Next Article in Journal
Bioavailability of Heavy Metals in Soil: Impact on Microbial Biodegradation of Organic Compounds and Possible Improvement Strategies
Next Article in Special Issue
Plant Defense against Insect Herbivores
Previous Article in Journal
Frequency-Dependent Magnetic Susceptibility of Magnetite and Cobalt Ferrite Nanoparticles Embedded in PAA Hydrogel
Previous Article in Special Issue
Characterization, Purification of Poncirin from Edible Citrus Ougan (Citrus reticulate cv. Suavissima) and Its Growth Inhibitory Effect on Human Gastric Cancer Cells SGC-7901
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Oxidative and Molecular Responses in Capsicum annuum L. after Hydrogen Peroxide, Salicylic Acid and Chitosan Foliar Applications

1
Biosystems Engineering Group, School of Engineering, Queretaro Autonomous University, C.U Cerro de las Campanas, S/N, colonia Las Campanas, CP 76010, Santiago de Querétaro, Querétaro, Mexico
2
Biotechnology Group, National Institute for Forestry, Agriculture and Livestock Research (INIFAP), Celaya-San Miguel de Allende, km 6, CP 38010, Celaya, Guanajuato, Mexico
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2013, 14(5), 10178-10196; https://0-doi-org.brum.beds.ac.uk/10.3390/ijms140510178
Submission received: 16 February 2013 / Revised: 24 April 2013 / Accepted: 2 May 2013 / Published: 15 May 2013
(This article belongs to the Special Issue Molecular Research in Plant Secondary Metabolism)

Abstract

:
Hydrogen peroxide (H2O2) is an important ROS molecule (Reactive oxygen species) that serves as a signal of oxidative stress and activation of signaling cascades as a result of the early response of the plant to biotic stress. This response can also be generated with the application of elicitors, stable molecules that induce the activation of transduction cascades and hormonal pathways, which trigger induced resistance to environmental stress. In this work, we evaluated the endogenous H2O2 production caused by salicylic acid (SA), chitosan (QN), and H2O2 elicitors in Capsicum annuum L. Hydrogen peroxide production after elicitation, catalase (CAT) and phenylalanine ammonia lyase (PAL) activities, as well as gene expression analysis of cat1, pal, and pathogenesis-related protein 1 (pr1) were determined. Our results displayed that 6.7 and 10 mM SA concentrations, and, 14 and 18 mM H2O2 concentrations, induced an endogenous H2O2 and gene expression. QN treatments induced the same responses in lesser proportion than the other two elicitors. Endogenous H2O2 production monitored during several days, showed results that could be an indicator for determining application opportunity uses in agriculture for maintaining plant alert systems against a stress.

1. Introduction

Plants are frequently exposed to different environmental stresses, which can be both biotic and/or abiotic. These stresses cause biochemical alterations as generation of hydrogen peroxide (H2O2) resulting in an early response of the plant defense mechanism [14]. The oxidative burst, the generation of reactive oxygen species (ROS) in response to microbial pathogen attack, is a ubiquitous early part of the resistance mechanisms of plant cells. H2O2 is a form of Reactive Oxygen Species (ROS) which are generated as a result of oxidative stress, and it is involved in the control and regulation of biological processes, such as growth, cell cycle, programmed cell death, hormone signaling, biotic/abiotic stress responses, and development [2,47]. The aforementioned research suggests that during the course of evolution, plants were able to achieve a high control degree over ROS toxicity, through a highly balanced and tightly coordinated network of at least 152 genes which encode both ROS-producing and ROS-scavenging enzymes [6]. For this reason, ROS molecules have been used as signaling molecules and accordingly, the interplay between the ROS-producing and ROS-scavenging pathways will determine the intensity, duration and localization of the ROS signals [6]. Usually, high intensity cellular signaling via ROS is generated by biotic stress, particularly in plant-pathogen interactions. However, this signaling cascade can also be activated by the use of elicitors, stable molecules that induce an immune defense response in plants, similar to that generated by microorganism-associated molecular patterns (MAMPs) [810]. Elicitor-induced plant signaling, serves as a guide to a series of intracellular events that end in the activation of transduction cascades and hormonal pathways, which trigger induced resistance and consequently activate plant immunity to environmental stresses [911]. Many substances have been discovered that work as elicitors [12]. Some examples are jasmonates, such as methyl jasmonate (MJ) and jasmonic acid (JA); other groups include salicylic acid (SA), benzothiadiazole (BTH), Etephon, hydrogen peroxide, and oligosaccharides such as chitosan, among other compounds [13]. Plant defensive mechanisms could be encouraged through the use of elicitors [14,15]. In fact, it is known that treatment of plants with elicitors, or attack with pathogens, causes a set of defense reactions such as the accumulation of defensive secondary metabolites in edible and inedible parts of plants, specific gene expression and enzymatic induction [13]. The effect of elicitors depends on many factors such as the concentration of the elicitor, time of elicitation, and stage in which elicitor is applied [16]. Also, elicitors can have a synergistic effect. Heredia and Cisneros-Zevallos [17] reported that a combination of ET and MJ on wounded lettuce, celery, red onions, carrots, and jicama tissues amplifies the stress response possibly because both stresses may share common signaling molecules. Thus, the aim of this work was to evaluate the effect of the SA, H2O2, and QN elicitors on H2O2 production, gene and enzymatic defense-related dynamic in Capsicum annuum L. Our results are discussed and concluded in terms of new possibilities of doses-scheme strategies in crop protection against biotic stresses resulting from the biochemical and molecular studies carried out in this research.

