Plant materials
Banana cv. Grand naine (ITC 1256) plantlets were obtained from the International Transit Centre (ITC) of Musa collection at Katholieke Universitiet Leuven, Belgium. The plantlets were propagated and maintained in banana multiplication media (Plantigen™ HIMEDIA, India) according to the manufacturer’s protocol. Subsequently, the plantlets were transferred onto rooting media (Plantigen™ HIMEDIA, India) for a month until reaching a five-leaf-stage prior to transplantation into either soil or hydroponic culture media.
Cloning of mature 16D10 gene sequence into pCAMBIA1304 expression vector
We synthesised 16D10 gene sequence published by [39] in pUC57 vector (NextGene, Malaysia). Mature peptide (denoted as m16D10) was used in this experiment. m16D10 gene was cloned to pCAMBIA1304 expression vector with 35S promoter driving its expression. For cloning purposes, the primer pair m16D10F 5’ CATCCATGGGCAAAAAGCCTAG 3’/ m16D10R 5’ GACCTCCTTTATTAAGGTACCGAT 3’ was designed to include NcoI restriction enzyme (RE) site (sequence underlined) to create sticky ends to the amplified m16D10 fragment. PCR was conducted in a thermocycler (peqSTAR, USA) with amplification profile consisted of an initial denaturation step at 94 °C for 3 minutes, followed by 35 cycles of a denaturation step at 94 °C for 1 min, an annealing step at 52 °C for 1 min, an elongation step at 72 °C for 44 sec, and a final extension step at 72 °C for 5 min. A total of 5 μL PCR product were then subjected to agarose gel electrophoresis (AGE) analysis. PCR product with the correct expected size (~55 bp) was purified using QIAquick gel extraction kit (Qiagen, USA) according to the manufacturer’s protocol. Both pCAMBIA1304 vector and the purified m16D10 gene were digested with NcoI enzyme and purified again prior to cloning. Both purified products were ligated using T4 DNA ligase (NEB, UK), producing pCAMBIA1304::CaMV35S::m16D10::mgfp5::GUS::6xHis expression cassette (Figure 3). We then propagated the plasmid in Escherichia coli (JM109) bacterial system.
Plasmid isolation from Escherichia coli and sequence analysis of cloned m16D10 fragment
Plasmid DNA was isolated from Escherichia coli cell lysate to detect the presence of m16D10 cloned fragment via PCR using the same primer pair. We confirmed the nucleotide sequence of the construct via one pass sequencing procedure using CaMV35S promoter region primer 5’ CTTTATTGTGAAGATAGTGGA 3’. Sequencing result was analysed using Chromas (Technelysium Pty Ltd, Australia) and subjected to BLASTn analysis at the GenBank [62]. Only clones with correct sequence and orientation were transformed into Agrobacterium tumefaciens strain LBA4404.
Transformation of pCAMBIA1304::CaMV35S::m16D10::mgfp5::GUS::6xHis into A. tumefaciens LBA4404 cells and preparation of transformation solution
pCAMBIA1304::CaMV35S::m16D10::mgfp5::GUS::6xHis was transformed into A. tumefaciens LBA4404 competent cells using a freeze-thaw method as described in [63]. Positive colonies harbouring the desired construct were selected using Kanamycin antibiotic. Plasmids were isolated from the surviving colonies and sent for sequencing to confirm the sequence and orientation of the construct. We also confirmed the expression of plasmid construct in A. tumefaciens clones using β-glucuronidase (GUS) histochemical assay.
GUS assay was conducted on putatively transformed A. tumefaciens cells as described in [64]. Briefly, the bacterial cells were incubated in a GUS solution (0.1 M NaPO4, 10 mM EDTA pH 8, 0.1% Triton X-100, 1 mM K3Fe(CN)6, 2 mM X-Glucuronide) at 37 °C for 16 hours. GUS gene, expressing β-Glucuronidase (GUS) enzyme hydrolyses X-Glucuronide substrate at 37 °C. The product of the hydrolysation i.e. Glucuronide, dimerised in the presence of oxygen to form an insoluble blue precipitate of chloro-bromoindigo [65], yielding blue-stained bacterial cells that are visible to the naked eye. The observation was photographed. We expected that m16D10 gene was also expressed in this construct since GUS gene is located downstream of m16D10 in the expression cassette and the expression was driven by the same promoter (Figure 3). Only clones with expressed cassettes were subjected to in planta root transformation procedure.
