Figures
Abstract
For Trypanosoma brucei arginine and lysine are essential amino acids and therefore have to be imported from the host. Heterologous expression in Saccharomyces cerevisiae mutants identified cationic amino acid transporters among members of the T. brucei AAAP (amino acid/auxin permease) family. TbAAT5-3 showed high affinity arginine uptake (Km 3.6 ± 0.4 μM) and high selectivity for L-arginine. L-arginine transport was reduced by a 10-times excess of L-arginine, homo-arginine, canavanine or arginine-β-naphthylamide, while lysine was inhibitory only at 100-times excess, and histidine or ornithine did not reduce arginine uptake rates significantly. TbAAT16-1 is a high affinity (Km 4.3 ± 0.5 μM) and highly selective L-lysine transporter and of the compounds tested, only L-lysine and thialysine were competing for L-lysine uptake. TbAAT5-3 and TbAAT16-1 are expressed in both procyclic and bloodstream form T. brucei and cMyc-tagged proteins indicate localization at the plasma membrane. RNAi-mediated down-regulation of TbAAT5 and TbAAT16 in bloodstream form trypanosomes resulted in growth arrest, demonstrating that TbAAT5-mediated arginine and TbAAT16-mediated lysine transport are essential for T. brucei. Growth of induced RNAi lines could partially be rescued by supplementing a surplus of arginine or lysine, respectively, while addition of both amino acids was less efficient. Single and double RNAi lines indicate that additional low affinity uptake systems for arginine and lysine are present in T. brucei.
Citation: Mathieu C, Macêdo JP, Hürlimann D, Wirdnam C, Haindrich AC, Suter Grotemeyer M, et al. (2017) Arginine and Lysine Transporters Are Essential for Trypanosoma brucei. PLoS ONE 12(1): e0168775. https://doi.org/10.1371/journal.pone.0168775
Editor: M Carolina Elias, Instituto Butantan, BRAZIL
Received: April 7, 2016; Accepted: December 6, 2016; Published: January 3, 2017
Copyright: © 2017 Mathieu et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Data Availability: All relevant data are within the paper and its Supporting Information files.
Funding: This work was supported by grants from the Swiss National Science Foundation SNF SINERGIA CRSII3_127300 and CRSII3_141913 (PM, PB, DR), and the University of Bern (DR).
Competing interests: The authors have declared that no competing interests exist.
Introduction
Trypanosomes are unicellular, flagellated eukaryotic parasites that cycle between different hosts and cause severe diseases. Trypanosoma brucei subspecies cause human African trypanosomiasis and also affect wild game and, more severely, cattle [1]. Recent estimates from the Food and Agriculture Organization on economic losses of agricultural gross domestic product due to animal trypanosomiasis reaches US$ 4.75 billion per year [2]. T. brucei are transmitted to mammalian hosts through the bite of an infected tsetse fly. The environments change dramatically upon transfer from the insect to the mammalian host or vice versa, and trypanosomes must adapt nutrient uptake accordingly. In the insect host, glucose is limited and therefore the trypanosomes rely on amino acids as energy source, whereas in the vertebrate host, trypanosomes use glucose as energy source and oxidative phosphorylation is absent [3,4]. Amino acid uptake is of fundamental importance for trypanosomes as they are auxotroph for a number of amino acids, including the proteinogenic amino acids arginine and lysine [5].
Increased transport activity for arginine upon amino acid starvation was found in parasites and in mammalian cells. Leishmania arginine transporter LdAAP3 mRNA and protein levels were elevated in promastigotes when starved for arginine. This process looks similar to mammalian cationic amino acid transporter 1 (CAT-1) regulation upon deprivation of amino acids [6]. It has been suggested that LdAAP3 contributes to parasite virulence by increased arginine uptake [6]. The arginine-deprivation response resulting in LdAAP3 up-regulation was recently shown to be mediated through a MAPK2-dependent signaling pathway [7]. While arginine is important for polyamine biosynthesis in Leishmania, the absence of a functional arginase homolog and the essentiality of ornithine decarboxylase (ODC) in T. brucei indicate that the latter rely on ornithine as precursor for polyamine biosynthesis [8–11], though in T. brucei ornithine synthesis from arginine seems possible when ornithine is limiting [12]. Furthermore in T. cruzi and T. brucei, arginine kinase converts arginine in an ATP-dependent reaction to phosphoarginine, contributing to the energy buffering of cells [13,14].
A variety of 48 putative amino acid transporter genes (including three pseudogenes) belonging to two different families are predicted in the genome of T. brucei (TriTrypDB [15–17]). Most genes encoding putative amino acid transporters belong to the amino acid/auxin permease (AAAP, TC 2.A.18) family and are clustered in 17 loci distributed over the 11 chromosomes [17]. Additionally, a member of the APC (amino acid-polyamine-organocation, TC 2.A.3) family was identified in the T. brucei genome [16]. So far, only one T. brucei amino acid transporter (i.e. TbAAT6) has been functionally characterized and linked to low affinity, broad specificity amino acid and eflornithine uptake, and consequently, eflornithine resistance [18–21].
Arginine and lysine transporters belonging to the AAAP family have been characterized in Leishmania and T. cruzi [6,22–25]. Interestingly, most of the functionally characterized L. donovani and T. cruzi arginine and lysine transporters are highly selective for their substrates. Expression of Leishmania LdAAP3 and T. cruzi TcAAAP411 in Saccharomyces cerevisiae mutants showed high selectivity and high affinity for arginine, i.e. Km of 1.9 μM and 32 μM, respectively [22,23], and the affinity of LdAAP7 for lysine was 7.4 μM [24]. Recently the Km of T. cruzi CAT1.1 for arginine was shown to be 85 μM, while the same transporter showed lower affinity for ornithine (Km 1.7 mM) [25].
In contrast to the transporters for lysine or arginine characterized from parasites, cationic amino acids are transported by the same transport system in mammalian cells, i.e. members of SLC7 family, also referred to as the APC (TC 2.A.3) transporter family [26]. While rBAT, a member of the L-type amino acid transporter (LAT) subgroup, mediates exchange of cationic amino acids and cysteine against neutral amino acids, mammalian CAT1 to 3, which are members of the cationic amino acid transporters (CAT) subgroup, mediate facilitated uptake of cationic amino acids and are trans-stimulated to various degrees [26]. Apparent affinities of CAT members for arginine, lysine and ornithine are comparable and in the high affinity (40–450 μM; CAT1, CAT2B, CAT3) or low affinity (2–5 mM; CAT2A) range [27]. Only histidine is recognized differently by these transporters.
In the present work we report the identification and functional characterization of high affinity arginine and lysine permeases from T. brucei and show that in contrast to the mammalian transporters for cationic amino acids, the T. brucei arginine and lysine transporters are highly selective. Furthermore, we show that uptake of both, arginine and lysine, is essential for parasite survival in culture.
Materials and Methods
Animal experiments (in Prof. E. Sigel's lab) were carried out in strict accordance to the Swiss ethical guidelines, and have been approved by the local committee of the Canton Bern Kantonstierarzt, Kantonaler Veterinärdienst Bern (BE85/15). Surgery of female adult Xenopus laevis was done under anesthesia (0.2% tricaine solution). Oocytes were prepared, injected and defolliculated as described previously [28].
Phylogenetic analysis
Annotated amino acid transporters (after [17]) in the genome of T. brucei TREU 927 within TriTrypDB were screened for Pfam families. Most amino acid transporters were part of Pfam family PF01490, Aa_trans (Transmembrane amino acid transporter protein). This family was used to screen the best-curated genomes in trypanosomatids, namely Trypanosoma cruzi CL Brener non-Esmeraldo-like, T. cruzi CL Brener Esmeraldo-like, Leishmania major strain Friedlin and T. brucei TREU 927, for genes that are members of this family. Using the coding sequences of the resulting 109 genes, we generated a codon-based alignment using MUSCLE [29]. Based on this analysis, we grew a phylogenetic tree by the Neighbor-Joining method. Both of these steps were carried out using the MEGA6 software [30]. Based on this tree, a limited tree showing representative genes was generated. The representative genes include: genes studied here, their homologs in the aforementioned genomes, characterized homologs from T. cruzi, L. donovani as well as TbAAT6 [21–25]. The amino acid sequences were used to calculate pairwise global alignment scores using the Needleman-Wunsch algorithm utilizing the BLOSUM62 matrix, a gap-opening penalty of 10 and a gap extension penalty of 0.5.
