A Novel lnc-RNA, Named lnc-ORA, Is Identified by RNA-Seq Analysis, and Its Knockdown Inhibits Adipogenesis by Regulating the PI3K/AKT/mTOR Signaling Pathway
Abstract
:1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. RNA Extraction, Library Preparation, Sequencing, and qPCR
2.3. Quality Control
2.4. Mapping to the Reference Genome and Transcriptome Assembly
2.5. Quantification of Gene Expression Level
2.6. Differential Expression Analysis and KEGG Enrichment Analysis
2.7. Cell Culture and Transfection
2.8. Western Blot Analysis and BODIPY Staining
2.9. RNA-Fluorescent In Situ Hybridization
2.10. Cytoplasmic and Nuclear RNA Extraction
2.11. Rapid Amplification of 5′ and 3′ cDNA Ends (RACE)
2.12. Flow Cytometry, Edu, and CCK-8 Assays
2.13. Statistical Analysis
3. Results
3.1. Identification and Characterization of lncRNAs in WT and ob/ob Mice
3.2. Differentially Expressed lncRNAs and Genes in WT and ob/ob Mice
3.3. Pathway Analysis of DEGs
3.4. Validation of the Differentially Expressed lncRNAs by qPCR
3.5. Identification, Subcellular Locations, and Expression Pattern Analysis of lnc-ORA
3.6. Knockdown of lnc-ORA Inhibits the Proliferation of Preadipocytes
3.7. Knockdown of lnc-ORA Inhibits Adipocytes Differentiation through the PI3K/AKT/mTOR Signaling Pathway
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Fukuda, T.; Hamaguchi, M.; Kojima, T.; Hashimoto, Y.; Ohbora, A.; Kato, T.; Nakamura, N.; Fukui, M. The impact of non-alcoholic fatty liver disease on incident type 2 diabetes mellitus in non-overweight individuals. Liver Int. 2016, 36, 275–283. [Google Scholar] [CrossRef] [PubMed]
- Farmer, S.R. Transcriptional control of adipocyte formation. Cell Metab. 2006, 4, 263–273. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lefterova, M.I.; Lazar, M.A. New developments in adipogenesis. Trends Endocrinol. Metab. 2009, 20, 107–114. [Google Scholar] [CrossRef] [PubMed]
- Drel, V.R.; Mashtalir, N.; Ilnytska, O.; Shin, J.; Li, F.; Lyzogubov, V.V.; Obrosova, I.G. The leptin-deficient (ob/ob) mouse: A new animal model of peripheral neuropathy of type 2 diabetes and obesity. Diabetes 2006, 55, 3335–3343. [Google Scholar] [CrossRef] [PubMed]
- Myers, M.G.; Cowley, M.A.; Munzberg, H. Mechanisms of leptin action and leptin resistance. Annu. Rev. Physiol. 2008, 70, 537–556. [Google Scholar] [CrossRef] [PubMed]
- Saltiel, A.R.; Kahn, C.R. Insulin signalling and the regulation of glucose and lipid metabolism. Nature 2001, 414, 799–806. [Google Scholar] [CrossRef] [PubMed]
- Pan, W.; Allison, M.B.; Sabatini, P.; Rupp, A.; Adams, J.; Patterson, C.; Jones, J.C.; Olson, D.P.; Myers, M.G., Jr. Transcriptional and physiological roles for STAT proteins in leptin action. Mol. Metab. 2019, 22, 121–131. [Google Scholar] [CrossRef] [PubMed]
- Lo, K.A.; Huang, S.; Walet, A.C.E.; Zhang, Z.C.; Leow, M.K.; Liu, M.; Sun, L. Adipocyte Long-Noncoding RNA Transcriptome Analysis of Obese Mice Identified Lnc-Leptin, Which Regulates Leptin. Diabetes 2018, 67, 1045–1056. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; Sun, Y.; Cai, R.; Wang, G.; Shu, X.; Pang, W. Long noncoding RNA: Multiple players in gene expression. BMB Rep. 2018, 51, 280–289. [Google Scholar] [CrossRef]
