Macrophage-Mediated Melanoma Reduction after HP-NAP Treatment in a Zebrafish Xenograft Model
Abstract
:1. Introduction
2. Results
2.1. HP-NAP Administration Counteracts Melanoma Growth and Metastasis In Vivo
2.2. The Anti-Tumor Effect of HP-NAP Does Not Rely on a Direct Action on Melanoma Cells
2.3. HP-NAP Promotes the Recruitment of Macrophages at the Tumor Site
2.4. HP-NAP Modulates the Macrophages Polarization
2.5. Macrophages Are Essential for the Anti-Tumor Activity of HP-NAP
3. Discussion
4. Materials and Methods
4.1. Ethic Statement
4.2. Danio Rerio (Zebrafish) Handling
4.3. Human Melanoma Cell Lines
4.4. Annexin V Assay
4.5. MTS Assay
4.6. Proliferation Assay
4.7. Migration Assay
4.8. Xenotransplant
4.9. Macrophage Depletion and HP-NAP Administration
4.10. Fluorescent Staining with Acridine Orange (AO)
4.11. Images Acquisition and Analysis of Zebrafish Embryos
4.12. Macrophage Sorting
4.13. RNA Extraction and Quantitative Real-Time PCR (qPCR)
4.14. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Acknowledgments
Conflicts of Interest
References
- Davis, L.E.; Shalin, S.C.; Tackett, A.J. Current State of Melanoma Diagnosis and Treatment. Cancer Biol. Ther. 2019, 20, 1366–1379. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Matthews, N.H.; Li, W.-Q.; Qureshi, A.A.; Weinstock, M.A.; Cho, E. Epidemiology of Melanoma. In Cutaneous Melanoma: Etiology and Therapy; Ward, W.H., Farma, J.M., Eds.; Codon Publications: Brisbane, Australia, 2017; ISBN 978-0-9944381-4-0. [Google Scholar]
- Domingues, B.; Lopes, J.M.; Soares, P.; Pópulo, H. Melanoma Treatment in Review. Immunotarg. Ther. 2018, 7, 35–49. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gentles, A.J.; Newman, A.M.; Liu, C.L.; Bratman, S.V.; Feng, W.; Kim, D.; Nair, V.S.; Xu, Y.; Khuong, A.; Hoang, C.D.; et al. The Prognostic Landscape of Genes and Infiltrating Immune Cells across Human Cancers. Nat. Med. 2015, 21, 938–945. [Google Scholar] [CrossRef]
- Cassetta, L.; Pollard, J.W. Targeting Macrophages: Therapeutic Approaches in Cancer. Nat. Rev. Drug Discov. 2018, 17, 887–904. [Google Scholar] [CrossRef] [PubMed]
- Falleni, M.; Savi, F.; Tosi, D.; Agape, E.; Cerri, A.; Moneghini, L.; Bulfamante, G.P. M1 and M2 Macrophages’ Clinicopathological Significance in Cutaneous Melanoma. Melanoma Res. 2017, 27, 200–210. [Google Scholar] [CrossRef] [PubMed]
- Hussein, M.R. Tumour-Associated Macrophages and Melanoma Tumourigenesis: Integrating the Complexity. Int. J. Exp. Pathol. 2006, 87, 163–176. [Google Scholar] [CrossRef] [PubMed]
- Piaggio, F.; Kondylis, V.; Pastorino, F.; Di Paolo, D.; Perri, P.; Cossu, I.; Schorn, F.; Marinaccio, C.; Murgia, D.; Daga, A.; et al. A Novel Liposomal Clodronate Depletes Tumor-Associated Macrophages in Primary and Metastatic Melanoma: Anti-Angiogenic and Anti-Tumor Effects. J. Control. Release 2016, 223, 165–177. [Google Scholar] [CrossRef]
- Montecucco, C.; de Bernard, M. Molecular and Cellular Mechanisms of Action of the Vacuolating Cytotoxin (VacA) and Neutrophil-Activating Protein (HP-NAP) Virulence Factors of Helicobacter Pylori. Microbes Infect. 2003, 5, 715–721. [Google Scholar] [CrossRef]
- Amedei, A.; Cappon, A.; Codolo, G.; Cabrelle, A.; Polenghi, A.; Benagiano, M.; Tasca, E.; Azzurri, A.; D’Elios, M.M.; Del Prete, G.; et al. The Neutrophil-Activating Protein of Helicobacter Pylori Promotes Th1 Immune Responses. J. Clin. Investig. 2006, 116, 1092–1101. [Google Scholar] [CrossRef] [Green Version]
