Small Extracellular Vesicles from Peripheral Blood of Aged Mice Pass the Blood-Brain Barrier and Induce Glial Cell Activation
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animal Experiments
2.2. sEV Isolation and Labeling
2.3. sEV Characterization by Nanoparticle-Tracking Analysis (NTA), Western Blot Analysis, and Cryo-Transmission Electron Microscopy (Cryo-TEM)
2.4. Assessment of sEV Uptake by Immunofluorescence
2.5. Analysis of Gene Expression
2.6. Statistical Analysis
3. Results
3.1. Isolation and Characterization of sEV Fractions from Young and Aged Mice
3.2. Localization of Peripherally Injected sEV in Recipient Mice
3.3. sEVs from Old Animals Alter Gene Expression in Brain Tissue In Vivo
3.4. Differential Effect of Aged and Young sEVs on Gene Expression in the Brain
3.5. Uptake of Peripheral sEVs by Microglia and Astrocyte Cells In Vitro
3.6. Effect of Aged and Young sEVs on Gene Expression In Vitro
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ratajczak, J.; Wysoczynski, M.; Hayek, F.; Janowska-Wieczorek, A.; Ratajczak, M.Z. Membrane-derived microvesicles: Important and underappreciated mediators of cell-to-cell communication. Leukemia 2006, 20, 1487–1495. [Google Scholar] [CrossRef] [PubMed]
- Thion, M.S.; Low, D.; Silvin, A.; Chen, J.; Grisel, P.; Schulte-Schrepping, J.; Blecher, R.; Ulas, T.; Squarzoni, P.; Hoeffel, G.; et al. Microbiome Influences Prenatal and Adult Microglia in a Sex-Specific Manner. Cell 2018, 172, 500–516 e516. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, J.J.; Wang, B.; Kodali, M.C.; Chen, C.; Kim, E.; Patters, B.J.; Lan, L.; Kumar, S.; Wang, X.; Yue, J.; et al. In vivo evidence for the contribution of peripheral circulating inflammatory exosomes to neuroinflammation. J. NeuroInflamm. 2018, 15, 8. [Google Scholar] [CrossRef] [PubMed]
- Sparkman, N.L.; Johnson, R.W. Neuroinflammation associated with aging sensitizes the brain to the effects of infection or stress. Neuroimmunomodulation 2008, 15, 323–330. [Google Scholar] [CrossRef] [Green Version]
- Thery, C.; Zitvogel, L.; Amigorena, S. Exosomes: Composition, biogenesis and function. Nat. Rev. Immunol. 2002, 2, 569–579. [Google Scholar] [CrossRef]
- Ransohoff, R.M. How neuroinflammation contributes to neurodegeneration. Science 2016, 353, 777–783. [Google Scholar] [CrossRef]
- Eitan, E.; Green, J.; Bodogai, M.; Mode, N.A.; Baek, R.; Jorgensen, M.M.; Freeman, D.W.; Witwer, K.W.; Zonderman, A.B.; Biragyn, A.; et al. Age-Related Changes in Plasma Extracellular Vesicle Characteristics and Internalization by Leukocytes. Sci. Rep. 2017, 7, 1342. [Google Scholar] [CrossRef] [Green Version]
- Xu, D.; Tahara, H. The role of exosomes and microRNAs in senescence and aging. Adv. Drug Deliv. Rev. 2013, 65, 368–375. [Google Scholar] [CrossRef]
- Davis, C.; Dukes, A.; Drewry, M.; Helwa, I.; Johnson, M.H.; Isales, C.M.; Hill, W.D.; Liu, Y.; Shi, X.; Fulzele, S.; et al. MicroRNA-183-5p Increases with Age in Bone-Derived Extracellular Vesicles, Suppresses Bone Marrow Stromal (Stem) Cell Proliferation, and Induces Stem Cell Senescence. Tissue Eng. Part A 2017, 23, 1231–1240. [Google Scholar] [CrossRef]
- Zhang, Y.; Kim, M.S.; Jia, B.; Yan, J.; Zuniga-Hertz, J.P.; Han, C.; Cai, D. Hypothalamic stem cells control ageing speed partly through exosomal miRNAs. Nature 2017, 548, 52–57. [Google Scholar] [CrossRef]
- Wang, W.Y.; Tan, M.S.; Yu, J.T.; Tan, L. Role of pro-inflammatory cytokines released from microglia in Alzheimer’s disease. Ann. Transl. Med. 2015, 3, 136. [Google Scholar] [CrossRef] [PubMed]