Saccharomyces cerevisiae transformation
Transformation of S. cerevisiae was performed according to [31]. S. cerevisiae mutants: JT16 (Mata, hip1-614, his4-401, can1, ino1, ura3-52; [32]), 22Δ6AAL (Matα, ura3-1, gap1-1, put4-1, uga4-1, can1::hisG, lyp1/alp1::hisG, lys2::hisG; [33]), 21.983c (MATa, gap1-1, can1-1, ura3; Hein and André, 1997). 22574d (Matα, ura3-1, gap1-1, put4-1, uga4-1; [34]), 30.537a (Matα, gap1-1, dip5::kanMX2, ura3; supplied by Professor Bruno André, Université Libre de Bruxelles), YDR544 (Matα, ura3-1, gap1-1, put4-1, uga4-1, ssy1::kanMX; [22]), Y01543 (Mata, his3Δ1, leu2Δ0, met15Δ0, ura3Δ0, YLL055w::kanMX4; EUROSCARF). Media for selective and non-selective growth were as described previously [21]. For transport experiments strain 22Δ7AA (Matα, ura3-1, gap1-1, put4-1, uga4-1, can1::hisG, lyp1/alp1::hisG, hip1::hisG; [33]) was grown in minimal medium [MM: 1.7 g L-1 yeast nitrogen base without amino acids and without ammonium sulfate (Difco), and 20 g L-1 glucose] containing 1 g L-1 urea.
DNA and RNA-work
The 1377 bp TbAAT5-ORFs were amplified by PCR using genomic DNA of T. b. brucei Lister strain 427, PfuUltra DNA polymerase (Stratagene), and primers 5’-CGGAATTCATGCTGAGCCCTACAGAACCATTAG-3’, 5’-CGCGGATCCTTACACAGCCACATTGTAGATTGAGG-3’. The fragments were cleaved with EcoRI and BamHI and cloned into the respective sites of the S. cerevisiae expression vector pDR197 [35]. For tetracycline-inducible RNA-interference (RNAi) against TbAAT5 in procyclic forms, a 596 bp fragment of the ORF Tb427.08.4720 (nucleotide position 234 to 829) was amplified using primers 5'- GGCCAAGCTTGGATCCCATAAGTCTCGCTATCGCTTTTCAG, 5'- GGCCTCTAGACTCGAGGTTTGCGCATCTCCGAGTAAATGG, and cloned into the stem-loop RNAi vector pALC14 (a derivative of pLEW100 [36] containing puromycin as selectable marker). In bloodstream forms (BSF) the TbAAT5-RNAi cassette mentioned above was similarly cloned into the stem-loop RNAi vector pMS14v5 [37] (a derivative of pLEW100 [36] containing phleomycin as selectable marker). All RNAi vectors were linearized with NotI prior to parasite transfection. For expression in oocytes, the TbAAT5 ORF was cloned into vector pBF1 [38]. Therefore Tb427.08.4720 was excised by EcoRI/BamHI from pDR-Tb427.08.4720 and cloned into EcoRI/BglII of pBF1. pBF1-Tb427.08.4720 was linearized with MluI and cRNA synthesized by using the Sp6 mMessage mMachine kit (Ambion, Austin, TX). RNA was purified by LiCl precipitation and stored at -80°C.
The 1389 bp TbAAT16-ORFs were amplified by PCR using genomic DNA of T. brucei brucei Lister strain 427, and primers 5’-CGGAATTCATGTCACCCAGGGCAACAGAGCC-3’ and 5’-CGCGGATCCCTACTTCTTAACCTCGTCGTAAATGGTTAATGCC-3’. The fragments were cleaved with EcoRI and BamHI and cloned into the respective sites of the S. cerevisiae expression vector pDR197. Tb427.tmp.01.7520 was not amplified using the primers above. Instead, we amplified Tb427.tmp.01.7520_G343V containing a single amino acid difference, which was mutagenized to obtain Tb427tmp.01.7520. Therefore T at position 1029 was mutated to G with the QuickChangeRII Site-Directed Mutagenesis Kit (Stratagene, La Jolla, USA) using primers 5’-CGCTATCAAGATATGCGGAGGATTCGCTATTTGCATCC-3’ and 5’-GCGATAGTTCTATACGCCTCCTAAGCGATAAACGTAGG-3’. For RNAi a 600 bp fragment of Tb427tmp01.7500 (ORF position 323 to 922) was amplified using primers: 5'-GGCCAAGCTTGGATCCTGTACTCTATCCGCATACTCGTG-3’ and 5'-GGCCTCTAGACTCGAGGATAACCGAAGATACCAGACAAGAAATAC-3’ and cloned into pMS14v5 [37]. For cRNA synthesis and subsequent expression in oocytes Tb427tmp.01.7500 was excised from pDR197 with EcoRI and BamHI and inserted into the corresponding site of the vector pBF1 [38]. All constructs were verified by sequencing.
For tightly-regulated inducible expression of cMyc-TbAAT5 and cMyc-TbAAT16, the ORFs were cloned into a modified pLEW100 vector [36], in which the phleomycin resistance gene has been replaced by the puromycin resistance gene and the triple cMyc cassette [39] was inserted to allow N-terminal tagging [40].
Transport assays
Transport assays in S. cerevisiae strain 21.983c and 22Δ7AA were performed as described previously [41] with slight modifications. Cells were grown to a density of OD578 up to 0.6, washed twice with water and resuspended in buffer A (1/10 initial volume; 0.6 M sorbitol and 50 mM potassium phosphate, different pH values). Prior to the transport assay, cells were preincubated at 30°C for 6 min in the presence of 100 mM glucose. To start the transport assay, cells (100 to 130 μl) were added to an equal volume of buffer with different concentrations of L-arginine or L-lysine and 3.7–18.5 kBq L-[3H]-arginine (1.48–2.22 TBq mmol-1) or 37–74 kBq L-[3H]-lysine (2.2–3.2 TBq mmol-1) per assay. For some experiments, competitors as specified in the results section were added.
Samples (48 μl) were transferred after 30 sec, 1 min, 2 min, 4 min (and 6 min) to 4 ml ice-cold buffer A, filtrated on glass fiber filters and washed twice with 4 ml ice-cold buffer A. The uptake of tritium-labeled substrates was determined by liquid scintillation spectrometry. In all experiments, uptake was linear over the time period investigated and transport rates were calculated from at least four different time-points. Uptake rates of S. cerevisiae transformed with ‘empty vector’ was subtracted as background. Kinetic parameters were calculated using the Michaelis-Menten equation V = Vmax x [S] x (Km + [S])-1.
Expression in Xenopus laevis oocytes
Preparation of the X. laevis oocytes, cRNA synthesis and injection, setup and two-electrode voltage clamping were essentially as described previously [21,28]. 50 nl of pBF1-Tb427.08.4720 (TbAAT5-3) or pBF1- Tb427tmp.01.7500 (TbAAT16-1) cRNA (50 ng) was injected per oocyte. Oocytes were clamped at a membrane potential of -80 mV. For Tb427.08.4720, currents were normalized to currents induced by 50 μM arginine (pH 7.4, Vm -80 mV) in Na+-Ringer buffer (115 mM NaCl, 2 mM KCl, 1.8 mM CaCl2, 1 mM MgCl2 and 5 mM HEPES) to correct for different expression levels between oocytes. Calculations and curve fittings were as described [28]. Experiments to test for co-transport of Na+ and K+ were performed in buffer containing 1.8 mM CaCl2, 1 mM MgCl2, 5 mM HEPES and 117 mM choline chloride (choline Ringer). Substrates were added to the buffer solutions as indicated, and the necessary pH adjustments were made with tris(hydroxymethyl)aminomethane (TRIS). Values represent mean ± SE of at least 5 oocytes from three batches of oocytes.
T. b. brucei culture
T. brucei bloodstream form (BSF) New York single marker (NY-SM, [36]) were cultured at 37°C and 5% CO2 in HMI-9 medium supplemented with 10% (v/v) of heat-inactivated FBS (Gibco, Basel, Switzerland). NY-SM was the parent line to obtain the RNAi cell lines. TbAAT5-RNAi and TbAAT16-RNAi BSF lines were selected and cultured in the presence of 1 μg ml-1 geneticin (G418) and 1.5 μg ml-1 phleomycin. TbAAT5/16 dRNAi clones were selected and cultured in the presence of 1 μg ml-1 geneticin (G418), 1.5 μg ml-1 phleomycin and 0.1 μg ml-1 puromycin.
T. brucei 29–13 procyclic forms (PCF) [36] were cultured at 27°C in SDM-79 supplemented with 10% (v/v) heat-inactivated FBS (Gibco), in the presence of 25 μg ml-1 hygromycin and 15 μg ml-1 G418. In this study 29–13 cells were the parental cell line used to obtain RNAi and over-expressing PCF T. brucei. TbAAT5-RNAi PCF and cMyc-TbAAT5 or cMyc-TbAAT16 over-expressing PCFs were selected and cultured with 1 μg ml-1 puromycin.
