1. Mouse genome mutagenesis
Mouse genome mutagenesis was carried out through the CRISPR/Cas9 gene editing approach in one-cell-stage embryos. A mixture of Cas9 protein 100 ng/μl (Alt. R S.p. Cas9 Nuclease 3NLS IDT Cat # 1074181), single guide RNAs (sgRNA) 200 ng/μl, and ssODN (DNA template) 200 ng/μl was transfected into the embryos through electroporation using the Super Electroporator NEPA21 type II and CUY 501-1-1.5 electrode (NEPA GENE Co. Ltd, Chiba, Japan). According to the original reported mutation sites in Adar1 gene found in AGS patients (33), we designed 8 sets of sgRNAs and mutant oligos to target the mouse genome at the genetic positions equivalent to each of the missense mutations of AGS patients (Supplemental Fig. 1). The sgRNAs were synthesized by in vitro transcription (MAXIscript™ T7 Transcription Kit, Thermo Fisher) from PCR products harboring the guide RNA sequences. Then, the sgRNAs were purified using RNA Cleanup kit (Qiagen), according to the manufacturer’s instructions. The ssODN oligos were synthesized by Integrated DNA Technologies (IDT), with each of the ssODN carrying one of the ADAR1 mutations. The electroporated embryos were washed two times in KSOM medium, then maintained in KSOM medium overnight at 5% CO2 at 37°C. The following day, the two-cell-stage embryos were transferred to the oviducts of pseudopregnant CD1 females (0.5 dpc). The potential founders carrying the designed mutation at the targeted ADAR1 loci were screened among the living pups. Multiple trials were performed for each mutation site. Sanger sequencing was used for genome sequence screening after PCR amplification of the targeted gene regions. In this study we only succeeded with two of the designed mutations (see result section), the c.2844 G>T mutation (equivalent to c.2997 G>T in patients), encoding the change for p.K948N in mouse ADAR1 protein, which is equivalent to the p.K999N mutation found in AGS patients, and the c. 583 C>G mutation (c.577 C>G in patients), encoding the change for p.P195A, equivalent to the human p.P193A mutation (9,33). For the K948N mutation, the sgRNA sequence was 5’-gcaaggcaagcttcgcacca-3’. The ssODN sequence for the G to T mutation at 2997 of ADAR1 gene was 5’-gtgccgtggaaagcacagagtcccgccattaccctgtctttgaaaatcccaagcaaggcaatcttcgcaccaaagtggagaatggtgagtggtaggtgccagctggcagtgaggagacatgcacgcgaggggtgtccgcttcctt-3’. The primer sequences used for amplifying the region flanking K999N mutation were 5’-tgccagttcccacataggat-3’ and 5’-agtccagtgacacccacctc-3’. For P195A mutation, the sgRNA sequence was 5’-gcaaggcaagcttcgcacca-3’. The ssODN sequence for the G to T mutation at 583 of Adar1 gene was 5’-gtgccgtggaaagcacagagtcccgccattaccctgtctttgaaaatcccaagcaaggcaatcttcgcaccaaagtggagaatggtgagtggtaggtgccagctggcagtgaggagacatgcacgcgaggggtgtccgcttcctt-3’. The primer sequences used for amplifying the region flanking K999N mutation were 5’-tgccagttcccacataggat-3’ and 5’-agtccagtgacacccacctc-3’.
Founders carrying the designed mutations were bred to homozygosity for phenotypic analysis.
2. Genotyping analysis
PCR genotyping approaches were established for the two mutant mouse lines. For K948N mutation, the sequences of the primers are 5’-aaaatcccaagcaaggcaag-3’ and 5’-gctgtgtggtgactgcattt-3’ for wild type allele, 5’-cacactgccaagaacagcat-3’ and 5’-ctccactttggtgcgaaga-3’ for mutant allele. PCR conditions were 94 oC 4 min, 94 oC 30 sec, 63 oC 30 sec, 72 oC 30 sec for 30 cycles. For P195A mutation, the sequences of the primers are 5’-aaaatcccaagcaaggcaag-3’ and 5’-gctgtgtggtgactgcattt-3’ for wild type allele, 5’-cacactgccaagaacagcat-3’ and 5’-ctccactttggtgcgaaga-3’ for mutant allele. PCR conditions were 94 oC 4 min, 94 oC 30 sec, 63 oC 30 sec, 72 oC 30 sec for 30 cycles. These PCR conditions were optimized to identify the single nucleotide replacements and distinguish the mutation from the wild type gene alleles.