- Quinn, J.J.; Chang, H.Y. Unique features of long non-coding RNA biogenesis and function. Nat. Rev. Genet. 2016, 17, 47–62. [Google Scholar] [CrossRef] [PubMed]
- Batista, P.J.; Chang, H.Y. Long noncoding RNAs: Cellular address codes in development and disease. Cell 2013, 152, 1298–1307. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fatica, A.; Bozzoni, I. Long non-coding RNAs: New players in cell differentiation and development. Nat. Rev. Genet. 2014, 15, 7–21. [Google Scholar] [CrossRef] [PubMed]
- Koerner, M.V.; Pauler, F.M.; Huang, R.; Barlow, D.P. The function of non-coding RNAs in genomic imprinting. Development 2009, 136, 1771–1783. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cai, R.; Sun, Y.; Qimuge, N.; Wang, G.; Wang, Y.; Chu, G.; Yu, T.; Yang, G.; Pang, W. Adiponectin AS lncRNA inhibits adipogenesis by transferring from nucleus to cytoplasm and attenuating Adiponectin mRNA translation. Biochim. Biophys. Acta Mol. Cell Biol. Lipids 2018, 1863, 420–432. [Google Scholar] [CrossRef] [PubMed]
- Zhao, X.; Li, S.; Wang, G.; Yu, Q.; Lin, J.D. A long noncoding RNA transcriptional regulatory circuit drives thermogenic adipocyte differentiation. Mol. Cell 2014, 55, 372–382. [Google Scholar] [CrossRef]
- Pang, W.; Lin, L.; Xiong, Y.; Wei, N.; Wang, Y.; Shen, Q.; Yang, G. Knockdown of PU.1 AS lncRNA inhibits adipogenesis through enhancing PU.1 mRNA translation. J. Cell Biochem. 2013, 114, 2500–2512. [Google Scholar] [CrossRef]
- Wei, N.; Wang, Y.; Xu, R.; Wang, G.; Xiong, Y.; Yu, T.; Yang, G.; Pang, W.J. PU.1 antisense lncRNA against its mRNA translation promotes adipogenesis in porcine preadipocytes. Anim. Genet. 2015, 46, 133–140. [Google Scholar] [CrossRef]
- Zhang, M.; Li, F.; Sun, J.; Li, D.; Li, W.; Jiang, R.; Li, Z.; Liu, X.; Han, R.; Li, G.; et al. LncRNA IMFNCR Promotes Intramuscular Adipocyte Differentiation by Sponging miR-128-3p and miR-27b-3p. Front Genet. 2019, 10, 42. [Google Scholar] [CrossRef]
- Wang, Z.; Gerstein, M.; Snyder, M. RNA-Seq: A revolutionary tool for transcriptomics. Nat. Rev. Genet. 2009, 10, 57–63. [Google Scholar] [CrossRef]
- Ingolia, N.T.; Brar, G.A.; Rouskin, S.; McGeachy, A.M.; Weissman, J.S. The ribosome profiling strategy for monitoring translation in vivo by deep sequencing of ribosome-protected mRNA fragments. Nat. Protoc. 2012, 7, 1534–1550. [Google Scholar] [CrossRef] [Green Version]
- Sun, L.; Goff, L.A.; Trapnell, C.; Alexander, R.; Lo, K.A.; Hacisuleyman, E.; Sauvageau, M.; Tazon-Vega, B.; Kelley, D.R.; Hendrickson, D.G.; et al. Long noncoding RNAs regulate adipogenesis. Proc. Natl. Acad. Sci. USA 2013, 110, 3387–3392. [Google Scholar] [CrossRef] [Green Version]
- Ding, C.; Lim, Y.C.; Chia, S.Y.; Walet, A.C.E.; Xu, S.; Lo, K.A.; Zhao, Y.; Zhu, D.; Shan, Z.; Chen, Q.; et al. De novo reconstruction of human adipose transcriptome reveals conserved lncRNAs as regulators of brown adipogenesis. Nat. Commun. 2018, 9, 1329. [Google Scholar] [CrossRef] [PubMed]