- Gan, K.J.; Sudhof, T.C. Specific factors in blood from young but not old mice directly promote synapse formation and NMDA-receptor recruitment. Proc. Natl. Acad. Sci. USA 2019, 116, 12524–12533. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Stojiljkovic, M.R.; Ain, Q.; Bondeva, T.; Heller, R.; Schmeer, C.; Witte, O.W. Phenotypic and functional differences between senescent and aged murine microglia. Neurobiol. Aging 2019, 74, 56–69. [Google Scholar] [CrossRef] [PubMed]
- Lajqi, T.; Stojiljkovic, M.; Williams, D.L.; Hudalla, H.; Bauer, M.; Witte, O.W.; Wetzker, R.; Bauer, R.; Schmeer, C. Memory-Like Responses of Brain Microglia Are Controlled by Developmental State and Pathogen Dose. Front. Immunol. 2020, 11, 546415. [Google Scholar] [CrossRef] [PubMed]
- Banks, W.A.; Sharma, P.; Bullock, K.M.; Hansen, K.M.; Ludwig, N.; Whiteside, T.L. Transport of Extracellular Vesicles across the Blood-Brain Barrier: Brain Pharmacokinetics and Effects of Inflammation. Int. J. Mol. Sci. 2020, 21, 4407. [Google Scholar] [CrossRef] [PubMed]
- Chaiwangyen, W.; Murrieta-Coxca, J.M.; Favaro, R.R.; Photini, S.M.; Gutierrez-Samudio, R.N.; Schleussner, E.; Markert, U.R.; Morales-Prieto, D.M. MiR-519d-3p in Trophoblastic Cells: Effects, Targets and Transfer to Allogeneic Immune Cells via Extracellular Vesicles. Int. J. Mol. Sci. 2020, 21, 3458. [Google Scholar] [CrossRef]
- Ospina-Prieto, S.; Chaiwangyen, W.; Herrmann, J.; Groten, T.; Schleussner, E.; Markert, U.R.; Morales-Prieto, D.M. MicroRNA-141 is upregulated in preeclamptic placentae and regulates trophoblast invasion and intercellular communication. Transl. Res. 2016, 172, 61–72. [Google Scholar] [CrossRef]
- Yanez-Mo, M.; Siljander, P.R.; Andreu, Z.; Zavec, A.B.; Borras, F.E.; Buzas, E.I.; Buzas, K.; Casal, E.; Cappello, F.; Carvalho, J.; et al. Biological properties of extracellular vesicles and their physiological functions. J. Extracell. Vesicles 2015, 4, 27066. [Google Scholar] [CrossRef] [Green Version]
- Lizarraga-Valderrama, L.R.; Sheridan, G.K. Extracellular vesicles and intercellular communication in the central nervous system. FEBS Lett. 2021, 595, 1391–1410. [Google Scholar] [CrossRef]
- Balusu, S.; Van Wonterghem, E.; De Rycke, R.; Raemdonck, K.; Stremersch, S.; Gevaert, K.; Brkic, M.; Demeestere, D.; Vanhooren, V.; Hendrix, A.; et al. Identification of a novel mechanism of blood-brain communication during peripheral inflammation via choroid plexus-derived extracellular vesicles. EMBO Mol. Med. 2016, 8, 1162–1183. [Google Scholar] [CrossRef]
- Chan, B.D.; Wong, W.Y.; Lee, M.M.; Cho, W.C.; Yee, B.K.; Kwan, Y.W.; Tai, W.C. Exosomes in Inflammation and Inflammatory Disease. Proteomics 2019, 19, e1800149. [Google Scholar] [CrossRef] [PubMed]
- Chen, S.H.; Oyarzabal, E.A.; Hong, J.S. Preparation of rodent primary cultures for neuron-glia, mixed glia, enriched microglia, and reconstituted cultures with microglia. Methods Mol. Biol. 2013, 1041, 231–240. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Caruso Bavisotto, C.; Scalia, F.; Marino Gammazza, A.; Carlisi, D.; Bucchieri, F.; Conway de Macario, E.; Macario, A.J.L.; Cappello, F.; Campanella, C. Extracellular Vesicle-Mediated Cell(-)Cell Communication in the Nervous System: Focus on Neurological Diseases. Int. J. Mol. Sci. 2019, 20, 434. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pegtel, D.M.; Peferoen, L.; Amor, S. Extracellular vesicles as modulators of cell-to-cell communication in the healthy and diseased brain. Philos. Trans. R. Soc. Lond. B Biol. Sci. 2014, 369. [Google Scholar] [CrossRef] [Green Version]