- Codolo, G.; Fassan, M.; Munari, F.; Volpe, A.; Bassi, P.; Rugge, M.; Pagano, F.; D’Elios, M.M.; de Bernard, M. HP-NAP Inhibits the Growth of Bladder Cancer in Mice by Activating a Cytotoxic Th1 Response. Cancer Immunol. Immunother. 2012, 61, 31–40. [Google Scholar] [CrossRef]
- Iankov, I.D.; Allen, C.; Federspiel, M.J.; Myers, R.M.; Peng, K.W.; Ingle, J.N.; Russell, S.J.; Galanis, E. Expression of Immunomodulatory Neutrophil-Activating Protein of Helicobacter Pylori Enhances the Antitumor Activity of Oncolytic Measles Virus. Mol. Ther. 2012, 20, 1139–1147. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ramachandran, M.; Yu, D.; Wanders, A.; Essand, M.; Eriksson, F. An Infection-Enhanced Oncolytic Adenovirus Secreting H. Pylori Neutrophil-Activating Protein with Therapeutic Effects on Neuroendocrine Tumors. Mol. Ther. 2013, 21, 2008–2018. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wyatt, R.A.; Trieu, N.P.V.; Crawford, B.D. Zebrafish Xenograft: An Evolutionary Experiment in Tumour Biology. Genes 2017, 8, 220. [Google Scholar] [CrossRef] [PubMed]
- Póvoa, V.; Rebelo de Almeida, C.; Maia-Gil, M.; Sobral, D.; Domingues, M.; Martinez-Lopez, M.; de Almeida Fuzeta, M.; Silva, C.; Grosso, A.R.; Fior, R. Innate Immune Evasion Revealed in a Colorectal Zebrafish Xenograft Model. Nat. Commun. 2021, 12, 1156. [Google Scholar] [CrossRef]
- Bootorabi, F.; Manouchehri, H.; Changizi, R.; Barker, H.; Palazzo, E.; Saltari, A.; Parikka, M.; Pincelli, C.; Aspatwar, A. Zebrafish as a Model Organism for the Development of Drugs for Skin Cancer. Int. J. Mol. Sci. 2017, 18, 1550. [Google Scholar] [CrossRef] [Green Version]
- Kaufman, C.K. Zebrafish Melanoma. Adv. Exp. Med. Biol. 2016, 916, 439–450. [Google Scholar] [CrossRef]
- Travnickova, J.; Tran Chau, V.; Julien, E.; Mateos-Langerak, J.; Gonzalez, C.; Lelièvre, E.; Lutfalla, G.; Tavian, M.; Kissa, K. Primitive Macrophages Control HSPC Mobilization and Definitive Haematopoiesis. Nat. Commun. 2015, 6, 6227. [Google Scholar] [CrossRef] [Green Version]
- Weissman, B.A.; Schwartz, S.D.; Lee, D.A. Oxygen Transmissibility of Disposable Hydrogel Contact Lenses. CLAO J. 1991, 17, 62–64. [Google Scholar]
- Thiele, D.L.; Lipsky, P.E. The Immunosuppressive Activity of L-Leucyl-L-Leucine Methyl Ester: Selective Ablation of Cytotoxic Lymphocytes and Monocytes. J. Immunol. 1986, 136, 1038–1048. [Google Scholar]
- Hagforsen, E.; Paivandy, A.; Lampinen, M.; Weström, S.; Calounova, G.; Melo, F.R.; Rollman, O.; Pejler, G. Ablation of Human Skin Mast Cells in Situ by Lysosomotropic Agents. Exp. Dermatol. 2015, 24, 516–521. [Google Scholar] [CrossRef]
- Gajewski, T.F.; Schreiber, H.; Fu, Y.-X. Innate and Adaptive Immune Cells in the Tumor Microenvironment. Nat. Immunol. 2013, 14, 1014–1022. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pan, Y.; Yu, Y.; Wang, X.; Zhang, T. Tumor-Associated Macrophages in Tumor Immunity. Front. Immunol. 2020, 11, 583084. [Google Scholar] [CrossRef] [PubMed]
- Bellora, F.; Castriconi, R.; Dondero, A.; Reggiardo, G.; Moretta, L.; Mantovani, A.; Moretta, A.; Bottino, C. The Interaction of Human Natural Killer Cells with Either Unpolarized or Polarized Macrophages Results in Different Functional Outcomes. Proc. Natl. Acad. Sci. USA 2010, 107, 21659–21664. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Long, K.B.; Beatty, G.L. Harnessing the Antitumor Potential of Macrophages for Cancer Immunotherapy. Oncoimmunology 2013, 2, e26860. [Google Scholar] [CrossRef] [PubMed]
- Duan, Z.; Luo, Y. Targeting Macrophages in Cancer Immunotherapy. Signal Transduct. Target. Ther. 2021, 6, 127. [Google Scholar] [CrossRef]