- Xiao, T.; Liu, L.; Li, H.; Sun, Y.; Luo, H.; Li, T.; Wang, S.; Dalton, S.; Zhao, R.C.; Chen, R. Long Noncoding RNA ADINR Regulates Adipogenesis by Transcriptionally Activating C/EBPalpha. Stem Cell Rep. 2015, 5, 856–865. [Google Scholar] [CrossRef] [PubMed]
- Gernapudi, R.; Wolfson, B.; Zhang, Y.; Yao, Y.; Yang, P.; Asahara, H.; Zhou, Q. MicroRNA 140 Promotes Expression of Long Noncoding RNA NEAT1 in Adipogenesis. Mol. Cell Biol. 2016, 36, 30–38. [Google Scholar]
- Sun, Y.; Chen, X.; Qin, J.; Liu, S.; Zhao, R.; Yu, T.; Chu, G.; Yang, G.; Pang, W. Comparative Analysis of Long Noncoding RNAs Expressed during Intramuscular Adipocytes Adipogenesis in Fat-Type and Lean-Type Pigs. J. Agric. Food Chem. 2018, 66, 12122–12130. [Google Scholar] [CrossRef] [PubMed]
- Guttman, M.; Garber, M.; Levin, J.Z.; Donaghey, J.; Robinson, J.; Adiconis, X.; Fan, L.; Koziol, M.J.; Gnirke, A.; Nusbaum, C.; et al. Ab initio reconstruction of cell type-specific transcriptomes in mouse reveals the conserved multi-exonic structure of lincRNAs. Nat. Biotechnol. 2010, 28, 503–510. [Google Scholar] [CrossRef] [PubMed]
- Trapnell, C.; Williams, B.A.; Pertea, G.; Mortazavi, A.; Kwan, G.; van Baren, M.J.; Salzberg, S.L.; Wold, B.J.; Pachter, L. Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat. Biotechnol. 2010, 28, 511–515. [Google Scholar] [CrossRef] [Green Version]
- Xiong, Y.; Yue, F.; Jia, Z.; Gao, Y.; Jin, W.; Hu, K.; Zhang, Y.; Zhu, D.; Yang, G.; Kuang, S. A novel brown adipocyte-enriched long non-coding RNA that is required for brown adipocyte differentiation and sufficient to drive thermogenic gene program in white adipocytes. Biochim. Biophys. Acta Mol. Cell Biol. Lipids 2018, 1863, 409–419. [Google Scholar] [CrossRef]
- Cai, R.; Qimuge, N.; Ma, M.; Wang, Y.; Tang, G.; Zhang, Q.; Sun, Y.; Chen, X.; Yu, T.; Dong, W.; et al. MicroRNA-664-5p promotes myoblast proliferation and inhibits myoblast differentiation by targeting serum response factor and Wnt1. J. Biol. Chem. 2018, 293, 19177–19190. [Google Scholar] [CrossRef]
- Ghaben, A.L.; Scherer, P.E. Adipogenesis and metabolic health. Nat. Rev. Mol. Cell Biol. 2019, 20, 242–258. [Google Scholar] [CrossRef]
- Rosen, E.D.; MacDougald, O.A. Adipocyte differentiation from the inside out. Nat. Rev. Mol. Cell Biol. 2006, 7, 885–896. [Google Scholar]
- Flaherty, S.E.; Grijalva, A.; Xu, X.; Ables, E.; Nomani, A.; Ferrante, A.W., Jr. A lipase-independent pathway of lipid release and immune modulation by adipocytes. Science 2019, 363, 989–993. [Google Scholar] [CrossRef] [PubMed]
- Wu, W.; Zhang, J.; Zhao, C.; Sun, Y.; Pang, W.; Yang, G. CTRP6 Regulates Porcine Adipocyte Proliferation and Differentiation by the AdipoR1/MAPK Signaling Pathway. J. Agric. Food Chem. 2017, 65, 5512–5522. [Google Scholar] [CrossRef]
- Wang, G.; Zhu, L.; Ma, M.; Chen, X.; Gao, Y.; Yu, T.; Yang, G.; Pang, W. Mulberry 1-Deoxynojirimycin Inhibits Adipogenesis by Repression of the ERK/PPARgamma Signaling Pathway in Porcine Intramuscular Adipocytes. J. Agric. Food Chem. 2015, 63, 6212–6220. [Google Scholar] [CrossRef] [PubMed]