- D’Anca, M.; Fenoglio, C.; Serpente, M.; Arosio, B.; Cesari, M.; Scarpini, E.A.; Galimberti, D. Exosome Determinants of Physiological Aging and Age-Related Neurodegenerative Diseases. Front. Aging Neurosci. 2019, 11, 232. [Google Scholar] [CrossRef] [Green Version]
- Robbins, P.D. Extracellular vesicles and aging. Stem Cell Investig. 2017, 4, 98. [Google Scholar] [CrossRef] [Green Version]
- Im, K.; Baek, J.; Kwon, W.S.; Rha, S.Y.; Hwang, K.W.; Kim, U.; Min, H. The Comparison of Exosome and Exosomal Cytokines between Young and Old Individuals with or without Gastric Cancer. Int. J. Gerontol. 2018, 12, 233–238. [Google Scholar] [CrossRef]
- Chen, C.C.; Liu, L.; Ma, F.; Wong, C.W.; Guo, X.E.; Chacko, J.V.; Farhoodi, H.P.; Zhang, S.X.; Zimak, J.; Segaliny, A.; et al. Elucidation of Exosome Migration across the Blood-Brain Barrier Model In Vitro. Cell. Mol. Bioeng. 2016, 9, 509–529. [Google Scholar] [CrossRef]
- Gomez-Molina, C.; Sandoval, M.; Henzi, R.; Ramirez, J.P.; Varas-Godoy, M.; Luarte, A.; Lafourcade, C.A.; Lopez-Verrilli, A.; Smalla, K.H.; Kaehne, T.; et al. Small Extracellular Vesicles in Rat Serum Contain Astrocyte-Derived Protein Biomarkers of Repetitive Stress. Int. J. Neuropsychopharmacol. 2019, 22, 232–246. [Google Scholar] [CrossRef]
- Gratpain, V.; Mwema, A.; Labrak, Y.; Muccioli, G.G.; van Pesch, V.; des Rieux, A. Extracellular vesicles for the treatment of central nervous system diseases. Adv. Drug Deliv. Rev. 2021, 174, 535–552. [Google Scholar] [CrossRef]
- Yousef, H.; Czupalla, C.J.; Lee, D.; Chen, M.B.; Burke, A.N.; Zera, K.A.; Zandstra, J.; Berber, E.; Lehallier, B.; Mathur, V.; et al. Aged blood impairs hippocampal neural precursor activity and activates microglia via brain endothelial cell VCAM1. Nat. Med. 2019, 25, 988–1000. [Google Scholar] [CrossRef] [PubMed]
- Imai, T.; Takahashi, Y.; Nishikawa, M.; Kato, K.; Morishita, M.; Yamashita, T.; Matsumoto, A.; Charoenviriyakul, C.; Takakura, Y. Macrophage-dependent clearance of systemically administered B16BL6-derived exosomes from the blood circulation in mice. J. Extracell. Vesicles 2015, 4, 26238. [Google Scholar] [CrossRef] [PubMed]
- Wiklander, O.P.; Nordin, J.Z.; O’Loughlin, A.; Gustafsson, Y.; Corso, G.; Mäger, I.; Vader, P.; Lee, Y.; Sork, H.; Seow, Y.; et al. Extracellular vesicle in vivo biodistribution is determined by cell source, route of administration and targeting. J. Extracell. Vesicles 2015, 4, 26316. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kang, M.; Jordan, V.; Blenkiron, C.; Chamley, L.W. Biodistribution of extracellular vesicles following administration into animals: A systematic review. J. Extracell. Vesicles 2021, 10, e12085. [Google Scholar] [CrossRef]
- Asai, H.; Ikezu, S.; Tsunoda, S.; Medalla, M.; Luebke, J.; Haydar, T.; Wolozin, B.; Butovsky, O.; Kugler, S.; Ikezu, T. Depletion of microglia and inhibition of exosome synthesis halt tau propagation. Nat. Neurosci. 2015, 18, 1584–1593. [Google Scholar] [CrossRef]
- Dehghani, M.; Gulvin, S.M.; Flax, J.; Gaborski, T.R. Systematic Evaluation of PKH Labelling on Extracellular Vesicle Size by Nanoparticle Tracking Analysis. Sci. Rep. 2020, 10, 9533. [Google Scholar] [CrossRef]