2. Results and Discussion

2.1. H2O2 Detection with DAB in C. annuum L. due to Elicitors’ Application

The H2O2 generation in leaves of C. annuum L. var. Don Benito due to the elicitors’ application was visually analyzed by staining with 3, 3′-Diaminobencidine (DAB) [18]. This staining polymerizes and turns deep brown in the presence of H2O2, and the intensity of the coloration and its localization can be visually assessed. H2O2 production in C. annuum L. leaves at 12 h post-application of SA (0.1, 6.7 and 10 mM), H2O2 (6, 14 and 18 mM) and QN (10, 670 and 1000 μg/mL) elicitors is shown in Figure 1. We observed a strong coloration induced with 6.7 and 10 mM SA concentration, in contrast with the 0.1 mM concentration where the signal was less intense. The same trend, of minor to major accumulation of hydrogen peroxide was observed, but in less intensity with applications H2O2 (14 and 18 mM) and QN (670 μg/mL and 1000 μg/mL) elicitors. The presence of endogenous hydrogen peroxide induced by foliar application of H2O2 (6 mM) elicitor is minimal compared with application of the other concentrations of this elicitor. Alternatively, it simply had no visible effect, at least with DAB staining, as was case of foliar application QN (10 μg/mL) elicitor. In general, the color was visibly observed at the base of the leaf, notably deeper in the tissue, and immediately appearing in primary and secondary veins from leaves (Figure 1). In contrast with the control, this was only sprayed with water, and where generation of H2O2 was not observed. Our results showed that exogenous application of SA, H2O2, and QN elicitors significantly induced hydrogen peroxide generation depending on the concentration of elicitor. This is an important point, because generally ROS molecules as hydrogen peroxide, and plant resistance to biotic stress are directly related to plant infection [19]. One example is reported by Guevara-Olvera et al. [20] where H2O2 production, evaluated by DAB staining, was significantly higher at 6 h post inoculation (hpi) with geminivirus in transgenic tobacco lines than expressing CchGLP gene related to defense against biotic stress. Also, García-Neria et al. [21] showed a high accumulation of H2O2 at 6 hpi in PepGMV-inoculated leaves of resistant plants (C. chinense accession BG-3821) than in similar leaves from susceptible plants of C. annuum var. Sonora Anaheim. Our results also show the durability of the accumulation of H2O2 until 12 h post application elicitors. Thus, we can infer that the plant could be on alert for any kind of stress. This is likely because H2O2 is produced in response to a variety of stimuli, and mediates cross-talk between signaling pathways. Moreover, some elicitors may not require a receptor-based mechanism for their activity [1,22,23].

2.2. Quantitative Analysis of the H2O2 Endogenous Content in Capsicum annuum L

Oxidative stress arises from an imbalance of metabolism and generation of ROS, and the extent of oxidative stress in a cell is determined by the amounts of superoxide, hydrogen peroxide, and hydroxyl radicals [24]. The amount of H2O2 generated by elicitor’s application in C. annuum L. was measured and a dynamic production of the molecule was shown over time, in order to establish the H2O2 production durability. H2O2 production dynamic by effect of SA (0.1, 6 and 10 mM), H2O2 (6, 14 and 18 mM) and QN (10, 670 and 1000 μg/mL) application is showed in Figure 2. It was shown that H2O2 production in C. annuum L. was significantly triggered in the early hours after elicitors’ application, compared to control. Moreover, in control treatments (0 mM elicitor), H2O2 levels were not significantly different during the evaluated periods. The monitoring of peroxide production was followed until day 30 after application of SA, H2O2 and QN elicitors, in order to estimate the H2O2 endogenous levels after the first elicitation. H2O2 production’s highest levels were localized from 4 to 30 days post-application (dpa) of elicitors’ application (Figure 2). It was also shown that H2O2 decreased until day 42 post first application (bsa) of elicitors (Figure 2). During day 42, we carried out a second application of elicitors in order to evaluate the H2O2 production levels when the plants are in a more developed stage. After second applications, H2O2 production level increased significantly, and differences were observed in H2O2 production among elicitors and their concentrations (Figure 2). Noteworthy that the half-life of exogenous 20 mM H2O2 is 2 min, and that after only 5 min, no H2O2 is detectable [25]. Therefore, the results shown refer only to endogen peroxide content caused by elicitors. H2O2 production was similar in SA (5.21 ng/mg tissue fresh weight, Figure 2a) and H2O2 (4.9 ng/mg tissue fresh weight, Figure 2b). In QN applications, H2O2 production reached 4.5 ng/mg fresh weight, which coincides with Lin et al. [26] who showed an inhibition of the chitosan-mediated increase in the H2O2 levels that led to a lower expression of glucanase and chitinase transcripts in rice.