- Liu, G.; Chan, E.; Higuchi, M.; Dusting, G.; Jiang, F. Redox mechanisms in regulation of adipocyte differentiation: Beyond a general stress response. Cells 2012, 1, 976–993. [Google Scholar] [CrossRef] [PubMed]
- Alvarez-Dominguez, J.R.; Bai, Z.; Xu, D.; Yuan, B.; Lo, K.A.; Yoon, M.J.; Lim, Y.C.; Knoll, M.; Slavov, N.; Chen, S.; et al. De Novo Reconstruction of Adipose Tissue Transcriptomes Reveals Long Non-coding RNA Regulators of Brown Adipocyte Development. Cell Metab. 2015, 21, 764–776. [Google Scholar] [CrossRef] [PubMed]
- Cesana, M.; Cacchiarelli, D.; Legnini, I.; Santini, T.; Sthandier, O.; Chinappi, M.; Tramontano, A.; Bozzoni, I. A long noncoding RNA controls muscle differentiation by functioning as a competing endogenous RNA. Cell 2011, 147, 358–369. [Google Scholar] [CrossRef] [PubMed]
- Mi, L.; Zhao, X.; Li, S.; Yang, G.; Lin, J.D. Conserved function of the long noncoding RNA Blnc1 in brown adipocyte differentiation. Mol. Metab. 2017, 6, 101–110. [Google Scholar] [CrossRef]
- Yang, Q.; Wan, Q.; Zhang, L.; Li, Y.; Zhang, P.; Li, D.; Feng, C.; Yi, F.; Zhang, L.; Ding, X.; et al. Analysis of LncRNA expression in cell differentiation. RNA Biol. 2018, 15, 413–422. [Google Scholar] [CrossRef]
- Tang, Q.Q.; Otto, T.C.; Lane, M.D. Mitotic clonal expansion: A synchronous process required for adipogenesis. Proc. Natl. Acad. Sci. USA 2003, 100, 44–49. [Google Scholar] [CrossRef]
- Merkestein, M.; Laber, S.; McMurray, F.; Andrew, D.; Sachse, G.; Sanderson, J.; Li, M.D.; Usher, S.; Sellayah, D.; Ashcroft, F.M.; et al. FTO influences adipogenesis by regulating mitotic clonal expansion. Nat. Commun. 2015, 6, 6792. [Google Scholar] [CrossRef] [Green Version]
- Lubelsky, Y.; Ulitsky, I. Sequences enriched in Alu repeats drive nuclear localization of long RNAs in human cells. Nature 2018, 555, 107–111. [Google Scholar] [CrossRef] [PubMed]
- Wen, X.; Gao, L.; Guo, X.; Li, X.; Huang, X.; Wang, Y.; Xu, H.; He, R.; Jia, C.; Liang, F. lncSLdb: A resource for long non-coding RNA subcellular localization. Database 2018, 2018, 1–6. [Google Scholar] [CrossRef]
- Ghilardi, N.; Ziegler, S.; Wiestner, A.; Stoffel, R.; Heim, M.H.; Skoda, R.C. Defective STAT signaling by the leptin receptor in diabetic mice. Proc. Natl. Acad. Sci. USA 1996, 93, 6231–6235. [Google Scholar] [CrossRef] [PubMed]
- Niswender, K.D.; Morton, G.J.; Stearns, W.H.; Rhodes, C.J.; Myers, M.G., Jr.; Schwartz, M.W. Intracellular signalling. Key enzyme in leptin-induced anorexia. Nature 2001, 413, 794–795. [Google Scholar] [CrossRef]
- Banks, A.S.; Davis, S.M.; Bates, S.H.; Myers, M.G., Jr. Activation of downstream signals by the long form of the leptin receptor. J. Biol. Chem. 2000, 275, 14563–14572. [Google Scholar] [CrossRef]
- Kim, Y.B.; Uotani, S.; Pierroz, D.D.; Flier, J.S.; Kahn, B.B. In vivo administration of leptin activates signal transduction directly in insulin-sensitive tissues: Overlapping but distinct pathways from insulin. Endocrinology 2000, 141, 2328–2339. [Google Scholar] [CrossRef] [PubMed]
- Plum, L.; Rother, E.; Munzberg, H.; Wunderlich, F.T.; Morgan, D.A.; Hampel, B.; Shanabrough, M.; Janoschek, R.; Konner, A.C.; Alber, J.; et al. Enhanced leptin-stimulated Pi3k activation in the CNS promotes white adipose tissue transdifferentiation. Cell Metab. 2007, 6, 431–445. [Google Scholar] [CrossRef]