T. b. brucei stable transfection
For transfection, NY-SM BSF T. brucei were harvested at mid-log phase and washed once in phosphate-buffered saline (PBS; 137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 1.76 mM KH2PO4, pH 7.2). Parasites were resuspended in 100 μl electroporation buffer (90 mM Na2HPO4, 5 mM KCl, 0.15 mM CaCl2, 50 mM HEPES, pH 7.3) containing 7–10 μg of DNA. Electroporation (pulse code FI-115, “Primary Cell P3” solution) was performed in 100 μl nucleocuvettes using Lonza 4D Nucleofector System. Cells were immediately inoculated in 10 ml culture medium, diluted 1:200–400 and plated in 24-well plates (1 mL per well). After 24 h, the corresponding antibiotics were added, i.e. 2.5 μg ml-1 phleomycin for selection of TbAAT16 RNAi cell lines, or 0.1 μg ml-1 puromycin for selection of TbAAT5 RNAi cell line. Double-RNAi cell line was selected in presence of both antibiotics.
Quantitative RT-PCR
Total RNA was isolated using the SV RNA isolation system (Promega, Madison, USA) following the manufacturer instructions. RNA samples were treated with DNase I (Roche, Basel, Switzerland) for 15 min at 37°C, followed by phenol/chloroform extraction and ethanol precipitation. Absence of gDNA contamination was confirmed by PCR. DNase I-treated RNA (0.5 μg) was used for cDNA synthesis using Takara PrimeScript reverse transcriptase (Takara, Shiga, Japan). Quantitative PCR was performed using a LightCycler 480 System (Roche). The reaction mixtures consisted of 1x Sybr green premix, Ex taq (RR420L, Takara) and 0.2 μM forward and reverse primers. TbAAT5 primers used for qRT-PCR analysis of RNAi lines, AAT5F 5’-ATCATTGCGGGTTTCTTCGG-3’ and AAT5R 5’- ACGCAATTGCCATCATCACG-3’. Primers used to compare stage-specific expression of TbAAT5 members: 4700F 5’-GGCGTGTCCAGTAAATTTCCAC-3’ and 4700R 5’-AGACCAACTGCTGTCTTCTCTG-3’; 4710-40F 5’-TTCCCACAGGGTTAAGTGAAGG-3’ and 4710-40R 5’-GCTGGAGTAACGTATTGTTGGC-3’. TbAAT16 primers used, AAT16F 5’-GGAATGATCTAGAAGGCTCCGTAC-3’ and AAT16R: 5’- CTTGATAGCGATGCCAACATACCC-3’. Real-time PCR analyses were performed in duplicates of three different cDNA dilutions and PCR efficiencies were carefully controlled (>90%). Telomerase reverse transcriptase (TERT, Tb927.11.10190) was used as reference using primers described before [42]. For comparisons of the expression levels in BSF and PCF, a second control gene (C1, Tb927.10.12970), described to be stably expressed in different life-cycle stages of T. brucei [43] was used in addition to TERT.
Immunolocalization
For immunolocalization of N-terminally cMyc-tagged TbAAT5-3 and TbAAT16-1, PCF over-expressing TbAAT5-3 (Tb427.08.4720) or TbAAT16-1 (Tb427tmp.01.7500) were fixed on poly-lysine slides with 4% (w/v) paraformaldehyde, followed by permeabilization with 0.2% (v/v) TX-100 in PBS. Antibody against cMyc (monoclonal antibody, mouse, clone 9E10, Santa Cruz Biotechnology) was applied at a dilution of 1:1000 in 5% (w/v) skim milk powder in PBS, followed by Alexa Fluor® 488, Goat anti-Mouse IgG (H+L) (Life Technologies), at a dilution of 1:1000. Coverslips were mounted with Vectashield® containing 4’,6-diamidino-2’-phenylindole (DAPI; Vector Laboratories) and images were obtained using a confocal microscope (Leica DM RXE, equipped with a Leica TCS SP2 confocal scanner) in sequential scanning mode. Alexa Fluor® 488 was excited with a wavelength of 488 nm and emission was detected at 500–600 nm. DAPI was detected at 410–610 nm after excitation at a wavelength of 405 nm. Final images were analyzed using Fiji software.
Results
T. brucei TbAAT5 and TbAAT16 are homologs of arginine and lysine transporters in other trypanosomatids
The TbAAT5 and TbAAT16 loci are synthenic in the reference T. brucei strain TREU927 and in Lister strain 427 used in our experiments. The TbAAT5 locus of T. brucei is located on chromosome 8 and consists of 5 full-length gene members and one pseudogene [17], i.e. Tb427.08.4700, Tb427.08.4710, Tb427.08.4720, Tb427.08.4730, Tb427.08.4740, and the 120 nt long pseudogene Tb427.08.4750 (S1 Fig). It should be noted that the full-length genes mentioned above are annotated differently in TriTrypDB for T. brucei strains 927 and 427. RNA-seq data [44–46] support ORFs of 1377 nt for all full-length TbAAT5 members, as shown in the TREU927 annotation. Our nucleotide numbering of TbAAT5 members in strain 427 refers to the TREU927 annotation (S1 Table, S1 Fig). The amino acid sequences of Tb427.08.4710 and Tb427.08.4720 are identical (not considering the unresolved 6 nucleotides; http://tritrypdb.org), while in Tb427.08.4730 a proline at position 43 is replaced by leucine (S1 Table). Tb427.08.4700 is identical to Tb427.08.4740 except for a predicted deletion of 4 nucleotides (at positions 60–63; S1 Table), which is not present in Tb927.8.4700 and would generate a truncated transporter in strain 427. The most divergent members, i.e. Tb427.08.4730 and Tb427.08.4740, differ from each other in at least 7 amino acids (S1 Table). Phylogenetic analyses revealed that the TbAAT5 proteins are homologs of the functionally characterized T. cruzi arginine transporter TcAAAP411 (TcCLB.511411.30 [23]; 76–78% similarity) and TcCAT1.1 to TcCAT1.3 [25] (70–76% similarity), but show a lower degree of similarity to the Leishmania arginine transporter LdAAP3 (LdBPK_310910.1 [6,22]; 60–62% similarity) (Fig 1 and S2 Table).
Phylogenetic relationship of members of the T. brucei TREU 927 AAT5 (Tb927.8.4700-4740) and AAT16 (Tb927.11.15840, Tb927.11.15860) families and characterized arginine and lysine transporters from T. cruzi and L. donovani: TcAAAP411, (TcCLB.511411.30 [23]), TcAAP7 (TcCLB.511545.80 [24]), TcCAT1.1, TcCAT1.2, TcCAT1.3 (TcCLB.506153.10, TcCLB.506153.20, TcCLB.506053.10 [25]); LdAAP7 (LdBPK_322800.1 [24]) and LdAAP3 (LdBPK_310910.1 [22]). Further shown are AAP7 in L. major, LmAAP7 (LmjF.32.2660); the characterized, but more distantly related transporter of eflornithine and neutral amino acids, TbAAT6 (Tb927.8.5450, [18–21]); an annotated fragment with high similarity to TcCAT1.1 (TcCLB.506053.5). Scale bar represents substitutions per site.
The TbAAT16 locus is located on chromosome 11 and contains two genes, Tb427tmp.01.7500 and Tb427tmp.01.7520 (Tb927.11.15840 and Tb927.11.15860 are the syntenic genes in T. brucei TREU927) [17] (S1 Fig). TbAAT16 gene products differ from each other by only 3 amino acids (S3 Table). TbAAT16 shares high similarity to the characterized lysine transporters in T. cruzi and Leishmania (TcAAP7 and LdAAP7, respectively; 68–70% similarity (S2 Table), [24]). On the other hand the degree of similarity of TbAAT16 is slightly higher to the above-mentioned arginine transporters from T. brucei (TbAAT5; 62–63% similarity) and T. cruzi (TcAAAP411, TcCAT1.1; 62% similarity) than to the L. donovani arginine transporter LdAAP3 (59% similarity; Fig 1 and S2 Table).
PCR using genomic DNA from T. brucei strain 427 amplified three different ORFs for TbAAT5, i.e. (1) Tb427.08.4720, the unresolved nucleotide at position 96 was identified as cytosine, resulting in aspartate (S1 Table); (2) Tb427.08.4720_D20N in which a single guanine was replaced by an adenine, changing the aspartate at position 20 of Tb427.08.4720 into an asparagine; and (3) Tb427.08.4740, the unresolved nucleotide at position 96 was identified as guanine, resulting in glutamate (S1 Table).