2.3. CAT and PAL Enzyme Activity

The dynamics of CAT and PAL specific activity in C. annuum L. var. Don Benito by elicitors’ application is shown in Figures 3 and 4, respectively. In Figure 3, it can be observed that CAT activity was significantly activated after any of the evaluated elicitors. Additionally, CAT activity followed a similar trend as H2O2 production level, except during the first 12 h post-application in the first application (Figure 2). In control treatments, CAT activity did not show significant differences. After the second application of elicitors, CAT activity increased at highest levels at 5 dpa (Figure 3). The latter results suggest that CAT activity was directly proportional to the H2O2 production generated by each elicitor, except during the first hours post-application. Our results suggest that high catalase activity is due to the stimulus received at the plant by elicitors. This coincides with exogenous applications of jasmonic acid (JA, another elicitor) as reported by Liu et al. [27], where CAT activity is increased up to 180 U in wheat plants pretreated with 1 mM JA and subsequently subjected to stress with UV-B radiation. Also, Iseri et al. [24] demonstrated that exogenous application of H2O2 in plants of tomato significantly enhance oxidative stress response and tolerance by elevating the antioxidant status of tomato as evidenced by CAT activity. However, our results also differ to those of Airaki et al. [28] because they report 100 times less CAT activity than reported in this study, when plants of C. annuum are only exposed to cold stress. This difference could be due to which cold stress causes a regular decrease in all the apoplastic antioxidant enzymes (SOD, CAT, and POX) as reported by Mutlu et al. [29] in the cold-sensitive cultivar of barley, whereas the SA application to sensitive and tolerant cultivars of barley before the exposure to cold stress increased the activities of the apoplastic antioxidant enzymes.
On the other hand, PAL is the key enzyme of phenylpropanoid metabolism in higher plants and several studies indicated that the activation of PAL and subsequent increase in phenolic content in plants is a general response associated with disease resistance [30]. PAL activity dynamic by effect of elicitors’ application in C. annuum L. var. Don Benito is shown in Figure 4. On the whole, no significant differences in the various sampling times evaluated in control treatments (0 mM elicitor) were shown. In addition, during the first application of any of the evaluated elicitors, significant increases in PAL activity were observed, as displayed in the Figure. This figure shows that PAL activity increases significantly just after application of SA, H2O2 and QN elicitors, up to 5 days after application, correlating with a H2O2 production (Figure 2), likely suggesting that this molecule acted as signal for activation of this enzyme as expected. QN increased PAL activity to 21 μg cinnamic acid/mg protein in 8 h (Figure 4c), staying almost unchanged until 4 dpa the first application. SA (Figure 4a) and H2O2 (Figure 5b) only generated a PAL activity of 17 μg cinnamic acid/mg protein in 4 dpa and 8 hpa, respectively. The results showed that PAL activity was high at 12 h post-application of elicitors (Figure 4), and the fact that this occurs in the first hours post-application suggests the rapid signaling from hydrogen peroxide for activation of this enzyme, which catalyzes the first step in phenylpropanoid biosynthetic pathway, having an important role in several aspects of plant growth, development and in the inducible plant defenses against both biotic and abiotic stresses [3133]. Finally, after second application of elicitors, a significant increase in PAL activity was displayed after 4–5 days depending on the elicitor and concentration evaluated.

2.4. Gene Expression Pattern of cat1, pal, and pr1 in C. annuum L. var. Don Benito

H2O2 is involved in the regulation of several stress-related genes, and genes encoding to cat1 and pal, which are widely used as indicators of ROS responsive and oxidative stress specific signaling. On the other hand, pr1 is indicative of biotic stress [32,33]. The gene expression pattern of cat1, pal, and pr1, by effect of elicitors’ application at different times in C. annuum L. var. Don Benito is shown in Figure 5. All expression patterns were evaluated using the highest concentration of each elicitor: SA (10 mM), H2O2 (18 mM) and QN (1000 μg/mL). It is shown that cat1 expression is mainly induced by SA (10 Mm) and H2O2 (18 mM) in the first application of these elicitors. Moreover, Figure 5 shows that cat1 expression was 20-fold increased respect to control, in the second application of elicitors. The pal expression pattern showed that, in the first application of elicitors, SA (10 mM) induced twice as much pal expression as the control. QN (1000 μg/mL) induced 4 times as much pal expression in both evaluated times. After second elicitor application, the PAL expression increased 12-fold with respect to the control, until 3 dpa for SA (10 mM) and QN (1000 μg/mL), the expression of which decreased for day 5 dpa, in contrast with H2O2 elicitor, which did not maintain a significant pal expression in 3 and 5 dpa, with respect to SA and QN. Finally, gene expression of pr1 was mainly induced with SA (10 mM), with initial expression of 3 times more than the control in the first application and extends during the 5 dpa of the same application, increasing its expression until 12 times that of the control in the second application. Induction of expression with H2O2 (18 mM) maintained low levels, between 1–2 fold more than the control, in the first application of elicitors. In the second application of elicitors, it can be observed that expression level changed from 1 to 6-fold in the second application. QN induced expression of pr1 on average 1.3-fold in the early 2 hpa of first application, increasing on average 9.3-fold more than the control in the second application. It should be noted that the cat1, pal and pr1 expression from control plants that were sprayed only with water, was at the same level in at all times tested, so we decided to show only a representative image from the control.
The expression of three catalase genes from Nicotiana plumbaginifolia has been analyzed, demonstrating that cat1 is specifically involved in the scavenging of photorespiratory H2O2, which, with the exception of senescing petals, is restricted to green organs [34]. In addition, based on the analysis of cat1 expression, transcript level in C. annum leaves were increased through oxidative stress dynamic, mainly by SA and H2O2, and potentially induced with second application (Figure 5). This result indicates that the enhanced catalase activity in systemic leaves of C. annuum L. elicitor treated is likely at least in part attributable to the increase in cat1 expression levels and scavenging of the H2O2 generated by elicitors’ treatment. The aforementioned is because it is not expected that cat1 is the only gene encoding catalase activities in pepper, as suggested elsewhere [35]. These latter authors showed an increase in cat1 mRNA level in C. annuum L. in paraquat-treated plants. It suggests that cat1 can play an important role in response to environmental stresses. Regarding pal expression, it is known that an increase in the content of pal mRNA often underlies activation of the enzyme [36]. As well as the cat1 expression, the pal expression was induced mainly by SA and H2O2 elicitors, and substantially increased in second elicitor application, which is attributed to the state of alert in which the plant is already in (Figure 5). PR proteins are locally induced in response to pathogen attack as well as systemically in both compatible and incompatible host/pathogen interactions [37]. For instance, the SAR response of pepper plants is accompanied by a systemic microoxidative burst that generates H2O2 and a systemic expression of defense-related genes in uninoculated leaves [37]. ROS induces the coordinate expression of a set of so-called SAR genes [38]. In this context, De Román et al. [39] showed that induced resistance to foliar pathogens with analogous of SA, acibenzolar-S-methyl (ASM) can (i) move from the above-ground to the below-ground compartment and (ii) affect mutualistic micro-organisms as well as plant pathogens. Our results show the rapid induction of pr1 of C. annuum L. with SA (10 mM) and H2O2 (18 mM) in contrast with QN (1000 μg·mL−1) induction, where pr1 expression is minimal (Figure 5). Indicating that exogenous application of elicitors is an efficient manner of inducing defense-related genes and proteins. In Arabidopsis leaves from plants treated with chitosan, benzothiadiazole, wounding, methyl viologen or control were used for the purification of phosphorylated proteins [40]. These authors described the quantitative changes of phosphoproteins present in Arabidopsis thaliana leaves after challenging with elicitors or treatments mimicking biotic stresses, which stimulate basal resistance responses, or oxidative stress.

