Leptospira Detection in Cats in Spain by Serology and Molecular Techniques
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animals in the Study
2.2. Sample Collection
2.3. Microscopic Agglutination Test (MAT)
2.4. DNA Isolation
2.5. TaqMan Real-Time PCR
2.6. Statistical Analysis
3. Results
3.1. Seroprevalence
3.2. DNA Detection in Blood PCR
3.3. Urinary Shedding
3.4. Risk Factor Analysis
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Levett, P.N. Leptospirosis. Clin. Microbiol. 2001, 14, 296–326. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Adler, B.; De la Peña, M.A. Leptospira and leptospirosis. Vet. Microbiol. 2010, 140, 287–296. [Google Scholar] [CrossRef] [PubMed]
- Costa, F.; Hagan, J.E.; Calcagno, J.; Kane, M.; Torgerson, P.; Martinez-Silveira, M.S.; Ko, A.I. Global morbidity and mortality of leptospirosis: A systematic review. PLoS Negl. Trop. Dis. 2015, 9, e0003898. [Google Scholar] [CrossRef] [PubMed]
- Domingo, I.; Cuenca, M.; Gimeno, F.; Guerrero, A. Incidencia de leptospirosis en España entre 2009–2012. Rev. Clin. Esp. 2016, 216, 51–53. [Google Scholar] [CrossRef] [PubMed]
- Núñez, M.J.; Lires, J.A.; Rodríguez, A.; Sanjurjo, A.B.; Sánchez, P. Leptospirosis: Presentación de un caso y revisión epidemiológica en España. Medifam 2001, 11, 107–109. [Google Scholar] [CrossRef] [Green Version]
- Chan, K.-W.; Hsu, Y.-H.; Hu, W.-L.; Pan, M.-J.; Lai, J.-M.; Huang, K.-C.; Chou, S.J. Serological and PCR detection of feline Leptospira in Southern Taiwan. Vector Borne Zoonotic Dis. 2014, 14, 118–123. [Google Scholar] [CrossRef]
- Dybing, N.A.; Jacobson, C.; Irwin, P.; Algar, D.; Adams, P.J. Leptospira species in feral cats and black rats from western Australia and Christmas Island. Vector Borne Zoonotic Dis. 2017, 17, 319–324. [Google Scholar] [CrossRef]
- Gomard, Y.; Lagadec, E.; Humeau, L.; Pinet, P.; Bureau, S.; Da Silva, D.; Turpin, M.; Soulaimana, M.Y.; George, S.; Mavingui, P.; et al. Feral cats do not play a major role in leptospirosis epidemiology on Reunion Island. Epidemiol. Infect. 2019, 147, e97. [Google Scholar] [CrossRef] [Green Version]
- Arbour, J.; Blais, M.-C.; Carioto, L.; Sylvestre, D. Clinical leptospirosis in three cats (2001–2009). J. Am. Anim. Hosp. Assoc. 2012, 48, 256–260. [Google Scholar] [CrossRef]
- Beaudu-Lange, C.; Lange, E. Unusual clinical presentation of leptospirosis in a cat. Rev. Vet. Clin. 2014, 49, 115–122. [Google Scholar] [CrossRef]
- Lapointe, C.; Plamondon, I.; Dunn, M. Feline leptospirosis serosurvey from a Quebec referral hospital. Can. Vet. J. 2013, 54, 497–499. [Google Scholar] [PubMed]
- Murillo, A.; Goris, M.; Ahmed, A.; Cuenca, R.; Pastor, J. Leptospirosis in cats: Current literature review to guide diagnoses and management. J. Feline Med. Surg. 2020, 22, 216–228. [Google Scholar] [CrossRef]
- Alashraf, A.R.; Lau, S.F.; Khor, K.H.; Khairani-Bejo, S.; Bahaman, A.R.; Roslan, M.A.; Rahman, M.S.A.; Go, S.H.; Radzi, R. Serological detection of anti-Leptospira antibodies in shelter cats in Malaysia. Top. Companion An. Med. 2019, 34, 10–13. [Google Scholar] [CrossRef] [PubMed]