For TbAAT16, three variants were found; the first amino acid sequence corresponded to the database annotation of Tb427tmp.01.7500; the second Tb427tmp.01.7500_V343G, differed from Tb427tmp.01.7500 in seven nucleotides, but only one (nt 1028) resulted in a single amino acid difference, i.e. a valine at position 343 was replaced by glycine; the third, Tb427tmp.01.7520_G343V, differed from the database annotation of Tb427tmp.01.7520 in one amino acid. Since Tb427tmp.01.7520 was not amplified in our analysis, it was generated by site directed mutagenesis of Tb427tmp.01.7520_G343V (S3 Table).
Comparable to predictions for other members of the AAAP family [47], membrane topology prediction platforms (Phobius [48] and HMMTOP [49]) suggested 11 transmembrane domains for the full-length TbAAT5 proteins and 10 or 11 transmembrane domains for TbAAT16 proteins.
TbAAT5 and TbAAT16 expressed in S. cerevisiae mediate uptake of cationic amino acids
To identify potential substrates of TbAAT5 and TbAAT16, the isolated ORFs were expressed in S. cerevisiae mutants impaired in the uptake of different amino acids. Interestingly, all three TbAAT5 gene products (Tb427.08.4720, Tb427.08.4720_D20N and Tb427.08.4740) mediated growth on arginine and histidine, but only Tb427.08.4720 and Tb427.08.4720_D20N mediated growth on lysine (Fig 2A).
Growth of S. cerevisiae mutants transformed with the vector pDR197 or pDR197 harboring different members of the T. brucei (A) AAT5 and (B) AAT16 family. S. cerevisiae was grown for 3 days on non-selective (left) and selective (right) medium. Strains allow selection for arginine (21.983c), histidine (JT16) and lysine (22Δ6AAL) transport, respectively. Lysine supplemented as lys-asp dipeptide was used as source of lysine in the non-selective medium for strain 22Δ6AAL.
The TbAAT16 gene products Tb427tmp.01.7500, Tb427tmp.01.7500_V343G, Tb427tmp.01.7520_G343V and Tb427tmp.01.7520 mediated growth on lysine and arginine, while Tb427tmp.01.7520_G343V and Tb427tmp.01.7520 complemented histidine transport deficiency (Fig 2B).
None of the ORFs mediated growth on any of the other tested amino acids (i.e. proline, alanine, cysteine, γ-aminobutyric acid, glutamate, aspartate, methionine, phenylalanine, valine, isoleucine, leucine, tryptophan, tyrosine, threonine and citrulline, data not shown). These results indicated that TbAAT5 and TbAAT16 are selective cationic amino acid transporters.
As it is unclear whether the different single nucleotide polymorphisms represent strain differences or may originate from (fusion) PCR events, for further functional analysis we decided to focus on one representative each that corresponded to the database amino acid sequence, i.e. Tb427.08.4720 (TbAAT5-3) and Tb427tmp.01.7500 (TbAAT16-1).
Members of the AAAP family in plants are known to be driven by the proton motive force [50], while mammalian AAAP members may use either proton or sodium [51]. In general, uptake of different substrates in trypanosomes is proton-coupled, e.g. nucleosides [52], choline and myo-inositol [53,54], and amino acids [21]. Between pH 4.5 and 7, and using 50 μM L-arginine, the arginine uptake rates were only slightly pH-dependent, indicating that TbAAT5-3 may mediate arginine uptake in different pH environments (Fig 3A). TbAAT16-1 showed highest 50 μM L-lysine transport rates at pH 5.5. At pH 4.5 and 6.5 the relative transport rate was approximately 80% while at pH 7.5, lysine uptake was reduced to 50% (Fig 3B).
(A) L-Arginine uptake rates in S. cerevisiae 21.983c expressing TbAAT5-3 were measured using 50 μM L-arginine and pH values between pH 4.5 and 7 (n = 3 ± SD). (B) TbAAT16-1-mediated 50 μM L-lysine transport at pH 4.5, 5.5, 6.5 and 7.5. Values correspond to the mean ± SD of at least seven independent experiments. Transport rates were determined as described in Materials and Methods. Relative transport rates were calculated by normalizing maximum values of each experiment to 100%.
To determine the dependence on Na+ and K+, substrate-induced currents were analyzed in Xenopus laevis oocytes injected with TbAAT5-3 or TbAAT16-1 cRNA using two-electrode voltage clamping. While no currents could be recorded for TbAAT16-1 when using up to 10 mM lysine, arginine or histidine as substrates (pH 7.4 and pH 5.5), in oocytes injected with TbAAT5-3 cRNA, the addition of 50 μM arginine in Na+-Ringer induced small inward currents in the range of 15 to 90 nA (Fig 4B, Vm -80 mV, pH 7.4). Comparable currents were measured when Na+ and K+ were replaced by choline (choline Ringer, Fig 4C). These findings indicate that arginine transport via TbAAT5-3 does not depend on extracellular Na+ and K+.
Oocytes were clamped at -80 mV. Inward currents were recorded upon superfusion of H2O-injected oocytes (A) and TbAAT5-1 injected oocytes (B) with Na+-Ringer containing 50 μM arginine at pH 7.4 (B). (C) Currents evoked by 20 μM arginine in sodium Ringer or choline Ringer (without sodium and potassium) at Vm of -80 mV. Mean values ± SE of 5 oocytes. Spikes in the current traces (marked by stars) are due to changes of solutions.
TbAAT5-3 and TbAAT16-1 mediate high affinity, selective transport of arginine and lysine, respectively
Transport assays performed using S. cerevisiae expressing TbAAT5-3 revealed high affinity transport of L-[3H]-arginine, with a Km of 3.6 ± 0.4 μM (strain 21.983c, Fig 5A), while expression of TbAAT16-1 showed high affinity transport of L-[3H]-lysine, with a Km of 4.3 ± 0.5 μM (strain 22Δ7AA, Fig 5B).
Kinetics of arginine (A) or lysine (B) uptake by TbAAT5-1 or TbAAT16-1 expressing S. cerevisiae strain 21.983c or 22Δ7AA, respectively. Representative graphs are shown. Affinities (Km) are mean values ± SD of three independent experiments.
Competition of TbAAT5-3 mediated (50 μM) L-arginine uptake showed that transport was only reduced by a 10 times excess of L-arginine, canavanine, homo-arginine and arginine-β-naphthylamide, but not by 10 or 100 times excess of citrulline, agmatine, cadaverine, histidine or ornithine, or other arginine analogs tested (Table 1). D-arginine did not inhibit L-arginine uptake, indicating that transport of L-arginine by TbAAT5-3 is stereospecific. Although TbAAT5-3 mediated growth on histidine and lysine, competition for L-arginine transport was only observed at 100 times excess of lysine (Table 1). Similarly, 50 μM L-lysine uptake mediated by TbAAT16-1 was only inhibited by a 10-times excess of L-lysine, Fmoc-lysine and thialysine (Table 2). Alanine, acetyl-L-lysine, arginine, aspartate, eflornithine, histidine, D-lysine, hydroxy-L-lysine, methyl-L-lysine, the dipeptide lysine-lysine, ornithine or proline did not compete for L-lysine transport (Table 2).
TbAAT5 and TbAAT16 are highly expressed and localized at the plasma membrane
TbAAT5 and TbAAT16 transcripts were abundant in both PCF and BSF T. brucei (Fig 6). Due to high sequence homology only Tb427.08.4700, which has a distinct 3’UTR, could be distinguished from the other TbAAT5 members (see S1 Fig). Transcriptome analyses support high transcript levels of TbAAT5 and TbAAT16 in BSF and PCF trypanosomes [45], in line with T. brucei being auxotroph for cationic amino acids [5], and thus, depending on their import in insect and mammalian hosts. While protein synthesis necessitates lysine and arginine import into the cytosol and the mitochondrion, the presence of arginine kinase in the cytosol, glycosome and flagellum [14] indicates the presence of arginine in additional subcellular compartments. Protein sorting motifs are generally better defined for soluble proteins than for membrane proteins and the fact that none of the sorting motif for mitochondria (using MitoProt [55] or TargetP [56]), peroxisomes/glycosomes [57] or flagellum [58] could be identified, does not exclude localization in the membrane of these subcellular compartments. Proteome analyses did not identify these transporters in the flagellum [59,60] or glycosome proteomes [61–63]. PCF T. brucei over-expressing cMyc-tagged versions of either TbAAT5-3 or TbAAT16-1 indicated plasma membrane localization of the tagged proteins (Fig 7), which is consistent with TbAAT5 or TbAAT16 mediating import of extracellular arginine or lysine, respectively, in S. cerevisiae. Fluorescence was also detected in unknown intracellular structures, possibly as a result of overexpression of the tagged protein.