3. Experimental Section

3.1. Plant Growth

The variety Don Benito of C. annuum L. was utilized in this study. This species was used because in our laboratory, pepper has been a study model for several physiological, molecular and biochemical studies since 10 years ago. The seeds were treated with 200 ppm of potassium nitrate to stimulate germination. After germination, the seedlings were grown in a substrate of peat moss in a germination room with a photoperiod of 16 h light-8 h dark at 25 °C. Plants were watered with the Steiner nutritive solution at 50% [41].

3.2. Stress Treatments with Elicitors’ Application

Treatments with elicitors were applied to plants of 8–10 leaf-stage, and the control plants were treated only with water. Two foliar applications unique, were took out at a time deferred with the objective of generate a dynamic of an oxidative stress. Acid salicylic (SA), hydrogen peroxide (H2O2), and chitosan (QN) were the elicitors used. The reason for using these elicitors was because in our laboratory these elicitors have been studied in order to further agronomic applications in greenhouse plant production. The QN was derived from chitin shrimp, had a molecular weight of 1836.277 g/mol and deacetylation degree of 95% [42]. Three different concentrations of each elicitor were used: 0.1 mM, 6.7 mM, and 10 mM for SA (Sigma, St. Louis, MO, USA); 6 mM, 14 mM, and 18 mM for H2O2 (Mallinckrodt Reagent Chemicals, Raleigh, NC, USA); and, 10 μg/mL, 670 μg/mL, and 1000 μg/mL for QN [42]. These concentrations were established because they are within the concentrations range where these elicitors have been tested with antimicrobial activity [12,14,43]. The QN solutions were previously hydrolyzed as described by Lizárraga-Paulín et al. [44]. Samples were taken immediately after the first application (iafa) of elicitors in day zero, as well as at 2, 4, 8, and 12 h post application (hpa), and at 1, 2, 3, 4, 5, 10 and 30 days post application (dpa). Subsequently, at day 42 after the first application when plants had 12–16 leaf-stage, a second application was made. The sampling was done before and after of this application, as well as at 1, 3, 4 and 5 dpa. The sampling was performed of apical leaves in both phenologial stages of the plants analyzed.

3.3. H2O2 Detection with DAB Staining

The detection H2O2 in leaves of C. annuum L. by using 3,3-diaminobenzidine (DAB) as substrate, is a qualitative method to measure the H2O2 generation, and was realized according to method described by Thordal-Christenssen et al. [18] with the following modifications: plant leaves were cut with a scalpel from the base of the stem, and submerged for 8 h under light at 25 °C in 1 mg/mL solution of DAB-MOPS 10 mM (Sigma-Aldrich, St. Louis, MO, USA), because MOPS is one of the main buffers of biological systems. The solution was acidified with HCl until obtain a pH 3.8 necessary to solubilize DAB. [18] After that time, the sheets were washed with methanol in a warm water bath, and then were stored in 50% glycerol [20,21]. Dark-brown zones indicated the presence of H2O2.

3.4. Plant Extracts Preparation

Plant extracts were obtained in accordance with Sibanda and Okoh [45] with following modifications: 50 mg plant tissue were frozen and milled in liquid nitrogen. Samples were homogenized with two washes in acetone (2.5 mL per wash) and centrifuged at 5000 rpm for 10 min, the supernatant was removed and 1.5 mL of 0.05 M potassium phosphate (pH 7.0) was added to the pellet, which was resuspended through vortex and centrifuged at 13000 rpm for 15 min.