Transformation solution was prepared according to [66]. Briefly, 200 µL of inoculated A. tumefaciens glycerol stock were cultured overnight in Luria-Bertani (LB) media (LB 20 g/L concentration, 50 μg/mL Kanamycin) at 28°C with 200 rpm shaking in a dry incubator. The culture was transferred into sterile 50 mL Falcon tubes once the O.D600 value reached 1.0 and centrifuged at 4000 x g, 4 °C for 10 minutes to pellet the cells. The pelleted cells were then diluted with sterile LB media (pH 6) until O.D600 value reached 0.3. This transformation solution was then used to transform A. tumefaciens harbouring pCAMBIA1304::CaMV35S::m16D10::mgfp5::GUS::6xHis into banana root tissues, in planta.
Transformation of soil-grown banana root tissues with A. tumefaciens (LBA 4404) cells harbouring pCAMBIA1304::CaMV35S::m16D10::mgfp5::GUS::6xHis
We conducted plant root transformation procedure using single inoculation protocol adopted from [67] with slight modifications. Instead of using nematode individuals, we used transformed A. tumefaciens cells harbouring pCAMBIA1304::CaMV35S::m16D10::mgfp5::GUS::6xHis as an inoculum. Soil mixture used in this study was first autoclaved at 121 °C for 15 minutes. A batch of 10 banana tissue cultured plantlets were transplanted into 1L pots containing a mixture of soil (black soil, burnt soil, compost, clay and coconut fibre) and sand at 3:1 ratio (Glorious Nursery, Malaysia). These plantlets were left to acclimatise in a growth room at 30 ± 2 °C with 12 hours photoperiod for three months. Subsequently, root tissues with a diameter ranging from 0.4 cm to 0.6 cm were selected for A. tumefaciens-mediated transformation assay. Three plants were treated with transformed A. tumefaciens cells while another three served as negative control plants, were inoculated with non-transformed A. tumefaciens cells. Three root strands were selected per plant for the treatment. Selected roots were first washed with distilled water, tapped on a C -fold towel and let dry for a few minutes. The roots were then scarred along its length using a sterile scalpel and placed across a 90 x 15 mm petri dish. We inoculated 200 µL transformation solution containing A. tumefaciens cells onto each of the scarred root fragment. The treated root fragments were then covered in soil and were harvested 24 hours post-inoculation (hpi). A fragment of the harvested roots in each treatment was subjected to β-glucuronidase (GUS) histochemical assay to confirm the presence of transformed cells in the root tissues, while others were subjected to protein extraction procedure.
Transformation of hydroponic- grown banana root tissues with A. tumefaciens (LBA 4404) cells harbouring pCAMBIA1304::CaMV35S::m16D10::mgfp5::GUS::6xHis
A batch of eight plantlets were transplanted into an in-house-designed hydroponic system made of used 1L mineral water bottles (Figure 9a). The plantlets were acclimatised in commercially available hydroponic media (Kazz Hidroponik, Malaysia), in a growth room at 30 ± 2 °C with 12 hours photoperiod for two months. During the acclimatisation period, the medium was replaced once a week while the container was washed every two weeks with 6% bleach to prevent algal or microbial contaminations.
Similar to A. tumefaciens-mediated transformation carried out on banana roots grown in soil, root strands with a diameter ranging from 0.4 cm to 0.6 cm were selected to be transformed. However, for hydroponic-grown root tissues, treatment was conducted using syringe-based agroinfiltration technique (Figure 9b). Four plants were treated with 2 mL transformation solution containing transformed A. tumefaciens cells using a sterile 3 cc/mL Terumo® syringe and needle while another four served as negative control plants, inoculated with untransformed A. tumefaciens cells. Treatment was terminated at four time points, i.e 1- day post inoculation (dpi), 3-, 5-, and 15- dpi. Two fragments of harvested root tissues of each time point were subjected to GUS assay, while others were subjected to protein extraction procedure.
GUS histochemical assay on transformed banana root tissues and estimation of transformed root area
GUS histochemical assay was carried out as described above on harvested root fragments to gauge the percentage of transformed areas on the root tissues. Briefly, harvested root tissues were submerged in GUS staining solution [(0.1 M NaPO4, 10 mM EDTA pH 8, 0.1% Triton X-100, 1 mM K3Fe(CN)6, 2 mM X-Glucuronide] in a 15 mL Falcon tube and later incubated at 37°C for 16 hours. Images were photographed. Estimation of transformed root area was made on these photographed images using ImageJ software [68] based on the number of pixels that made the image up. The percentage (%) of transformed root area for each root fragment was defined as [(the total number of pixels of GUS-stained root area / the total number of pixels of the whole root fragment) x 100], with final values obtained rounded. For this analysis, triplicates were used for root tissues grown in soil while duplicates were used for those grown in hydroponic culture for each time-point.