TbAAT5 and TbAAT16 mRNA abundance in PCF and BSF T. brucei was quantified by qRT-PCR using telomerase reverse transcriptase (TERT, Tb927.11.10190) as reference gene. Due to high homology of ORFs and UTRs (S1 Fig) only Tb427.08.4700 could be discriminated from the other TbAAT5 members (i.e. Tb427.08.4710, Tb427.08.4720, Tb427.08.4730, Tb427.08.4740). The two TbAAT16 genes (Tb427tmp.01.7500 and Tb427tmp.01.7520) were not differentiated.
Confocal microscopy of procyclic T. brucei cells over-expressing N-terminally cMyc-tagged versions of TbAAT5-1 and TbAAT16-1. The proteins localized in a bright ring along the periphery of the cell body and in internal membranes, showing partial localization at the plasma membrane as well as in internal membranes of unknown identity. Anti-cMyc (green); DAPI (blue); bright field image (grey); scale bar: 5 μM. The insets show Western blot analyses of extracts from uninduced (-tet) or induced (+tet) cells probed with anti-cMyc antibody. Ponceau (Ponc) staining is shown as loading control.
TbAAT5 and TbAAT16 are essential for arginine and lysine uptake and growth of bloodstream form trypanosomes
To investigate the role of TbAAT5 and TbAAT16 in trypanosomes, expression was down-regulated by RNAi using a tetracycline-inducible system [36]. After one day of induction, mRNA of TbAAT5 and TbAAT16 were significantly reduced. RNAi against TbAAT5 or TbAAT16 substantially reduced growth of BSF parasites after one day of induction (Fig 8B and 8C), thus hampering mRNA isolation at later time points.
Cumulative growth of T. brucei BSF control (A) or after down-regulation of TbAAT5 (B), TbAAT16 (C) or both (D) for 5 days in HMI-9. 5 mM arginine and/or 10 mM lysine was added as indicated above the growth curves. Data points of growth curves correspond to mean values ± SD from three independent experiments. Insets show mRNA levels relative to telomerase reverse transcriptase (TERT, Tb927.11.10190) transcripts after one day of induction as determined by qRT-PCR. Expression in the absence of tetracycline was set as 100%. Data points correspond to mean values ± SD from three independent experiments.
Although down-regulation of individual genes was not analyzed, the high homology among the 5 genes of the AAT5 locus (> 98% overall identity on nucleotide level) and between the 2 genes of the AAT16 locus (99% overall identity on nucleotide level) suggests that the RNAi constructs targeted all genes of the TbAAT5 or TbAAT16 locus, respectively.
To test the hypothesis that the growth defect of the induced RNAi lines is due to the inability to import sufficient amounts of arginine or lysine, the medium was supplemented with 5 mM arginine or 10 mM lysine, i.e. approximately 10 times the concentration of arginine or lysine in HMI-9 (482 μM Arg and 1 mM Lys, respectively [64]). Indeed, the addition of arginine or lysine to the medium significantly improved growth of the tetracycline-induced TbAAT5-RNAi (Fig 8B) or TbAAT16-RNAi (Fig 8C) BSF T. brucei, respectively, while growth of non-induced cells remained unchanged (Fig 8A). In contrast, addition of both amino acids improved growth of induced RNAi lines less efficiently, indicating that at least part of the import at high substrate concentrations is mediated by a system that transports both arginine and lysine. Down-regulation of TbAAT5 in PCF parasites also impacts growth indicating that arginine uptake is essential in this life-cycle stage (S2 Fig). In a double-RNAi BSF line (TbAAT5/16-RNAi) with simultaneous down-regulation of TbAAT5 and TbAAT16, reduction of transcript levels was comparable to the single RNAi lines (Fig 8D). Induced TbAAT5/16-RNAi parasites stopped growth after one day of tetracycline addition. As expected, supplementing the medium with 5 mM arginine or 10 mM lysine did not prevent the growth defect. Addition of both arginine and lysine resulted in partial rescue, comparable to the addition of both amino acids to single RNAi knockdown lines.
Discussion
In mammalian cells the cationic amino acids arginine and lysine are transported by the same transport systems that mediate exchange of cationic amino acids and cysteine against intracellular neutral amino acids (rBAT), or facilitated uptake of cationic amino acids (CAT) [26,65]. CAT members have similar affinities for arginine, lysine and ornithine (Km 40–450 μM for CAT1, CAT2B and CAT3; 2–5 mM for CAT2A) [27] while histidine recognition varies. In contrast, the cationic amino acid transporters characterized from the parasitic protozoa L. donovani and T. cruzi are selective for either arginine (LdAAP3, TcAAAP411) or lysine (LdAAP7, TcAAP7) and belong to a different gene family [22–24]. Only TcCAT1.1 has recently been described as arginine/ornithine transporter [25], but the huge difference in affinity for the two substrates indicates that the latter may not be the preferred substrate in vivo. Our results show that similar to the trypanosomatid transporters mentioned above, uptake of cationic amino acids in T. brucei is mediated by selective and high affinity transporters.
Despite the similarities among trypanosomatid arginine and lysine transporters, subtle differences were detected. At saturating arginine concentrations, L-arginine transport mediated by TbAAT5-3 was not affected by the presence of a 10 times excess of the cationic amino acids histidine, ornithine, and lysine, with the latter partially reducing arginine transport only at 100 times excess, indicating high selectivity, comparable to LdAAP3 and TcCAT1.1 [22,25]. Furthermore, like the arginine transporter TcAAAP411 [23], TbAAT5-3 is stereoselective since D-arginine has no effect on arginine transport. The arginine analogs canavanine and homoarginine were inhibitors of TbAAT5-mediated arginine transport, suggesting that the aliphatic chain between the guanidino group and the amino- and the carboxylic acid-group is less important for substrate recognition. Canavanine was also found to be a good competitor for TcCAT1.1-mediated arginine uptake, while homoarginine was less efficient [25]. In contrast, in TcAAAP411-expressing S. cerevisiae cells, canavanine was competing only at 50-fold excess, and for LdAAP3 homoarginine at 5-fold excess did not inhibit arginine uptake [22,23], revealing slight preferences in substrate recognition. The arginine analogs homoarginine and canavanine were not only competitors in heterologous expression systems, but were also the best competitors for arginine uptake in T. cruzi epimastigotes [66]. Interestingly in T. cruzi the arginine analogs agmatine, homoarginine and canavanine were shown to inhibit arginine kinase and the latter two compounds were also able to reduce T. cruzi epimastigote growth in culture [67].
Agmatine neither interfered with TbAAT5-3 nor with LdAAP3- or TcCAT1.1-mediated arginine transport indicating that the negatively charged carboxylic acid is essential for substrate recognition [22,23]. Furthermore, alkylation of the carboxylic acid moiety of arginine also decreased competition for arginine uptake by TbAAT5-3 as indicated by the much smaller reduction of arginine transport rates by arginine ethyl ester and arginine methyl ester that diminished arginine transport rates to about 70% (at 100 times excess). In addition to the lack of a negative charge in these compounds, steric constraints might explain reduced interaction of arginine derivatives esterified at the carboxylic acid group. In contrast, arginine β-naphthylamide reduced arginine transport rates, though it was not tested whether the amphipathic compound may reduce transport through an unspecific effect.
Methylation at the guanidine group of arginine lowered recognition by TbAAT5-3 substantially as seen for NG-monomethylarginine (L-NMMA). A second methylation of the same amino group in NG,NG-dimethylarginine (ADMA) completely impaired recognition by TbAAT5-3. And finally, a guanidine group is preferred to an amine group as lysine only decreases arginine transport if present at 100 times excess. Comparably, the affinity of Leishmania LdAAP3 for lysine was about 500 times lower than for arginine [22].
The lysine transporter, Tb427tmp.01.7500, is also highly selective. Similar to LdAAP7-mediated lysine transport and lysine uptake into T. cruzi epimastigotes and L. donovani promastigotes, none of the proteinogenic amino acids tested competed for L-lysine uptake [24]. Transport was stereospecific and modifications of the amino group (N-α-acetyl-L-lysine methyl ester), shortening the length of the carbon scaffold as in ornithine and eflornithine (α-difluoromethylornithin) or extending it at the ε-amino residue (N-ε-methyl-L-lysine) impaired recognition as substrates. Also the dipeptide lysyllysine was not recognized. While hydroxylation of the carbon backbone (5-hydroxy-L-lysine) was not tolerated, thialysine (S-(2-aminoethyl)-L-cysteine) in which C2 is replaced by a sulphur was the only compound competing for lysine uptake and, to a lesser extend, Fmoc-lysine (N-α-(9-fluorenylmethyloxycarbonyl)-L-lysine) also reduced L-lysine uptake rates. The various compounds were tested to evaluate the requirements for a substrate to be recognized by TbAAT5 and TbAAT16. In the future, structural models of the transporters may allow identification of the residues involved in substrate binding and selectivity.