3.5. H2O2 Content Assay

For quantitative measurements of H2O2 production, 100 μL of plant extract was mixed with Hydrogen Peroxide Substrate Solution (90 μL) containing ferrous iron and xylenol orange (Hydrogen Peroxide Assay Kit, National Diagnostics Atlanta, GA, USA), the blank was prepared in the same manner except that 100 μL of 0.05 M potassium phosphate (pH 7.0) was used instead of the sample. The mixture was incubated at room temperature for 30 min. The absorbance at 560 nm was measured for each sample and compared with a standard curve made by measuring known hydrogen peroxide concentrations. Experiments were performed in duplicate.

3.6. Enzyme Activity Assays

CAT activity was determined spectrophotometrically, monitoring the oxidation of H2O2 at 240 nm, as described by Chandlee et al. [46]. The reaction mix consisted of 1 mL of plant extract and 1 mL of 0.022 M H2O2. The blank was prepared in the same manner except that 1 mL of 0.05 M potassium phosphate (pH 7.0) was used instead of the sample. An aliquot of the extract was used to determine protein content through the Bradford method [47] utilizing bovine serum albumin as standard. The enzyme-specific activity is expressed as μmol of oxidized H2O2 per mg of protein, per minute (μmol/mg protein/min).
To determine PAL activity, plant extracts were prepared similarly using 0.1 M borate buffer (pH 8.8). PAL activity was determined spectrophotometrically at 290 nm by the formation of trans-cinnamic acid (SIGMA) as the method described by Gerasimova et al. [48] with some modifications. The standard curve was performed using different concentrations of cinnamic acid. The reaction mix contained 100 μL of plant extract and 100 μL 60 μM/mL l-phenylalanine (MERCK, Naucalpan, Edo. Mexico, Mexico) solution. Reaction mixes were incubated at 37 °C for 1 h. In control samples, the extract was replaced by borate buffer. The reaction was stopped by adding 50 μL 1 M trichloroacetic acid (J.T. Baker, Phillipsburg, NJ, USA). Protein concentration was measured according to the method described by Bradford [47]. Enzyme activity was expressed by the amount of cinnamic acid produced in μmol/mg protein/h.

3.7. Gene Expression Analysis of cat1, pal, and pr1 in Capsicum annuum L

Gene expression analysis was carried out at 0, 24, 72, and 120 h, and at day 42 after first elicitor’s application. Also took place at 0, 24, 72, and 120 h after the second elicitor application, carried out in day 42 after first elicitors application, with objective know if it maintains or increases the gene expression after the second application of elicitors and their relationship with the H2O2 production dynamics by effect of elicitors in C. annuum L. Total RNA extraction was done using TRIzol® Reagent (Catalogue 15596-026, Invitrogen, Carlsbad, CA, USA). Complementary DNA (cDNA) was obtained through First Strand cDNA Synthesis Kit (Catalogue K1611, Fermentas, Glen Burnie, MD, USA), starting from 700 ng of total RNA. To carry out amplification of genes cat1, pal and pr1 of Capsicum annuum L., were obtained its sequences of the GenBank database to design specific oligonucleotides (Table 1). Also, glyceraldehyde phosphate dehydrogenase gene (GPDH) from C. annuum L. (accession number AJ246011) was evaluated. PCR conditions were: 30 cycles of 95 °C for 30 s; 65 °C for 2 min, and 72 °C for 1 min. PCR products were visualized on 1.5% agarose gels using a digital image system (DNR Bio-Imaging Systems Mini BIS Pro, Hamisha, Jerusalem, Israel).

3.8. Statistical Analyses

Statistical analysis was conducted using the software JMP 5.0.1 [49]. A completely random experimental design was used to evaluate the effect of the type and concentration of elicitors in the two varieties of C. annuum L. for oxidative stress studies. The arrangement consisted of 20 treatments with 3 replications, considering as experimental unit 4 plants. Data were subjected to analysis of variance (ANOVA) and the differences between means were compared using Tukey’s test (p < 0.05).

4. Conclusions

Exogenous application of SA, H2O2, and QN elicitors in C. annuum L significantly increased endogenous H2O2 as well as gene expression and enzymatic activities related with plant defense as phenylalanine ammonia lyase and catalase 1. The duration of oxidative and molecular inductions was 30 days in the first elicitors’ application. The second elicitors’ applications displayed significant increased activity of CAT and PAL and H2O2 endogenous concentration after 4–5 days post-application in an elicitor-dose manner. It can be suggested that monitoring the biochemical and molecular indicators evaluated in this work might be a criteria to determine the appropriate time for elicitors’ application, and thus induce the defense system of C. annuum L. for agricultural uses. Based on our results, elicitor application could be conducted once a month to keep on alert the plant defense system, in order to diminish the cost of an induced response that is typically measured as a reduction in plant fitness. In our laboratory, currently we are undertaking experiments related to plant-costs for elicitation, especially using metabolomic and physiological methods. Also, we will attempt to evaluate all these aspects related to elicitors’ application in agricultural practices, with minor plant and environmental-costs and increased quality of microbe-free products.

Acknowledgments

The authors express their thanks to FORDECyT 2012-02, Ciencia Básica (SEP-CONACyT 2012), FOMIX-QRO (2012) and FOFI-UAQ-2012 to Ramón Gerardo Guevara-González, for their partial support to this work. Besides thanks to PROMEP (Proyectos Redes) for Irineo Torres-Pacheco, also by partial support to this work. Special thanks to Eva Lizárraga-Paulín, Brenda Garín-Arroyo and Héctor Prastegui-Nava for their valuable collaboration in the laboratory. Special thanks to Mario M. González-Chavira (INIFAP) y Susana Patricia Miranda-Castro (FESC, UNAM, Mexico) who kindly provided the biological material, seeds of Capsicum annuum L. and chitosan elicitor, respectively for this project.