- Villeda, S.A.; Plambeck, K.E.; Middeldorp, J.; Castellano, J.M.; Mosher, K.I.; Luo, J.; Smith, L.K.; Bieri, G.; Lin, K.; Berdnik, D.; et al. Young blood reverses age-related impairments in cognitive function and synaptic plasticity in mice. Nat. Med. 2014, 20, 659–663. [Google Scholar] [CrossRef] [Green Version]
- Weilner, S.; Keider, V.; Winter, M.; Harreither, E.; Salzer, B.; Weiss, F.; Schraml, E.; Messner, P.; Pietschmann, P.; Hildner, F.; et al. Vesicular Galectin-3 levels decrease with donor age and contribute to the reduced osteo-inductive potential of human plasma derived extracellular vesicles. Aging 2016, 8, 16–33. [Google Scholar] [CrossRef] [Green Version]
- Sieber, M.W.; Claus, R.A.; Witte, O.W.; Frahm, C. Attenuated inflammatory response in aged mice brains following stroke. PLoS ONE 2011, 6, e26288. [Google Scholar] [CrossRef] [Green Version]
- Zhuang, X.; Xiang, X.; Grizzle, W.; Sun, D.; Zhang, S.; Axtell, R.C.; Ju, S.; Mu, J.; Zhang, L.; Steinman, L.; et al. Treatment of brain inflammatory diseases by delivering exosome encapsulated anti-inflammatory drugs from the nasal region to the brain. Mol. Ther. 2011, 19, 1769–1779. [Google Scholar] [CrossRef]
- Fitzner, D.; Schnaars, M.; van Rossum, D.; Krishnamoorthy, G.; Dibaj, P.; Bakhti, M.; Regen, T.; Hanisch, U.K.; Simons, M. Selective transfer of exosomes from oligodendrocytes to microglia by macropinocytosis. J. Cell Sci. 2011, 124, 447–458. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Saint-Pol, J.; Gosselet, F.; Duban-Deweer, S.; Pottiez, G.; Karamanos, Y. Targeting and Crossing the Blood-Brain Barrier with Extracellular Vesicles. Cells 2020, 9, 851. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Primer | Forward | Reverse |
---|---|---|
Cdkn2a (p16) | ctttgtgtaccgctgggaac | ctgaggccggatttagctct |
Il1b (IL-1β) | gaagagcccatcctctgtga | ttcatctcggagcctgtagtg |
Tnf (TNF-α) | gtctactgaacttcggggtgat | atgatctgagtgtgagggtctg |
Cd68 | ttctgctgtggaaatgcaag | gagaaacatggcccgaagt |
Iba1 | acagcaatgatgaggatctgc | ctctaggtgggtcttgggaac |
Il10 (IL-10) | atggtgtcctttcaattgctct | aggatctccctggtttctcttc |
Tgfb (TGF—β) | tgcttcagctccacagagaa | tactgtgtgtccaggctcca |
Il6 (IL-6) | acaaagccagagtccttcagag | cattggaaattggggtagga |
Nos2 (iNOS) | tgactcccagcacaaagggctca | gcactctcttgcggaccatctcct |
Gfap | agaaaggttgaatcgctgga | gccactgcctcgtattgagt |
Gapdh | caacagcaactcccactcttc | Ggtccagggtttcttactcctt |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Morales-Prieto, D.M.; Murrieta-Coxca, J.M.; Stojiljkovic, M.; Diezel, C.; Streicher, P.E.; Henao-Restrepo, J.A.; Röstel, F.; Lindner, J.; Witte, O.W.; Weis, S.; et al. Small Extracellular Vesicles from Peripheral Blood of Aged Mice Pass the Blood-Brain Barrier and Induce Glial Cell Activation. Cells 2022, 11, 625. https://0-doi-org.brum.beds.ac.uk/10.3390/cells11040625
Morales-Prieto DM, Murrieta-Coxca JM, Stojiljkovic M, Diezel C, Streicher PE, Henao-Restrepo JA, Röstel F, Lindner J, Witte OW, Weis S, et al. Small Extracellular Vesicles from Peripheral Blood of Aged Mice Pass the Blood-Brain Barrier and Induce Glial Cell Activation. Cells. 2022; 11(4):625. https://0-doi-org.brum.beds.ac.uk/10.3390/cells11040625
Chicago/Turabian StyleMorales-Prieto, Diana M., José M. Murrieta-Coxca, Milan Stojiljkovic, Celia Diezel, Priska E. Streicher, Julian A. Henao-Restrepo, Franziska Röstel, Julia Lindner, Otto W. Witte, Sebastian Weis, and et al. 2022. "Small Extracellular Vesicles from Peripheral Blood of Aged Mice Pass the Blood-Brain Barrier and Induce Glial Cell Activation" Cells 11, no. 4: 625. https://0-doi-org.brum.beds.ac.uk/10.3390/cells11040625