- Spribler, F.; Jongwattanapisan, P.; Luengyosluechakul, S.; Pusoonthornthum, R.; Prapasarakul, N.; Kurilung, A.; Goris, M.; Ahmed, A.; Reese, S.; Bergmann, M.; et al. Leptospira infection and shedding in cats in Thailand. Transbound. Emerg. Dis. 2018, 66, 948–956. [Google Scholar] [CrossRef] [PubMed]
- Weis, S.; Rettinger, A.; Bergmann, M.; Llewellyn, J.R.; Pantchev, N.; Straubinger, R.K.; Hartmann, K. Detection of Leptospira DNA in urine and presence of specific antibodies in outdoor cats in Germany. J. Feline Med. Surg. 2017, 19, 470–476. [Google Scholar] [CrossRef] [PubMed]
- Mylonakis, M.E.; Bourtzi-Hatzopoulou, E.; Koutinas, A.F.; Petridou, E.; Saridomichelakis, M.N.; Leontides, L.; Siochu, A. Leptospiral seroepidemiology in a feline hospital population in Greece. Vet. Rec. 2005, 156, 615–616. [Google Scholar] [CrossRef]
- Azócar-Aedo, L.; Monti, G.; Jara, R. Leptospira spp. in domestic cats from different environments: Prevalence of antibodies and risk factors associated with the seropositivity. Animals 2014, 4, 612–626. [Google Scholar] [CrossRef] [Green Version]
- Desvars, A.; Naze, F.; Benneveau, A.; Cardinale, E.; Michault, A. Endemicity of leptospirosis in domestic and wild animal species from Reunion Island (Indian Ocean). Epidemiol. Infect. 2013, 141, 1154–1165. [Google Scholar] [CrossRef] [Green Version]
- Dorsch, R.; Salgado, M.; Monti, G.; Avilez, C.; Collado, B.; Tomckoviack, C.; Tejeda, C.; Müller-Pareira, A.; Ojeda, J.; Hartmann, K. Urine shedding of pathogenic Leptospira spp. in cats in southern chile in science for people. In Proceedings of the 10th International Leptospirosis Society Conference, Palmerston North, New Zealand, 27 November–1 December 2017; p. 227. [Google Scholar]
- Rodriguez, J.; Lapointe, C.; Arsenault, J.; Carioto, L.; Harel, J. Serologic and urinary PCR survey of leptospirosis in healthy cats and in cats with kidney disease. J. Vet. Intern. Med. 2014, 28. [Google Scholar] [CrossRef]
- Zaidi, S.; Bouam, A.; Bessas, A.; Hezil, D.; Ghaoui, H.; Ait-Oudhia, K.; Drancourt, M.; Bitam, I. Urinary shedding of pathogenic Leptospira in stray dogs and cats, Algiers: A prospective study. PLoS ONE 2018, 13, e0197068. [Google Scholar] [CrossRef] [Green Version]
- Goris, M.G.; Hartskeerl, R.A. Leptospirosis serodiagnosis by the microscopic agglutination test. Curr. Protoc. Microbio. 2014, 32, 12E-5. [Google Scholar] [CrossRef]
- Adler, B. Current Topics in Microbiology and Immunology, 1st ed.; Springer: Berlin/Heidelberg, Germany, 2014. [Google Scholar]
- Terpstra, W.J. Human Leptospirosis: Guidance for Diagnosis, Surveillance and Control; World Health Organization: Geneva, Switzerland; International Leptospirosis Society: Geneva, Switzerland, 2003; 64p. [Google Scholar]
- Ahmed, A.A.; Goris, M.G.; Meijer, M. Development of Lipl32 Real-Time PCR Combined with an Internal and Extraction Control for Pathogenic Leptospira Detection; Submitted for Publication, Plos one: san Francisco, CA, USA, 2020. [Google Scholar]
- Dean, A.G.; Sullivan, K.M.; Soe, M.M. OpenEpi: Open Source Epidemiologic Statistics for Public Health, Version. 2013/04/06. Available online: http://www.OpenEpi.com (accessed on 3 February 2020).