Conflict of Interest

The authors declare no conflict of interest.

References

  1. Neill, S.J.; Desikan, R.; Clarke, A.; Hurst, R.D.; Hancock, J.T. Hydrogen peroxide and nitric oxide as signalling molecules in plants. J. Exp. Bot 2002, 53, 1237–1247. [Google Scholar]
  2. Gechev, T.S.; Hille, J. Hydrogen peroxide as a signal controlling plant programmed cell death. J. Cell Biol 2005, 168, 17–20. [Google Scholar]
  3. Pitzschke, A.; Hirt, H. Mitogen-Activated Protein Kinases and Reactive Oxygen Species Signaling in Plants. Plant Physiol 2006, 141, 351–356. [Google Scholar]
  4. Fones, H.; Preston, G.M. Reactive oxygen and oxidative stress tolerance in plant pathogenic Pseudomonas. FEMS Microbiol. Lett 2011, 327, 1–8. [Google Scholar]
  5. Apel, K.; Hirt, H. Reactive oxygen species: Metabolism, oxidative stress, and signal transduction. Annu. Rev. Plant Biol 2004, 55, 373–399. [Google Scholar]
  6. Mittler, R.; Vanderauwera, S.; Gollery, M.; van Breusegem, F. Reactive oxygen gene network of plants. Trends. Plant Sci 2004, 9, 490–498. [Google Scholar]
  7. Inzé, A.; Vanderauwera, S.; Hoeberichts, F.A.; Vandorpe, M.; Van Gaever, T.; van Breusegem, F. A subcellular localization compendium of hydrogen peroxide-induced proteins. Plant Cell. Environ 2012, 35, 308–320. [Google Scholar]
  8. Holopainen, J.K.; Heijari, J.; Nerg, A.M.; Vuorinen, M.; Kainulainen, P. Potential for the use of exogenous chemical elicitors in disease and insect pest management of conifer seedling production. Open For. Sci. J 2009, 2, 17–24. [Google Scholar]
  9. Mejía-Teniente, L.; Torres-Pacheco, I.; González-Chavira, M.M.; Ocampo-Velázquez, R.V.; Herrera-Ruiz, G.; Chapa-Oliver, A.M.; Guevara-González, R.G. Use of elicitors as an approach for sustainable agriculture. Afr. J. Biotechnol 2010, 9, 9155–9162. [Google Scholar]
  10. Spoel, S.H.; Dong, X. How do plants achieve immunity? Defence without specialized immune cells. Nat. Rev. Immunol 2012, 12, 89–100. [Google Scholar]
  11. Jones, D.G.; Dangl, J.L. The plant immune system. Nature 2006, 444, 323–329. [Google Scholar]
  12. Terry, L.A.; Joyce, D.C. Elicitors of induced disease resistance in postharvest horticultural crops: A brief review. Postharvest Biol. Technol 2004, 32, 1–13. [Google Scholar]
  13. García-Mier, L.; Guevara-González, R.G.; Mondragón-Olguín, V.M.; del Verduzco-Cuellar, B.R.; Torres-Pacheco, I. Agriculture and Bioactives: Achieving Both Crop Yield and Phytochemicals. Int. J. Mol. Sci 2013, 14, 4203–4222. [Google Scholar]
  14. Zinovieva, S.V.; Vasyukova, N.I.; Udalova, Z.V.; Gerasimova, N.G.; Ozeretskovskaya, O.L. Involvement of salicylic acid in induction of nematode resistance in plants. Biol. Bull 2011, 38, 453–458. [Google Scholar]
  15. Montesano, M.; Brader, G.; Palva, E.T. Pathogen derived elicitors: Searching for receptors in plants. Mol. Plant Pathol 2003, 4, 73–79. [Google Scholar]
  16. Jeong, G.-T.; Park, D.-H. Enhancement of growth and secondary metabolite biosynthesis: Effect of elicitors derived from plants and insects. Biotechnol. Bioprocess Eng 2005, 10, 73–77. [Google Scholar]
  17. Heredia, J.B.; Cisneros-Zevallos, L. The effects of exogenous ethylene and methyl jasmonate on the accumulation of phenolic antioxidants in selected whole and wounded fresh produce. Food Chem 2009, 115, 1500–1508. [Google Scholar]
  18. Thordal-Christensen, H.; Zhang, Z.; Wei, Y.; Collinge, D.B. Subcellular localization of H2O2 in plants. H2O2 accumulation in papillae and hypersensitive response during the barley-powdery mildew interaction. Plant J 1997, 11, 1187–1194. [Google Scholar]
  19. Vlot, A.C.; Dempsey, D.A.; Klessig, D.F. Salicylic acid, a multifaceted hormone to combat isease. Annu. Rev. Phytopathol 2009, 47, 177–206. [Google Scholar]
  20. Guevara-Olvera, L.; Ruíz-Nito, M.L.; Rangel-Cano, R.M.; Torres-Pacheco, I.; Rivera-Bustamante, R.F.; Muñoz-Sánchez, C.I.; González-Chavira, M.M.; Cruz-Hernandez, A.; Guevara-González, R.G. Expression of a germin-like protein gene (CchGLP) from a geminivirus-resistant pepper (Capsicum chinense Jacq.) enhances tolerance to geminivirus infection in transgenic tobacco. Physiol. Mol. Plant Pathol 2012, 78, 45–50. [Google Scholar]
  21. García-Neria, M.A.; Rivera-Bustamante, R. Characterization of Geminivirus Resistance in an Accession of Capsicum chinense Jacq. Mol. Plant. Microbe Interact 2011, 24, 172–182. [Google Scholar]
  22. Chong, T.M.; Abdullah, M.A.; Fadzillah, N.M.; Lai, O.M.; Lajis, N.H. Jasmonic acid elicitation of anthraquinones with some associated enzymic and non-enzymic antioxidant responses in Morinda elliptica. Enzyme Microb. Tech 2005, 36, 469–477. [Google Scholar]