The apparent affinities of TbAAT5-3 (Km 3.6 μM) and TbAAT16-1 (Km 4.3 μM) for arginine and lysine, respectively, indicate that the transporters are likely to be saturated and working at maximal rates in mammalian blood where concentrations of 20–218 μM arginine and 164–434 μM lysine have been reported (Human metabolome database, www.hmdb.ca [68]). In human cerebrospinal fluid, 9–25 μM arginine and 22–32 μM lysine were found [68], suggesting that the transporters also mediate uptake of these amino acids in T. brucei parasites in the central nervous system. Although TbAAT5 is more closely related to TcAAAP411 and TcCAT1.1 (Fig 1), the apparent affinity of TbAAT5 for arginine determined in S. cerevisiae is close to 10 times (TcAAAP4111) and more than 20 times (TcCAT1.1) higher and comparable to the Km determined for the arginine-selective transport system AAP3 from L. donovani [22,23,25]. All trypanosomatid lysine transporters characterized so far are highly homologous, and also the Km values were in a comparable range [24]. While transport of arginine and lysine into T. brucei parasites has not been determined, the affinity of lysine and arginine uptake in L. donovani promastigotes (Km values of 3 μM and 14 μM, respectively) are in a range comparable to the Km value determined in S. cerevisiae expressing LdAAP7 (7.4 ± 3.6 μM) or LdAAP3 (1.9 ± 0.1 μM) [22,24,69] and similar to the affinity of the T. brucei lysine and arginine transporters characterized in our study. Lysine transport assessed in T. cruzi epimastigotes revealed a slightly lower affinity of 23.4 ± 2.3 μM, while kinetic data of TcAAP7 expressed in S. cerevisiae were not determined [24].
Down-regulation of TbAAT5 and TbAAT16 resulted in impaired growth of T. brucei parasites, confirming their importance for arginine and lysine uptake. The growth defect could only be rescued at very high, i.e. non-physiological concentrations of arginine or lysine, respectively. Initially, growth phenotypes of the S. cerevisiae mutants expressing TbAAT5 or TbAAT16 indicated that the transporters recognize both arginine and lysine. However, the competition experiments showed that with a 10-fold excess there is no reduction of transport rates, and thus in vivo, with concentrations of arginine and lysine differing ~ 2-fold, transport of both amino acids by the same transporters is very unlikely. Furthermore, the reduction of growth of TbAAT5 RNAi lines in the presence of high arginine and high lysine compared to high arginine indicated that uptake is mediated partially by a system that also recognizes lysine. This transport system is, however, unlikely to be TbAAT16, because lysine concentrations in HMI9 medium are at saturation for TbAAT16 and a 10-fold excess of arginine is not expected to be transported at high rates. The same line of arguments can be used for the TbAAT16 RNAi lines grown in the presence of lysine or lysine plus arginine. Single and double RNAi lines therefore indicate that additionally one or several low affinity transport systems are present and that at least one of them recognizes both arginine and lysine. Low affinity arginine transport has so far only been described in T. cruzi [70], but the corresponding gene has not been identified and low affinity lysine or arginine transport has not been determined in T. brucei.
Dependence of parasites on these high affinity lysine and arginine transport systems is likely to be more important in vivo since—as indicated above—the concentrations of cationic amino acids in the blood are 5–6 times lower and in the cerebrospinal fluid 30-70-times lower than in standard HMI-9 medium [64,68]. Understanding the multiple mechanisms by which the parasites acquire nutrients remains of major importance to comprehend parasite physiology and may help developing new trypanocidal compounds. TbAAT5 and TbAAT16 may be promising candidates as drug delivery systems or targets, because they are essential and not related to human cationic amino acid uptake systems.
Supporting Information
S1 Table. Comparison of T. brucei AAT5-genes from strains TREU927 and 427 with ORFs amplified by PCR.
The nucleotide positions are according to the annotated sequences of AAT5 genes in strain TREU927 in the TriTrypDB, containing 1377 nucleotides. Changes in amino acids are indicated when different from the reference gene Tb427.08.4720 (boxed in red). Conserved nucleotides in strain 427 and TREU927 are highlighted in blue or orange. N, unresolved nucleotides in strain 427; del, predicted deletion in Tb427.8.4700. G/C* nucleotide (G) present in the primer and not verified by PCR.
https://doi.org/10.1371/journal.pone.0168775.s001
(PDF)
S2 Table. Percentage of identity and similarity of predicted amino acid sequences of T. brucei AAT5 and AAT16 members and characterized arginine and lysine transporters from T. cruzi and Leishmania.
Percentage of identity and similarity of members of the AAT5 and AAT16 family of T. brucei brucei strain TREU927, characterized arginine and lysine transporters from T. cruzi and L. donovani: TcAAAP411, (TcCLB.511411.30 [23]), TcAAP7 (TcCLB.511545.80 [24]), TcCAT1.1, TcCAT1.2, TcCAT1.3 (TcCLB.506153.10, TcCLB.506153.20, TcCLB.506053.10 [25]); LdAAP7 (LdBPK_322800.1 [24]) and LdAAP3 (LdBPK_310910.1 [22]). Included are also L. major AAP7 (LmjF.32.2660); and the characterized, but more distantly related transporter of eflornithine and neutral amino acids, TbAAT6 (Tb927.8.5450, [21]). Because the ORF of TcCLB.506053.5 is much shorter, it was not included.
https://doi.org/10.1371/journal.pone.0168775.s002
(TIF)
S3 Table. Comparison of T. brucei AAT16-genes from strains 427 and TREU927 with ORFs amplified by PCR.
The predicted ORFs have the same length in strain TREU927 and 427 (ORF 1389 nt, TriTrypDB). Changes in amino acids are indicated when different from Tb427tmp.01.7500 (boxed in red). *The amino acid sequence of Tb427tmp.01.7520 was generated by mutagenesis of T1028 in Tb427tmp.01.7520_G343V to G, thereby changing valine to glycine. Conserved nucleotides found in strain 427 and TREU927 are highlighted in blue or orange. N, unresolved nucleotides in strain 427.
https://doi.org/10.1371/journal.pone.0168775.s003
(PDF)
S1 Fig. Organization of AAT5 and AAT16 loci in the T. brucei genome.
(A) The 6 copies of the TbAAT5 locus of T. brucei are located on chromosome 8, i.e. Tb427.08.4700, Tb427.08.4710, Tb427.08.4720, Tb427.08.4730, Tb427.08.4740, and the 120 nt long pseudogene Tb427.08.4750. (B) The two copies of the TbAAT16 locus are found on chromosome 11, i.e. Tb427tmp.01.7500 and Tb427tmp.01.7520. Open reading frames (ORFs) and untranslated regions (UTRs) are based on the annotation in the reference strain TREU927. Regions used for qRT-PCR on RNA isolated from RNAi clones (to assess TbAAT5 or TbAAT16 down-regulation) or from parental cell lines (to compare transcript levels in BSF vs PCF) are indicated. UTR sequences are color-coded with similar colors representing high identity. Schemes are based on the TriTrypDB annotation (see http://tritrypdb.org).
https://doi.org/10.1371/journal.pone.0168775.s004
(PDF)
S2 Fig. Growth curve of TbAAT5-RNAi PCF T. brucei.
Growth of T. brucei procyclic forms after down-regulation of TbAAT5 by RNAi. Data points are mean values of three independent experiments ± SD. The inset shows Northern blot analysis of total RNA extracted from trypanosomes after 2 days of incubation in the absence (-) or presence (+) of tetracycline (Tet) and probed with 32P-labeled oligonucleotide fragments used as inserts for the respective stem-loop vectors. Ethidium bromide (EtBr) staining is shown as loading control. Northern blot was performed as described previously [53].
https://doi.org/10.1371/journal.pone.0168775.s005
(TIFF)
Acknowledgments
We thank Erwin Sigel (University of Bern) for providing Xenopus laevis oocytes. J.P.M. thanks L. C. Alves for encouragement and support.
Author Contributions
- Conceptualization: DR.
- Formal analysis: CM JPM DH MSG RSS.
- Funding acquisition: PM PB DR.
- Investigation: CM JPM DH CW ACH MSG AGS EI.
- Project administration: DR.
- Resources: EI DZ.
- Supervision: PM PB DZ DR.
- Visualization: CM JPM CW ACH MSG RSS DR.
- Writing – original draft: CM JPM DR.
- Writing – review & editing: CM JPM AGS RSS PM PB DZ DR.
References
- 1. Geerts S, Holmes PH, Eisler MC, Diall O. African bovine trypanosomiasis: the problem of drug resistance. Trends Parasitol. 2001;17: 25–28. pmid:11137737
- 2.