- Schuller, S.; Francey, T.; Hartmann, K.; Hugonnard, M.; Kohn, B.; Nally, J.E.; Sykes, J. European consensus statement on leptospirosis in dogs and cats. J. Small Anim. Pract. 2015, 56, 159–179. [Google Scholar] [CrossRef] [PubMed]
- Ojeda, J.; Salgado, M.; Encina, C.; Santamaria, C.; Monti, G. Evidence of interspecies transmission of pathogenic Leptospira between livestock and a domestic cat dwelling in a dairy cattle farm. J. Vet. Med. Sci 2018, 80, 1305–1308. [Google Scholar] [CrossRef] [PubMed]
- Goldstein, R.E.; Lin, R.C.; Langston, C.E.; Scrivani, P.V.; Erb, H.N.; Barr, S.C. Influence of infecting serogroup on clinical features of leptospirosis in dogs. J. Vet. Int. Med. 2006, 20, 489–494. [Google Scholar] [CrossRef]
- Nally, J.E.; Chow, E.; Fishbein, M.C.; Blanco, D.R.; Lovett, M.A. Changes in lipopolysaccharide O antigen distinguish acute versus chronic Leptospira interrogans infections. Infect. Immun. 2005, 73, 3251–3260. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Adler, B. Pathogenesis of leptospirosis: Cellular and molecular aspects. Vet. Microbiol 2014, 172, 353–358. [Google Scholar] [CrossRef] [PubMed]
- Nahori, M.-A.; Fournié-Amazouz, E.; Que-Gewirth, N.S.; Balloy, V.; Chignard, M.; Raetz, C.R.H.; Saint Girons, I.; Werts, C. Differential TLR recognition of leptospiral lipid a and lipopolysaccharide in murine and human cells. J. Immunol. 2005, 175, 6022–6031. [Google Scholar] [CrossRef] [Green Version]
- Faine, S. The growth of Leptospira australis B in the kidneys of mice in the incipient experimental carrier state. J Hyg. 1962, 60, 435–442. [Google Scholar] [CrossRef] [Green Version]
- Larsson, C.E.; Santa Rosa, C.A.; Larsson, M.H.; Birgel, E.H.; Fernandes, W.R.; Paim, G.V. Laboratory and Clinical features of experimental feline leptospirosis. Int. J. Zoonoses 1985, 12, 111–119. [Google Scholar]
- Shophet, R.; Marshall, R.B. An experimentally induced predator chain transmission of Leptospira ballum from mice to cats. Br. Vet. J. 1980, 136, 265–270. [Google Scholar] [CrossRef]
- Shropshire, S.B.; Veir, J.K.; Morris, A.K.; Lappin, M.R. Evaluation of the Leptospira species microscopic agglutination test in experimentally vaccinated cats and Leptospira species seropositivity in aged azotemic client owned cats. J. Feline Med. Surg. 2016, 18, 768–772. [Google Scholar] [CrossRef] [PubMed]
- Pratt, N.; Conan, A.; Rajeev, S. Leptospira seroprevalence in domestic dogs and cats on the Caribbean island of saint Kitts. Vet. Med. Int. 2017, 2017, 5904757. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Millán, J.; Candela, M.G.; López-Bao, J.V.; Pereira, M.; Jiménez, M.Á.; León-Vizcaíno, L. Leptospirosis in wild and domestic carnivores in natural areas in Andalusia, Spain. Vector Borne Zoonotic Dis. 2009, 9, 549–554. [Google Scholar] [CrossRef] [PubMed]
- Agunloye, C.A.; Nash, A.S. Investigation of possible leptospiral infection in cats in Scotland. J. Small Anim. Pract. 1996, 37, 126–129. [Google Scholar] [CrossRef]
- Millán, J.; Cevidanes, A.; Chirife, A.D.; Candela, M.G.; León-Vizcaíno, L. Risk factors of Leptospira infection in Mediterranean periurban micromammals. Zoonoses Public Health 2018, 65, e79–e85. [Google Scholar] [CrossRef]
- Stull, J.W.; Anderson, M.E.C.; Weese, J.S. The dynamic nature of canine and feline infectious disease risks in the twenty-first century. Vet. Clin. North. Am. Small Anim. Pract. 2019, 49, 587–598. [Google Scholar] [CrossRef]