  23. Mayers, C.N.; Lee, K.C.; Moore, C.A.; Wong, S.M.; Carr, J.P. Salicylic acid-induced resistance to Cucumber mosaic virus in squash and Arabidopsis thaliana: Contrasting mechanisms of induction and antiviral action. Mol. Plant Microbe. Interact 2005, 18, 428–434. [Google Scholar]
  24. Iseri, O.D.; Korpe, D.A.; Sahin, F.I.; Haberal, M. Hydrogen peroxide pretreatment of roots enhanced oxidative stress response of tomato under cold stress. Acta Physiol Plant 2013. [Google Scholar] [CrossRef]
  25. Desikan, R.; Reynolds, A.; Hancock, J.T.; Neill, S.J. Harpin and hydrogen peroxide both initiate programmed cell death but have differential effects on gene expression in Arabidopsis suspension cultures. Biochem. J 1998, 330, 115–120. [Google Scholar]
  26. Lin, W.; Hu, X.; Zhang, W.; Rogers, W.J.; Cai, W. Hydrogen peroxide mediates defence reponses induced by chitosans of different molecular weights in rice. J. Plant Physiol 2005, 162, 937–944. [Google Scholar]
  27. Liu, X.; Chi, H.; Yue, M.; Zhang, X.; Li, W.; Jia, E. The regulation of exogenous jasmonic acid on UV-B stress tolerance in Wheat. J Plant Growth Regul 2012, 31, 436–447. [Google Scholar]
  28. Airaki, M.; Leterrier, M.; Mateos, R.M.; Valderrama, R.; Chaki, M.; Barroso, J.B.; Del Río, L.A.; Palma, J.M.; Corpas, F.J. Metabolism of reactive oxygen species and reactive nitrogen species in pepper (Capsicum annuum L.) plants under low temperature stresspce. Plant Cell Environ 2012, 35, 281–295. [Google Scholar]
  29. Mutlu, S.; Karadagoglu, O.; Atici, O.; Nalbantoglu, B. Protective role of salicylic acid applied before cold stress on antioxidative system and protein patterns in barley apoplast. Biol. Plant 2013. [Google Scholar] [CrossRef]
  30. Vimala, R.; Suriachandraselvan, M. Induced resistance in bhendi against powdery mildew by foliar application of salicylic acid. J. Biopesticides 2009, 2, 111–114. [Google Scholar]
  31. Bautista-Banos, S.; Hernandez-Lauzardo, A.N.; del Velazquez-Valle, M.G. Chitosan as a potential natural compound to control pre and postharvest diseases of horticultural commodities. Crop Prot 2006, 25, 108–118. [Google Scholar]
  32. Tanabe, S.; Hayashi, N.; Nishizawa, Y.; Yamane, H.; Shibuya, N.; Minami, E. Elicitor and catalase activity of conidia suspensions of various strains of Magnaporthe grisea in suspensions-cultured cells of rice. Biosci. Biotechnol. Biochem 2008, 72, 889–892. [Google Scholar]
  33. Sahebani, N.; Hadavi, N. Induction of H2O2 and related enzymes in tomato roots infected with root knot nematode (M. javanica) by several chemical and microbial elicitors. Biocontrol. Sci. Technol 2009, 19, 301–313. [Google Scholar]
  34. Willekens, H.; Langebartelst, C.; Tiré, C.; Van Montagu, M.; Inzé, D.; van Camp, W. Differential expression of catalase genes in Nicotiana plumbaginifolia (L.). EMBO J 1994, 16, 4806–4816. [Google Scholar]
  35. Lee, S.H.; An, C.S. Differential expression of three catalase genes in hot pepper (Capsicum annuum L.). Mol. Cells 2005, 20, 247–255. [Google Scholar]
  36. Xu, M.; Dong, J. O2− from elicitor-induced oxidative burst is necessary for triggering phenylalanine ammonia-lyase activation and catharanthine synthesis in Catharanthus roseus cell cultures. Enzyme Microb. Technol 2005, 36, 280–284. [Google Scholar]
  37. Heath, M.C. Hypersensitive response-related death. Plant Mol. Biol 2000, 44, 321–334. [Google Scholar]
  38. Choi, H.W.; Kim, Y.J.; Lee, S.C.; Hong, J.K.; Hwang, B.K. Hydrogen peroxide generation by the pepper extracellular peroxidase CaPO2 activates local and systemic cell death and defense response to bacterial pathogens. Plant Physiol 2007, 145, 890–904. [Google Scholar]
  39. De Román, M.; Fernández, I.; Wyatt, T.; Sahrawy, M.; Heil, M.; Pozo, M.J. Elicitation of foliar resistance mechanisms transiently impairs root association with arbuscular mycorrhizal fungi. J. Ecol 2011, 99, 36–45. [Google Scholar]
  40. Huang, C.; Verrillo, F.; Renzone, G.; Arena, S.; Rocco, M.; Scalonic, A.; Marra, M. Response to biotic and oxidative stress in Arabidopsis thaliana: Analysis of variably phosphorylated proteins. J. Proteomics 2011, 74, 1934–1949. [Google Scholar]
  41. Steiner, A.A. The universal nutrient solution. Proceedings of 6th International Congress on Soilles Culture, Wageningen, The Netherlands, 29 April–5 May 1984; pp. 633–650.
  42. Iriti, M.; Faoro, F. Chitosan as a MAMP, searching for a PRR. Plant Signal Behav 2009, 4, 66–68. [Google Scholar]