Programme Against African Trypanosomosis. Food and Agriculture Organization (FAO) [Internet]. Available: http://www.fao.org/ag/againfo/programmes/en/paat/disease.html
- 3. Evans DA, Brown RC. The utilization of glucose and proline by culture forms of Trypanosoma brucei. J Protozool. 1972;19: 686–690. pmid:4641906
- 4. Bringaud F, Rivière L, Coustou V. Energy metabolism of trypanosomatids: adaptation to available carbon sources. Mol Biochem Parasitol. 2006;149: 1–9. pmid:16682088
- 5. Chaudhary K, Roos DS. Protozoan genomics for drug discovery. Nature biotechnology. 2005.: 1089–1091. pmid:16151400
- 6. Darlyuk I, Goldman A, Roberts SC, Ullman B, Rentsch D, Zilberstein D. Arginine homeostasis and transport in the human pathogen Leishmania donovani. J Biol Chem. 2009;284: 19800–19807. pmid:19439418
- 7. Goldman-Pinkovich A, Balno C, Strasser R, Zeituni-Molad M, Bendelak K, Rentsch D, et al. An arginine deprivation response pathway is induced in Leishmania during macrophage invasion. PLoS Pathog. 2016;12: e1005494. pmid:27043018
- 8. Xiao Y, McCloskey DE, Phillips MA. RNA interference-mediated silencing of ornithine decarboxylase and spermidine synthase genes in Trypanosoma brucei provides insight into regulation of polyamine biosynthesis. Eukaryotic Cell. 2009;8: 747–755. pmid:19304951
- 9. Vincent IM, Creek DJ, Burgess K, Woods DJ, Burchmore RJS, Barrett MP. Untargeted metabolomics reveals a lack of synergy between nifurtimox and eflornithine against Trypanosoma brucei. PLoS Negl Trop Dis. 2012;6: e1618. pmid:22563508
- 10. Bacchi CJ, Garofalo J, Mockenhaupt D, McCann PP, Diekema KA, Pegg AE, et al. In vivo effects of alpha-DL-difluoromethylornithine on the metabolism and morphology of Trypanosoma brucei brucei. Mol Biochem Parasitol. 1983;7: 209–225. pmid:6193423
- 11. Fairlamb AH, Henderson GB, Bacchi CJ, Cerami A. In vivo effects of difluoromethylornithine on trypanothione and polyamine levels in bloodstream forms of Trypanosoma brucei. Mol Biochem Parasitol. 1987;24: 185–191. pmid:3114634
- 12. Hai Y, Kerkhoven EJ, Barrett MP, Christianson DW. Crystal structure of an arginase-like protein from Trypanosoma brucei that evolved without a binuclear manganese cluster. Biochemistry. 2015;54: 458–471. pmid:25536859
- 13. Pereira CA, Alonso GD, Paveto MC, Iribarren A, Cabanas ML, Torres HN, et al. Trypanosoma cruzi arginine kinase characterization and cloning: a novel energetic pathway in protozoan parasites. J Biol Chem. 2000;275: 1495–1501. pmid:10625703
- 14. Voncken F, Gao F, Wadforth C, Harley M, Colasante C. The phosphoarginine energy-buffering system of Trypanosoma brucei involves multiple arginine kinase isoforms with different subcellular locations. PLoS ONE. 2013;8: e65908. pmid:23776565
- 15. Aslett MA, Aurrecoechea C, Berriman M, Brestelli J, Brunk BP, Carrington M, et al. TriTrypDB: a functional genomic resource for the Trypanosomatidae. Nucleic Acids Res. 2010;38: D457–62. pmid:19843604
- 16. Berriman M, Ghedin E, Hertz-Fowler C, Blandin G, Renauld H, Bartholomeu DC, et al. The genome of the African trypanosome Trypanosoma brucei. Science. 2005;309: 416–422. pmid:16020726
- 17. Jackson AP. Origins of amino acid transporter loci in trypanosomatid parasites. BMC Evol Biol. 2007;7: 26. pmid:17319943
- 18. Baker N, Alsford S, Horn D. Genome-wide RNAi screens in African trypanosomes identify the nifurtimox activator NTR and the eflornithine transporter AAT6. Mol Biochem Parasitol. 2011;176: 55–57. pmid:21093499
- 19. Schumann Burkard G, Jutzi P, Roditi I. Genome-wide RNAi screens in bloodstream form trypanosomes identify drug transporters. Mol Biochem Parasitol. 2011;175: 91–94. pmid:20851719
- 20. Vincent IM, Creek DJ, Watson DG, Kamleh MA, Woods DJ, Wong PE, et al. A molecular mechanism for eflornithine resistance in African trypanosomes. PLoS Pathog. 2010;6: e1001204. pmid:21124824
- 21. Mathieu C, Gonzalez-Salgado A, Wirdnam C, Meier S, Suter Grotemeyer M, Inbar E, et al. Trypanosoma brucei eflornithine transporter AAT6 is a low affinity, low selective transporter for neutral amino acids. Biochem J. 2014.
- 22. Shaked-Mishan P, Suter Grotemeyer M, Yoel-Almagor T, Holland N, Zilberstein D, Rentsch D. A novel high-affinity arginine transporter from the human parasitic protozoan Leishmania donovani. Mol Microbiol. 2006;60: 30–38. pmid:16556218
- 23. Carrillo C, Canepa GE, Giacometti A, Bouvier LA, Miranda MR, de los Milagros Cámara M, et al. Trypanosoma cruzi amino acid transporter TcAAAP411 mediates arginine uptake in yeasts. FEMS Microbiol Lett. 2010;306: 97–102. pmid:20337715
- 24. Inbar E, Canepa GE, Carrillo C, Glaser F, Suter Grotemeyer M, Rentsch D, et al. Lysine transporters in human trypanosomatid pathogens. Amino Acids. 2012;42: 347–360. pmid:21170560
- 25. Henriques C, Miller MP, Catanho M, de Carvalho TMU, Krieger MA, Probst CM, et al. Identification and functional characterization of a novel arginine/ornithine transporter, a member of a cationic amino acid transporter subfamily in the Trypanosoma cruzi genome. Parasit Vectors. 2015;8: 346. pmid:26109388
- 26. Verrey F, Closs EI, Wagner CA, Palacin M, Endou H, Kanai Y. CATs and HATs: the SLC7 family of amino acid transporters. Pflugers Arch—Eur J Physiol. Springer-Verlag; 2004;447: 532–542.