Total crude protein isolation from A. tumefaciens (LB4404) cells
Total crude protein was isolated from A. tumefaciens (LB4404) as described in [69] with slight modifications. Briefly, 200 µL A. tumefaciens cells were cultured in 1 L Luria-Bertani (LB) media containing 50 μg/mL Kanamycin at 28°C with 200 rpm shaking overnight in an incubator (N-Biotek, South Korea), until the value of O.D600 reached 1.0. The culture was then transferred into four sterile 250 mL Nalgene bottles and centrifuged at 4000 x g, 4 °C, for 10 minutes. Subsequently, the supernatants were discarded, and the pellets were stored at -80°C. To harvest the protein, the pellets were subjected to four cycles of freeze-thaw procedure which includes freezing at - 80°C for 10 minutes and thawing at 0 °C (ice-water bath) for 20 minutes. The pellets were then resuspended in a resuspension buffer [10% Glycerol, 25 mM Tris-HCl pH 7.5, 1 mM EDTA, 150 mM NaCl, 0.1% Tween 20 and 1 tablet /10ml EDTA-free protease inhibitor cocktail (Roche, Germany)] as described in [70]. The resuspended solution was transferred into a fresh 15 mL Falcon tube and incubated in ice for 60 minutes. Soluble protein sample was collected by subjecting the sample to a centrifugation step at 6000 x g, 4 °C for 15 minutes. The isolated total protein was either used as a positive control to detect expressed protein or used in the ‘spiking’ experiment.
Total crude protein isolation from banana root tissues and protein purification using nickel His GravitrapTM affinity column
Total crude protein was isolated from harvested root fragments according to [71] with slight modifications. Briefly, the harvested root tissues were ground into fine white powder in the presence of liquid nitrogen using a sterile mortar and pestle pair. Approximately 100 - 150 mg banana root powder were mixed with 5 mL of ice-cold extraction buffer [25 mM Tris-HCl pH 7.6, 15 mM MgCl2, 150 mM NaCl, 0.1% Triton X, 0.1 mM Na3VO4, 1 mM NaF, 1 mM PMSF, 1 µM E-64, 5% Ethylene glycol, 60 mM β-glycerophosphate and 1 tablet/10mL EDTA-free protease inhibitor cocktail (Roche, Germany)] in a sterile 15 mL Falcon tube. Subsequently, 0.1% (vol/vol) Benzonase were added to the mixture and incubated at 4 °C for 30 minutes. Subsequently, the tube was centrifuged for 10 minutes, 6500 x g, 4 °C, and the resulting supernatant transferred into sterile 2 mL microcentrifuge tubes. The samples were later centrifuged at the maximum speed (6500 x g), 4 °C for 30 minutes or until a clear supernatant was obtained. The supernatant was then transferred into fresh Falcon tubes and either subjected to protein purification step or stored at -80 °C. To analyse the quality of extracted crude protein, 10 µl of the extract were subjected to SDS-PAGE and western blot analysis.
Protein purification step was carried out by subjecting 30 mL total crude root protein to nickel His GravitrapTM purification column (GE Healthcare, Sweden) according to the manufacturer’s protocol. Purified protein was eluted with an elution buffer (20 mM Sodium phosphate, 500 mM NaCl, 500 mM Imidazole), and quantified using Bradford assay. Purified sample was subjected to SDS-PAGE and western blot analysis.
SDS-PAGE and western blot assay
Total crude root protein extract or nickel-purified root protein (1 µg/µl) was separated by SDS-PAGE at 180V for 1hr (Bio-rad, USA), and stained with Coomassie blue solution [50% (v/v) methanol, 0.05% (v/v) Coomassie Brilliant Blue R250, 10% (v/v) acetic acid]. For western blot analysis, the electrophoresed protein sample on SDS-PAGE gel were transferred onto a nitrocellulose membrane (GE Healthcare, USA). The membrane was blocked with skimmed milk (2.5 g of skim milk in 50 mL of 1X TBS) at 4 °C overnight then blotted with 2 µg anti-GUS primary antibody (ID# ab188492; Abcam, USA) and 2 µg anti-mouse IgG- alkaline phosphatase, produced in goat secondary antibody (Cat. #SLBB9232, Sigma-Aldrich, USA). Protein bands on SDS-PAGE and membrane were photographed.
Determination of minimum amount of m16D10 protein signal in the purified root protein product detectable in western blot assay
An experiment referred to as ‘spiking’ experiment was conducted to determine the minimum amount of m16D10 protein detectable in western blot assay after the total root protein purification step. To mimic the expression of pCAMBIA1304::CaMV35S::m16D10::mgfp5::GUS::6xHis in transformed root tissues, we spiked 15 mg total crude root protein sample with different amounts of m16D10 protein that were expressed in A. tumefaciens. m16D10 protein amounts used in this experiment were 3.75 mg, 7.5 mg, 11.25 mg, and 15 mg. This made up the ratio of bacterial protein: crude plant root protein amount of 0.25:1, 0.5:1, 0.75:1 and 1:1, respectively. The protein mixture was then subjected to a purification step, quantification step, and western blot assay as described above.