized mice presented significantly reduced parasitemias during the acute phase of infection compared to the control (Fig 5A) and this was reflected in a 3-fold reduction of the areas under the curve (Fig 5B). We observed that on the early acute phase (9 dpi) rTc80im group achieved the highest control of parasitemia. By contrast, at 23 dpi when most of the control animals died, parasitemias were significantly lower in STc80 and Pboost compared with rTc80im (Fig 5C).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 5. Protection against a lethal T. cruzi challenge.

a) Parasitemia curve at different days post-infection (dpi) and b) area under the curves (AUC) of parasitemia. c) Parasitemia at early (9 dpi) and late (23 dpi) stages of acute infection. d) Survival rate curve. Results are expressed as mean ± SEM (n = 4–5 per group) and are representative of at least three independent experiments. *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001. One-way ANOVA plus Dunnett’s post-test(a, b) or Tukey’s post-test (c) and log-rank test for survival curves (d). Color code from panel ‘a’ legend is also used in the other panels (b, c, d).

https://doi.org/10.1371/journal.pntd.0006384.g005

More important, all vaccinated mice had an increased in the survival rate compared with SaroA group. Specifically, those mice immunized with at least 2 doses of Salmonella sp. carrying the Tc80 gene presented a higher survival rate at 23 dpi: 80% and 67% for STc80 and Pboost, respectively (Fig 5D).

Tc80-based vaccine prevented chronic disease-associated damages

As T. cruzi is able to persist, even in vaccinated animals, the ability of the Tc80-based vaccine to prevent chronic phase-associated disorders, was evaluated after a challenge with the sub-lethal T. cruzi K98 strain (K98). In accordance with the observations after the lethal challenge, immunized mice presented lower parasitemias with respect to SaroA group during the acute phase of infection (Fig 6A). Since rTc80im group was not significantly protected against T. cruzi lethal challenge, this group was not subjected to a K98 infection.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 6. Protection in a chronic infection model in vaccinated mice.

Animals were immunized as indicated and challenged 15 days later with T. cruzi K98 strain. a) Parasitemia curve (I) and its AUC (II) during the acute phase of infection. b) Serum level of tissue damage-associated enzymes at 100 dpi: creatine kinase, CK (I) and its cardiac isoform, CK-MB(II); glutamate oxaloacetate transaminase, GOT (III); and lactate dehydrogenase, LDH (IV). c) Electrocardiogram parameters at 100 dpi: Corrected QT interval(cQTi) (I) and PR interval(PRi) (II). d) Parasite load by qPCR in target tissues at 100 dpi. e) Histopathological analysis of skeletal and heart muscle at 100 dpi. Representative muscle sections stained with hematoxilin-eosin at 100x magnification (I) and semi-quantitative analysis of inflammatory infiltrate (II). Results are expressed as mean ± SEM (n = 4–5 per group) and are representative of two independent experiments. Survival statistical analysis was performed with log-rank test. *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001. One-way ANOVA plus Tukey’s post-test. (n.s.: non-significant differences).

https://doi.org/10.1371/journal.pntd.0006384.g006

At the chronic stage (100 dpi), immunized mice showed significantly lower serum levels of tissue damage-associated enzymes with respect to control group, more importantly these values were similar to those observed in non-infected mice (Fig 6B). Notably, immunization with Tc80 was able to avoid heart electrophysiological disorders such as corrected QT and PR intervals prolongation (Fig 6C). Thus, STc80-immunized and subsequently infected mice presented a QT interval significantly less prolonged than SaroA group and more interestingly they were similar to those registered in non-infected control mice (Fig 6C-I). Similar results were observed for the PR interval which tended to be less prolonged compared to control group and similar to non-infected mice (Fig 6C-II).

When qPCR was conducted on tissue samples, both immunized groups showed a 4-fold reduced parasite burden in skeletal muscle compared with SaroA group (Fig 6D). Additionally, by hematoxilin-eosine stain, we observed that immunized and infected mice also presented reduced extent of inflammatory infiltrates (Fig 6E). While SaroA group showed multiple diffuse inflammatory foci (++++), STc80 and Pboost groups showed non-confluent foci (++). On the contrary, in heart muscle, no significant difference was observed between the different groups. Interestingly, we found that parasite burden was relatively low (Fig 6D) which correlated with the low levels of isolated inflammatory foci observed in the histopathologic studies. Amastigotes nest in immunized and control groups were not detected neither in heart nor skeletal muscle.