- 27. Hatzoglou M, Fernandez J, Yaman I, Closs E. Regulation of cationic amino acid transport: the story of the CAT-1 transporter. Annu Rev Nutr. 2004;24: 377–399. pmid:15459982
- 28. Hammes UZ, Meier S, Dietrich D, Ward JM, Rentsch D. Functional properties of the Arabidopsis peptide transporters AtPTR1 and AtPTR5. J Biol Chem. 2010;285: 39710–39717. pmid:20937801
- 29. Edgar RC. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 2004;32: 1792–1797. pmid:15034147
- 30. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. MEGA6: molecular evolutionary genetics analysis version 6.0. Mol Biol Evol. 2013;30: 2725–2729. pmid:24132122
- 31. Dohmen RJ, Strasser AW, Höner CB, Hollenberg CP. An efficient transformation procedure enabling long-term storage of competent cells of various yeast genera. Yeast. 1991;7: 691–692. pmid:1776359
- 32. Tanaka J, Fink GR. The histidine permease gene (HIP1) of Saccharomyces cerevisiae. Gene. 1985;38: 205–214. pmid:3905514
- 33. Fischer W-N, Loo DDF, Koch W, Ludewig U, Boorer KJ, Tegeder M, et al. Low and high affinity amino acid H+-cotransporters for cellular import of neutral and charged amino acids. Plant J. 2002;29: 717–731. pmid:12148530
- 34. Jauniaux JC, Vandenbol M, Vissers S, Broman K, Grenson M. Nitrogen catabolite regulation of proline permease in Saccharomyces cerevisiae. Cloning of the PUT4 gene and study of PUT4 RNA levels in wild-type and mutant strains. Eur J Biochem. 1987;164: 601–606. pmid:3552672
- 35. Rentsch D, Laloi M, Rouhara I, Schmelzer E, Delrot S, Frommer WB. NTR1 encodes a high affinity oligopeptide transporter in Arabidopsis. FEBS Lett. 1995;370: 264–268. pmid:7656990
- 36. Wirtz LE, Leal S, Ochatt C, Cross GA. A tightly regulated inducible expression system for conditional gene knock-outs and dominant-negative genetics in Trypanosoma brucei. Mol Biochem Parasitol. 1999;99: 89–101. pmid:10215027
- 37. Serricchio M, Bütikofer P. Phosphatidylglycerophosphate synthase associates with a mitochondrial inner membrane complex and is essential for growth of Trypanosoma brucei. Mol Microbiol. 2013;87: 569–579. pmid:23190171
- 38. Baukrowitz T, Tucker SJ, Schulte U, Benndorf K, Ruppersberg JP, Fakler B. Inward rectification in KATP channels: a pH switch in the pore. EMBO J. 1999;18: 847–853. pmid:10022827
- 39. Oberholzer M, Morand S, Kunz S, Seebeck T. A vector series for rapid PCR-mediated C-terminal in situ tagging of Trypanosoma brucei genes. Mol Biochem Parasitol. 2006;145: 117–120. pmid:16269191
- 40. Mani J, Desy S, Niemann M, Chanfon A, Oeljeklaus S, Pusnik M, et al. Mitochondrial protein import receptors in Kinetoplastids reveal convergent evolution over large phylogenetic distances. Nat Commun. 2015;6: 6646. pmid:25808593
- 41. Rentsch D, Hirner B, Schmelzer E, Frommer WB. Salt stress-induced proline transporters and salt stress-repressed broad specificity amino acid permeases identified by suppression of a yeast amino acid permease-targeting mutant. Plant Cell. 1996;8: 1437–1446. pmid:8776904
- 42. Brenndörfer M, Boshart M. Selection of reference genes for mRNA quantification in Trypanosoma brucei. Mol Biochem Parasitol. 2010;172: 52–55. pmid:20302889
- 43. Jones NG, Thomas EB, Brown E, Dickens NJ, Hammarton TC, Mottram JC. Regulators of Trypanosoma brucei cell cycle progression and differentiation identified using a kinome-wide RNAi screen. PLoS Pathog. 2014;10: e1003886. pmid:24453978
- 44. Siegel TN, Hekstra DR, Wang X, Dewell S, Cross GA. Genome-wide analysis of mRNA abundance in two life-cycle stages of Trypanosoma brucei and identification of splicing and polyadenylation sites. Nucleic Acids Res. 2010;38: 4946–4957. pmid:20385579
- 45. Nilsson D, Gunasekera K, Mani J, Osteras M, Farinelli L, Baerlocher L, et al. Spliced leader trapping reveals widespread alternative splicing patterns in the highly dynamic transcriptome of Trypanosoma brucei. PLoS Pathog. 2010;6: e1001037. pmid:20700444
- 46. Kolev NG, Franklin JB, Carmi S, Shi H, Michaeli S, Tschudi C. The transcriptome of the human pathogen Trypanosoma brucei at single-nucleotide resolution. PLoS Pathog. 2010;6: e1001090. pmid:20838601
- 47. Young GB, Jack DL, Smith DW, Saier MH. The amino acid/auxin:proton symport permease family. Biochim Biophys Acta. 1999;1415: 306–322. pmid:9889387
- 48. Käll L, Krogh A, Sonnhammer ELL. Advantages of combined transmembrane topology and signal peptide prediction—the Phobius web server. Nucleic Acids Res. 2007;35: W429–32. pmid:17483518
- 49. Tusnády GE, Simon I. Principles governing amino acid composition of integral membrane proteins: application to topology prediction. J Mol Biol. 1998;283: 489–506. pmid:9769220
- 50. Rentsch D, Schmidt S, Tegeder M. Transporters for uptake and allocation of organic nitrogen compounds in plants. FEBS Lett. 2007;581: 2281–2289. pmid:17466985
- 51. Schiöth HB, Roshanbin S, Hägglund MGA, Fredriksson R. Evolutionary origin of amino acid transporter families SLC32, SLC36 and SLC38 and physiological, pathological and therapeutic aspects. Mol Aspects Med. 2013;34: 571–585. pmid:23506890
- 52. de Koning HP, Watson CJ, Jarvis SM. Characterization of a nucleoside/proton symporter in procyclic Trypanosoma brucei brucei. J Biol Chem. American Society for Biochemistry and Molecular Biology; 1998;273: 9486–9494.
- 53. Gonzalez-Salgado A, Steinmann ME, Greganova E, Rauch M, Mäser P, Sigel E, et al. myo-Inositol uptake is essential for bulk inositol phospholipid but not glycosylphosphatidylinositol synthesis in Trypanosoma brucei. J Biol Chem. 2012;287: 13313–13323. pmid:22351763
- 54. Macêdo JP, Schmidt RS, Mäser P, Rentsch D, Vial HJ, Sigel E, et al. Characterization of choline uptake in Trypanosoma brucei procyclic and bloodstream forms. Mol Biochem Parasitol. 2013;190: 16–22. pmid:23747277
- 55. Claros MG, Vincens P. Computational Method to Predict Mitochondrially Imported Proteins and their Targeting Sequences. Eur J Biochem. 1996;241: 779–786. pmid:8944766
- 56. Emanuelsson O, Nielsen H, Brunak S, Heijne von G. Predicting subcellular localization of proteins based on their N-terminal amino acid sequence. J Mol Biol. 2000;300: 1005–1016. pmid:10891285
- 57. Schlüter A, Real-Chicharro A, Gabaldón T, Sánchez-Jiménez F, Pujol A. PeroxisomeDB 2.0: an integrative view of the global peroxisomal metabolome. Nucleic Acids Res. 2010;38: D800–5. pmid:19892824
- 58. Landfear SM, Tran KD, Sanchez MA. Flagellar membrane proteins in kinetoplastid parasites. IUBMB Life. 2015;67: 668–676. pmid:26599841
- 59. Oberholzer M, Langousis G, Nguyen HT, Saada EA, Shimogawa MM, Jonsson ZO, et al. Independent analysis of the flagellum surface and matrix proteomes provides insight into flagellum signaling in mammalian-infectious Trypanosoma brucei. Mol Cell Proteomics. 2011;10: M111.010538. pmid:21685506
- 60. Subota I, Julkowska D, Vincensini L, Reeg N, Buisson J, Blisnick T, et al. Proteomic analysis of intact flagella of procyclic Trypanosoma brucei cells identifies novel flagellar proteins with unique sub-localization and dynamics. Mol Cell Proteomics. 2014;13: 1769–1786. pmid:24741115
- 61. Colasante C, Alibu VP, Kirchberger S, Tjaden J, Clayton CE, Voncken F. Characterization and developmentally regulated localization of the mitochondrial carrier protein homologue MCP6 from Trypanosoma brucei. Eukaryotic Cell. 2006;5: 1194–1205. pmid:16896205
- 62. Colasante C, Voncken F, Manful T, Ruppert T, Tielens AGM, van Hellemond JJ, et al. Proteins and lipids of glycosomal membranes from Leishmania tarentolae and Trypanosoma brucei. F1000Res. 2013;2: 27. pmid:24358884
- 63. Güther MLS, Urbaniak MD, Tavendale A, Prescott A, Ferguson MAJ. High-confidence glycosome proteome for procyclic form Trypanosoma brucei by epitope-tag organelle enrichment and SILAC proteomics. J Proteome Res. 2014;13: 2796–2806. pmid:24792668
- 64. Creek DJ, Nijagal B, Kim D-H, Rojas F, Matthews KR, Barrett MP. Metabolomics guides rational development of a simplified cell culture medium for drug screening against Trypanosoma brucei. Antimicrob Agents Chemother. 2013;57: 2768–2779. pmid:23571546
- 65. Fotiadis D, Kanai Y, Palacin M. The SLC3 and SLC7 families of amino acid transporters. Mol Aspects Med. 2013;34: 139–158. pmid:23506863
- 66. Pereira CA, Alonso GD, Paveto MC, Flawiá MM, Torres HN. L-arginine uptake and L-phosphoarginine synthesis in Trypanosoma cruzi. J Eukaryot Microbiol. 1999;46: 566–570. pmid:10568030
- 67. Pereira CA, Alonso GD, Ivaldi S, Silber AM, Alves MJM, Torres HN, et al. Arginine kinase overexpression improves Trypanosoma cruzi survival capability. FEBS Lett. 2003;554: 201–205. pmid:14596940
- 68. Wishart DS, Jewison T, Guo AC, Wilson M, Knox C, Liu Y, et al. HMDB 3.0—The Human Metabolome Database in 2013. Nucleic Acids Res. 2013;41: D801–7. pmid:23161693
- 69. Kandpal M, Fouce RB, Pal A, Guru PY, Tekwani BL. Kinetics and molecular characteristics of arginine transport by Leishmania donovani promastigotes. Mol Biochem Parasitol. 1995;71: 193–201. pmid:7477101
- 70. Canepa GE, Silber AM, Bouvier LA, Pereira CA. Biochemical characterization of a low-affinity arginine permease from the parasite Trypanosoma cruzi. FEMS Microbiol Lett. 2004;236: 79–84. pmid:15212794