3. Mouse breeding and phenotype observation
Mice were hosted in a SPF animal facility in University of Pittsburgh School of Medicine with strict monitoring of temperature, humidity, light cycles, and potential presence of pathogens. Studies were approved by IACUC at the University of Pittsburgh. The mice were observed from birth to adulthood for growth, behavioral change, and signs of neuropathy. The body weights of the mice, together with their littermates, were measured weekly. PCR genotyping was performed on each of the mice at 2-3 weeks of age to determine their genetic status.
4. Protein structure modeling and comparison
Mouse and human ADAR1 protein sequences, Q99MU3 and P55265 in UniPro protein database, were used for protein modeling and structure comparison. The protein structure modeling software package Modeller (34) was used for the protein structure prediction; human ADAR2 crystal structure (PDB Code 1ZY7) was used as the template for the modeling. 22 amino acids, AA922-943 in mouse ADAR1 sequence, were skipped as the corresponding structure is not found in the template. The molecular dynamics simulation software package AMBER (AMBER 2018. University of California, San Francisco 2018) was used for the structural refinement. Modeling was conducted both for mouse and for human sequences.
5. Pathology study
Histopathologic studies were carried out on formalin fixed paraffin embedded (FFPE) mouse tissues including brain, skin, heart, lung, liver, spleen, and kidney. Tissues were harvested and immersion fixed in 4% paraformaldehyde in phosphate buffered saline followed by dehydration, paraffin embedding, and routine pathologic processing. Hematoxylin and eosin (H&E), Von Kossa and Luxol Fast Blue staining were performed on tissue sections.
6. Immunohistochemistry
Five-micron thick sections from paraffin embedded brain blocks were immunohistochemically stained for glial fibrillary acidic protein (GFAP) and Ionized calcium binding adaptor molecule 1 (Iba1) with antibodies; mouse anti-GFAP(catalog# 837202, BioLegend) and rabbit anti-IBA-1 (catalog# WDG5619, WAKO) each at a dilution of 1:1000, followed by secondary antibodies and peroxidase development (35).
7. RNA in situ hybridization
ISH studies were performed on FFPE tissue sections using 2 commercial RNAscope Target Probes (Advanced Cell Diagnostics, Hayward, CA) catalog # 559271 and 408921 complementary to sequences 2-561 of ISG-15 and 11-1012 of CXCL10 respectively. Pretreatment, hybridization and detection techniques (RNAscope 2.5HD) were performed according to manufacturer’s protocols and as previously described (36).
8. Protein sample preparation and analysis
Before tissues were collected from the mice, whole body perfusion with PBS with heparin was performed to remove the blood from the organs. The tissues were immediately frozen in liquid nitrogen until analysis. For the brain sample collections, the cerebellum and olfactory bulb were removed prior to freezing. Homogenization was performed in RIPA buffer with the addition of protease inhibitor cocktail. ADAR1 protein in the brain tissues were detected by Western blot as described previously18. In brief, 30ug of protein extract was loaded to each lane and separated on 8% polyacrylamide gel with 0.1% SDS. ADAR1 was detected with ADAR1 antibody clone 15.8.6 (Santa Cruz sc-73408) at 1:1,000 dilution.
9. RNA sample preparation and qRT-PCR
RNA isolation was performed with RNeasy Plus Mini Kit (Qiagen Cat # 74134) following manufacturer’s instructions. Quantitative RT-PCR was performed using the iTaqTM Universal SYBR Green One-Sep Kit (Bio-Rad cat #1725151). Assayed genes comprised ISG15,Ccl-5,Ccl-10,Ifit-1,Ifit3,Oasl-1,Oasl-2,Mx2,IL-6,TNF α,Xaf1,IFI 27,Oas1c,IL-1,IFN-α,IFN-β,GAPDH and HPRT. Primer sequences are listed in Supplemental material. The specificity of PCR amplifications was confirmed by the melting curve and by electrophoresis analysis of the final PCR products. The quantification of the mRNA levels was calculated by the Ct values using ΔΔt method with internal references of the average value of the HPRT and GADH expressions.