- Sonja, O.; Sonja, R.; Nataša, S.; Danica, B.; Slobodanka, V.; Miroslav, V. Seroprevalence of cat leptospirosis in Belgrade (Serbia). Acta Vet. Brno 2014, 64, 510–518. [Google Scholar] [CrossRef] [Green Version]
- López, M.C.; Vila, A.; Rodón, J.; Roura, X. Seroprevalence in owned dogs from Spain. Heliyon 2019, 5, e02373. [Google Scholar] [CrossRef] [Green Version]
- Chappel, R.J.; Goris, M.; Palmer, M.F.; Hartskeerl, R.A. Impact of proficiency testing on results of the microscopic agglutination test for diagnosis of leptospirosis. J. Clin. Microbiol. 2004, 42, 5484–5488. [Google Scholar] [CrossRef] [Green Version]
- Levett, P.N. Usefulness of serologic analysis as a predictor of the infecting serovar in patients with severe leptospirosis. Clin. Infect. Dis. 2003, 36, 447–452. [Google Scholar] [CrossRef]
- Markovich, J.E.; Ross, L.; McCobb, E. The prevalence of leptospiral antibodies in free roaming cats in Worcester County, Massachusetts. J. Vet. Int. Med. 2012, 26, 688–689. [Google Scholar] [CrossRef] [PubMed]
- Denipitiya, D.T.H.; Chandrasekharan, N.V.; Abeyewickreme, W.; Hartskeerl, R.A.; Hapugoda, M.D. Identification of cattle, buffaloes and rodents as reservoir animals of Leptospira in the District of Gampaha, Sri Lanka. BMC Res. Notes 2017, 10, 134. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Stoddard, R.A.; Gee, J.E.; Wilkins, P.P.; McCaustland, K.; Hoffmaster, A.R. Detection of pathogenic Leptospira spp. through TaqMan polymerase chain reaction targeting the LipL32 gene. Diagn. Microbiol. Infect. Dis. 2009, 64, 247–255. [Google Scholar] [CrossRef] [PubMed]
SPECIES (8) | SEROGROUP (20) | SEROVAR (27) | STRAIN (28) |
---|---|---|---|
L. biflexa * | Andaman | Andaman | CH 11 |
L. interrogans | Australis | Australis | Ballico |
L. interrogans | Australis | Bratislava | Jez Bratislava |
L. interrogans | Autumnalis | Rachmati | Rachmat |
L. borgpetersenii | Ballum | Ballum | Mus 127 |
L. interrogans | Bataviae | Bataviae | Swart |
L. interrogans | Canicola | Canicola | Hond Utrecht IV |
L. weilii | Celledoni | Celledoni | Celledoni |
L. kirschneri | Cynopteri | Cynopteri | 3522 C |
L. kirschneri | Grippotyphosa | Grippotyphosa | Mandemakers |
L. kirschneri | Grippotyphosa | Grippotyphosa type Moska | Moskva V |
L. interrogans | Hebdomadis | Hebdomadis | Hebdomadis |
L. interrogans | Icterohaemorrhagiae | Copenhageni | Wijnberg |
L. interrogans | Icterohaemorrhagiae | Icterohaemorrhagiae | Kantorowic |
L. borgpetersenii | Javanica | Poi | Poi |
L. borgpetersenii | Mini | Mini | Sari |
L. noguchii | Panama | Panama | CZ 214 |
L. interrogans | Pomona | Pomona | Pomona |
L. noguchii | Pomona | Proechimys | 1161 U |
L. interrogans | Pyrogenes | Pyrogenes | Salinem |
L. borgpetersenii | Sejroe | Hardjo type bovis | Sponselee |
L. interrogans | Sejroe | Hardjo type prajitno | Hardjoprajitno |
L. borgpetersenii | Sejroe | Saxkoebing | Mus 24 |
L. borgpetersenii | Sejroe | Sejroe | M 84 |
L. biflexa* | Semaranga | Patoc | Patoc I |
L. meyeri* | Semaranga | Semaranga | Veldrat Semarang 173 |
L. santarosai | Shermani | Shermani | 1342 K |
L. borgpetersenii | Tarassovi | Tarassovi | Perepelitsin |
Oligo ID | Sequence | Sequence Source |
---|---|---|
LipgrF2 | 5’CGCTGAAATGGGAGTTCGTATGATTTCC3’ | lipL32 |
LipgrR2 | 5’GGCATTGATTTTTCTTCYGGGGTWGCC3’ | lipL32 |