- Dodd, G.T.; Decherf, S.; Loh, K.; Simonds, S.E.; Wiede, F.; Balland, E.; Merry, T.L.; Munzberg, H.; Zhang, Z.Y.; Kahn, B.B.; et al. Leptin and insulin act on POMC neurons to promote the browning of white fat. Cell 2015, 160, 88–104. [Google Scholar] [CrossRef] [Green Version]
- Wang, Y.; Ali, Y.; Lim, C.Y.; Hong, W.; Pang, Z.; Han, W. Insulin-stimulated leptin secretion requires calcium and PI3K/Akt activation. Biochem. J. 2014, 458, 491–498. [Google Scholar] [CrossRef] [PubMed]
- Commins, S.P.; Watson, P.M.; Levin, N.; Beiler, R.J.; Gettys, T.W. Central leptin regulates the UCP1 and ob genes in brown and white adipose tissue via different beta-adrenoceptor subtypes. J. Biol. Chem. 2000, 275, 33059–33067. [Google Scholar] [CrossRef] [PubMed]
- Morrison, S.F.; Madden, C.J.; Tupone, D. Central neural regulation of brown adipose tissue thermogenesis and energy expenditure. Cell Metab. 2014, 19, 741–756. [Google Scholar] [CrossRef] [PubMed]
- Sharma, B.R.; Kim, H.J.; Rhyu, D.Y. Caulerpa lentillifera extract ameliorates insulin resistance and regulates glucose metabolism in C57BL/KsJ-db/db mice via PI3K/AKT signaling pathway in myocytes. J. Transl. Med. 2015, 13, 62. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Name | Forward (5′→3′) | Reverse (5′→3′) |
---|---|---|
lnc-ORA | GCCTTGCTTGTGCAGGTCTA | GTCTAGGAAGACTGGGTGCTG |
PPARγ | CCAAGAATACCAAAGTGCGATCA | CCCACAGACTCGGCACTCAAT |
FASN | AATCGGCAAATTCGACCTTTC | ACCTGGATGACCACTTTGCCTAT |
FABP4 | AAGAAGTGGGAGTGGGCTTTG | CTCTTCACCTTCCTGTCGTCTG |
Leptin | GAGACCCCTGTGTCGGTTC | CTGCGTGTGTGAAATGTCATTG |
Adiponectin | GGCAGGAAAGGAGAACCTGG | AGCCTTGTCCTTCTTGAAGAG |
cyclin B | AATCCCTTCTTGTGGTTA | CTTAGATGTGGCATACTTG |
cyclin E | CAGAGCAGCGAGCAGGAGC | GCAGCTGCTTCCACACCACT |
cyclin D1 | TAGGCCCTCAGCCTCACTC | CCACCCCTGGGATAAAGCAC |
GAPDH | TGCTGAGTATGTCGTGGAGTCT | ATGCATTGCTGACAATCTTGAG |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cai, R.; Tang, G.; Zhang, Q.; Yong, W.; Zhang, W.; Xiao, J.; Wei, C.; He, C.; Yang, G.; Pang, W. A Novel lnc-RNA, Named lnc-ORA, Is Identified by RNA-Seq Analysis, and Its Knockdown Inhibits Adipogenesis by Regulating the PI3K/AKT/mTOR Signaling Pathway. Cells 2019, 8, 477. https://0-doi-org.brum.beds.ac.uk/10.3390/cells8050477
Cai R, Tang G, Zhang Q, Yong W, Zhang W, Xiao J, Wei C, He C, Yang G, Pang W. A Novel lnc-RNA, Named lnc-ORA, Is Identified by RNA-Seq Analysis, and Its Knockdown Inhibits Adipogenesis by Regulating the PI3K/AKT/mTOR Signaling Pathway. Cells. 2019; 8(5):477. https://0-doi-org.brum.beds.ac.uk/10.3390/cells8050477
Chicago/Turabian StyleCai, Rui, Guorong Tang, Que Zhang, Wenlong Yong, Wanrong Zhang, Junying Xiao, Changsheng Wei, Chun He, Gongshe Yang, and Weijun Pang. 2019. "A Novel lnc-RNA, Named lnc-ORA, Is Identified by RNA-Seq Analysis, and Its Knockdown Inhibits Adipogenesis by Regulating the PI3K/AKT/mTOR Signaling Pathway" Cells 8, no. 5: 477. https://0-doi-org.brum.beds.ac.uk/10.3390/cells8050477