10. Cytokine and chemokine assays
Forty-five (45) cytokines and chemokines were measured utilizing Luminex® xMAP® technology. The multiplexing analysis was performed using the Luminex™ 200 system (Luminex, Austin, TX, USA) by Eve Technologies Corp. (Calgary, Alberta, Canada). Forty-five markers were simultaneously measured in the samples using a MILLIPLEX Mouse Cytokine/Chemokine 32-plex kit and a MILLIPLEX Mouse Cytokine/Chemokine 13-plex kit (Millipore, St. Charles, MO, USA) according to the manufacturer's protocol. The 45-plex consisted of Eotaxin, Erythropoietin, 6Ckine, Fractalkine, G-CSF, GM-CSF, IFNB1, IFNγ, IL-1α, IL-1β, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-9, IL-10, IL-11, IL-12 (p40), IL-12 (p70), IL-13, IL-15, IL-16, IL-17, IL-20, IP-10, KC, LIF, LIX, MCP-1, MCP-5, M-CSF, MDC, MIG, MIP-1α, MIP-1β, MIP-2, MIP-3α, MIP-3B, RANTES, TARC, TIMP-1, TNFα, and VEGF. The assay sensitivities of these markers range from 0.3 – 30.6 pg/mL.
11. Liver function assays
Mouse blood was taken via cardiopuncture and serum was collected and frozen at -80oC until analysis. ALT, AST, and total bilirubin were measured at the central laboratory at UPMC pathology core.
12. RNA editing essays
Total brain RNA was isolated from undissected whole brains, and reverse transcript PCR was performed with the total RNA samples. The PCR products of the entire brain RNA pool were subjected to Sanger sequencing analysis. The relative quantities of inosine (read as guanosine) and adenosine at each editing site were determined on the chromatographs by the ratio of the G and A peaks. The primer sequences used for the PCR amplifications of the editing sites were 5’-cactgaggaatttgaagatgga-3’ and 5’-agcaggcatggaatgatagg-3’ (for the GRIA2 Q/R site and the intron hot spots), 5’-cttgcgacaccatgaaagtg-3’ and 5’-gccagaaatgtgggtaaagg-3’ (for the GRIA2 R/G site), 5’-agcagagaaagccgtgtgat-3’ and 5’-agaacaccacatccatgcaa-3’ (for the GRIA3 R/G site), 5’-acccgtgcaaccctgact-3’ and 5’-ttgcaggaaattttgtccagt-3’ (for the GRIK1 Q/R site), 5’-attatgtctggcctttacctagatat-3’ and 5’-ataggaactgaaactcctattgatattgc-3’ (for the editing sites A to E in 5-HT 2cR mRNA). RNA editing efficiency was assessed on the editing sites in GRIA2, GRIA3, GRIK1 mRNAs for the Q/R and R/G sites and on the A-E sites in 5-HT2C receptor mRNA by calculation of the relative ratio of the average of G peak to A peak on each of the Sanger sequencing chromatograph for samples from mutant and wild type groups.
13. Data analysis
Continuous data was summarized using median and interquartile or mean and standard deviation. Categorical data was summarized using frequency and percentages. Scatter plots and bar graphs were used to illustrate differences and relationships. For comparison of between two groups of nonparametric data, Wilcoxon rank sum test was used test differences between two independent groups and Wilcoxon signed-rank test was used to compare two related samples. To test the differences between more than two groups non-parametrically, Kruskal–Wallis test by ranks was used and followed with the post-hoc Conover test for pairwise multiple comparisons procedure upon the rejecting the null of Kruskal–Wallis test. To test the correlation between data non-parametrically, Spearman's rank-order correlation test was used to compare Spearman's rank correlation coefficient (rho) and test for differences. All test used in the analysis were of two-sided nature with p<0.05 was referred as statistically. Prism - GraphPad. Was used to generate graphs and Stata software version 12.0 (StataCorp, College Station, TX), was used was used in conducting statistical testing.