- Mrad, M.; Imbert, C.; Garcia, V.; Rambow, F.; Therville, N.; Carpentier, S.; Ségui, B.; Levade, T.; Azar, R.; Marine, J.-C.; et al. Downregulation of Sphingosine Kinase-1 Induces Protective Tumor Immunity by Promoting M1 Macrophage Response in Melanoma. Oncotarget 2016, 7, 71873–71886. [Google Scholar] [CrossRef] [Green Version]
- Ceci, C.; Atzori, M.G.; Lacal, P.M.; Graziani, G. Targeting Tumor-Associated Macrophages to Increase the Efficacy of Immune Checkpoint Inhibitors: A Glimpse into Novel Therapeutic Approaches for Metastatic Melanoma. Cancers 2020, 12, 3401. [Google Scholar] [CrossRef]
- D’Elios, M.M.; Amedei, A.; Cappon, A.; Del Prete, G.; de Bernard, M. The Neutrophil-Activating Protein of Helicobacter Pylori (HP-NAP) as an Immune Modulating Agent. FEMS Immunol. Med. Microbiol. 2007, 50, 157–164. [Google Scholar] [CrossRef] [Green Version]
- Kimmel, C.B.; Ballard, W.W.; Kimmel, S.R.; Ullmann, B.; Schilling, T.F. Stages of Embryonic Development of the Zebrafish. Dev. Dyn. 1995, 203, 253–310. [Google Scholar] [CrossRef]
- Casellato, A.; Rossi Paccani, S.; Barrile, R.; Bossi, F.; Ciucchi, L.; Codolo, G.; Pizza, M.; Aricò, B.; de Bernard, M. The C2 Fragment from Neisseria Meningitidis Antigen NHBA Increases Endothelial Permeability by Destabilizing Adherens Junctions. Cell Microbiol. 2014, 16, 925–937. [Google Scholar] [CrossRef]
- Facchinello, N.; Schiavone, M.; Vettori, A.; Argenton, F.; Tiso, N. Monitoring Wnt Signaling in Zebrafish Using Fluorescent Biosensors. Methods Mol. Biol. 2016, 1481, 81–94. [Google Scholar] [CrossRef] [PubMed]
- Camillo, C.; Facchinello, N.; Villari, G.; Mana, G.; Gioelli, N.; Sandri, C.; Astone, M.; Tortarolo, D.; Clapero, F.; Gays, D.; et al. LPHN2 Inhibits Vascular Permeability by Differential Control of Endothelial Cell Adhesion. J. Cell Biol. 2021, 220, e202006033. [Google Scholar] [CrossRef] [PubMed]
- Pozzobon, T.; Facchinello, N.; Bossi, F.; Capitani, N.; Benagiano, M.; Di Benedetto, G.; Zennaro, C.; West, N.; Codolo, G.; Bernardini, M.; et al. Treponema Pallidum (Syphilis) Antigen TpF1 Induces Angiogenesis through the Activation of the IL-8 Pathway. Sci. Rep. 2016, 6, 18785. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Gene | Sequence (5′-3′) |
---|---|
rna18s | F: GCCTGCGGCTTAATTTGACT R: ACCACCCACAGAATCGAGAAA |
il-1b | F: GACATGCTCATGGCGAACG R: GCAAATCGTGCATTGCAAGACG |
il-6 | F: GTGAAGACACTCAGAGACG R: GTTAGACATCTTTCCGTGCTG |
il-10 | F:TCAGAGCAGGAGAGTCGAATGCA R: CGATTGGGGTTGTGGAGTGCTT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Codolo, G.; Facchinello, N.; Papa, N.; Bertocco, A.; Coletta, S.; Benna, C.; Dall’Olmo, L.; Mocellin, S.; Tiso, N.; de Bernard, M. Macrophage-Mediated Melanoma Reduction after HP-NAP Treatment in a Zebrafish Xenograft Model. Int. J. Mol. Sci. 2022, 23, 1644. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms23031644
Codolo G, Facchinello N, Papa N, Bertocco A, Coletta S, Benna C, Dall’Olmo L, Mocellin S, Tiso N, de Bernard M. Macrophage-Mediated Melanoma Reduction after HP-NAP Treatment in a Zebrafish Xenograft Model. International Journal of Molecular Sciences. 2022; 23(3):1644. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms23031644
Chicago/Turabian StyleCodolo, Gaia, Nicola Facchinello, Nicole Papa, Ambra Bertocco, Sara Coletta, Clara Benna, Luigi Dall’Olmo, Simone Mocellin, Natascia Tiso, and Marina de Bernard. 2022. "Macrophage-Mediated Melanoma Reduction after HP-NAP Treatment in a Zebrafish Xenograft Model" International Journal of Molecular Sciences 23, no. 3: 1644. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms23031644