LipgrP1 | 5’FAM AGGCGAAATCGGKGARCCAGGCGAYGG3’BHQ1 | lipL32 |
IntoF2 | 5’TAGAATCATTGAATCTATCACATCTCATG3’ | Internal Control |
IntoR2 | 5’TTGAACTAAATGTAGACTAAAGATGATCG’3 | Internal Control |
IntoP1 | 5’TxRd TTCACATTAACATTCAATAATCAATCATGAA3’BHQ2 | Internal Control |
PlasintS1 | 5’CTATAGAATCATTGAATCTATCACATCTCATGTACTTCACATTAACATTCAATAATCAATCATGAATTAATTCAATTTCTGATATGAATCGATCATCTTTAGTCTACATTTAGTTCAATATATC3’ | Internal Control artificial template |
Gender | Age y.o. | Origin | Titer | Species | Serogroup | Serovar | Strain | FIV | FeLV |
---|---|---|---|---|---|---|---|---|---|
F | 1 | C | 1:20 | L. borgpetersenii | Ballum | Ballum | Mus 127 | N | N |
M | 0.5 | C | 1:20 1:20 | L. interrogans L. kirschneri | Australis Cynopteri | Bratislava Cynopteri | Jez Bratislava 3522 C | N | N |
M | 1 | C | 1:20 | L. kirschneri | Cynopteri | Cynopteri | 3522 C | N | N |
M | 2 | C | 1:20 | L. kirschneri | Cynopteri | Cynopteri | 3522 C | N | N |
M | 2 | C | 1:40 | L. kirschneri | Cynopteri | Cynopteri | 3522 C | N | N |
M | 2 | C | 1:320 | L. interrogans | Bataviae | Bataviae | Swart | N | N |
M | 5 | C | 1:20 | L. borgpetersenii | Ballum | Ballum | Mus 127 | N | N |
F | 1 | C | 1:20 1:20 1:80 1:40 1:20 1:80 1:320 | L. interrogans L. kirschneri L. kirschneri L. kirschneri L. interrogans L. noguchii L. interrogans | Australis Cynopteri Grippotyphosa Grippotyphosa Pomona Pomona Autumnalis | Bratislava Cynopteri Grippotyphosa Grippotyphosa-M Pomona Proechimys Rachmati | Jez Bratislava 3522 C Mandemakers Moskva V Pomona 1161 U Rachmat | N | N |
M | 2 | C | 1:20 1:20 | L. interrogans L. noguchii | Pomona Pomoma | Pomona Proechimys | Pomona 1161 U | P | N |
nM | 7 | B | 1:20 | L. borgpetersenii | Sejroe | Sejroe | M 84 | N | N |
Gender | Age y.o. | Origin | Blood DNA Amplification by PCR (n = 89) | Urine DNA Amplification by PCR (n = 232) | FIV | FeLV |
---|---|---|---|---|---|---|
F | 1 | C | N | N | N | N |
M | 0.5 | C | N | N | N | N |
M | 1 | C | N | N | N | N |
M | 2 | C | N | N | N | N |
M | 2 | C | N | N | N | N |
M | 2 | C | N | N | N | N |
M | 5 | C | N | N | N | N |
F | 1 | C | N | N | N | N |
M | 2 | C | N | N | P | N |
nM | 7 | B | N | N | N | N |
M | 0.5 | C | N | P | N | N |
F | 1 | C | N | P | N | N |
M | 0.5 | B | N | P | N | N |
F | 0.5 | B | N | P | N | N |
F | 0.6 | B | P | N | N | N |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Murillo, A.; Cuenca, R.; Serrano, E.; Marga, G.; Ahmed, A.; Cervantes, S.; Caparrós, C.; Vieitez, V.; Ladina, A.; Pastor, J. Leptospira Detection in Cats in Spain by Serology and Molecular Techniques. Int. J. Environ. Res. Public Health 2020, 17, 1600. https://0-doi-org.brum.beds.ac.uk/10.3390/ijerph17051600
Murillo A, Cuenca R, Serrano E, Marga G, Ahmed A, Cervantes S, Caparrós C, Vieitez V, Ladina A, Pastor J. Leptospira Detection in Cats in Spain by Serology and Molecular Techniques. International Journal of Environmental Research and Public Health. 2020; 17(5):1600. https://0-doi-org.brum.beds.ac.uk/10.3390/ijerph17051600
Chicago/Turabian StyleMurillo, Andrea, Rafaela Cuenca, Emmanuel Serrano, Goris Marga, Ahmed Ahmed, Salvador Cervantes, Cristina Caparrós, Verónica Vieitez, Andrea Ladina, and Josep Pastor. 2020. "Leptospira Detection in Cats in Spain by Serology and Molecular Techniques" International Journal of Environmental Research and Public Health 17, no. 5: 1600. https://0-doi-org.brum.beds.ac.uk/10.3390/ijerph17051600