  43. Tierranegra-García, N.; Salinas-Soto, P.; Torres-Pacheco, I.; Ocampo-Velázquez, R.V.; Rico-García, E.; Mendoza-Diaz, S.O.; Feregrino-Pérez, A.A.; Mercado-Luna, A.; Vargas-Hernandez, M.; Soto-Zarazúa, G.M.; et al. Effect of foliar salicylic acid and methyl jasmonate applications on protection against pill-bugs in lettuce plants (Lactuca sativa). Phytoparasitica 2011, 39, 137–144. [Google Scholar]
  44. Lizárraga-Paulín, E.G.; Torres-Pacheco, I.; Moreno-Martínez, E.; Miranda-Castro, S.P. Chitosan application in maize (Zea mays) to counteract the effects of abiotic stress at seedling level. Afr. J. Biotechnol 2011, 10, 6439–6446. [Google Scholar]
  45. Sibanda, T.; Okoh, A.I. In vitro evaluation of interactions between acetone extracts of Garcinia kola seeds and some antibiotics. Afr. J. Biotechnol 2008, 7, 1672–1678. [Google Scholar]
  46. Chandlee, J.M.; Tsaftaris, A.S.; Scandalios, J.G. Purification and partial characterization of three genetically defined catalases of maize. Plant Sci. Lett 1983, 29, 117–131. [Google Scholar]
  47. Bradford, M.M. A rapid and sensitive method for quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem 1976, 72, 248–254. [Google Scholar]
  48. Gerasimova, N.G.; Pridvorova, S.M.; Ozeretskovskaya, O.L. Role of l-phenylalanine ammonia lyase in the induced resistance and susceptibility of potato plants. Appl. Biochem. Microbiol 2005, 41, 103–105. [Google Scholar]
  49. JMP, version 5.0.1; Software for dynamic data visualisation and deep analytics; SAS Institute: Cary, NC, USA, 2002.
Figure 1. Hydrogen peroxide detection using DAB staining at 12 h post-application of elicitors in C. annuum L. var. Don Benito.
Figure 1. Hydrogen peroxide detection using DAB staining at 12 h post-application of elicitors in C. annuum L. var. Don Benito.
Ijms 14 10178f1
Figure 2. H2O2 production dynamic in C. annuum L. var. Don Benito as result of elicitors’ applications at two different times. H2O2 production generated by three concentrations of: (a) SA elicitor; (b) H2O2 elicitor; (c) QN elicitor. Elicitors’ application first at day zero, and second application at day 42 after first application of elicitors. Abreviations: iafa: immediately after first application; bsa: before second application; iasa: immediately after second application; hpa: hours post application; dpa: days post application.
Figure 2. H2O2 production dynamic in C. annuum L. var. Don Benito as result of elicitors’ applications at two different times. H2O2 production generated by three concentrations of: (a) SA elicitor; (b) H2O2 elicitor; (c) QN elicitor. Elicitors’ application first at day zero, and second application at day 42 after first application of elicitors. Abreviations: iafa: immediately after first application; bsa: before second application; iasa: immediately after second application; hpa: hours post application; dpa: days post application.
Ijms 14 10178f2aIjms 14 10178f2b
Figure 3. Dynamic from catalase (CAT) specific activity in C. annuum L. var. Don Benito as result of unique applications of elicitors at two different times. (a) SA elicitor; (b) H2O2 elicitor; (c) QN elicitor. Elicitors’ application first in day zero, and second application in day 42 after first application of elicitors. Abreviations: iafa: immediately after first application; bsa: before second application; iasa: immediately after second application; hpa: hours post application; dpa: days post application.
Figure 3. Dynamic from catalase (CAT) specific activity in C. annuum L. var. Don Benito as result of unique applications of elicitors at two different times. (a) SA elicitor; (b) H2O2 elicitor; (c) QN elicitor. Elicitors’ application first in day zero, and second application in day 42 after first application of elicitors. Abreviations: iafa: immediately after first application; bsa: before second application; iasa: immediately after second application; hpa: hours post application; dpa: days post application.
Ijms 14 10178f3aIjms 14 10178f3b
Figure 4. Dynamic from phenylalanine ammonia lyase (PAL) specific activity in C. annuum L. variety Don Benito as result of unique applications of elicitors in two different times. PAL specific activity produced by three concentrations of: (a) SA elicitor; (b) H2O2 elicitor; (c) QN elicitor. Elicitors’ application first at day zero, and second application at day 42 after first application of elicitors. Abreviations: iafa: immediately after first application; bsa: before second application; iasa: immediately after second application; hpa: hours post application; dpa: days post application.
Figure 4. Dynamic from phenylalanine ammonia lyase (PAL) specific activity in C. annuum L. variety Don Benito as result of unique applications of elicitors in two different times. PAL specific activity produced by three concentrations of: (a) SA elicitor; (b) H2O2 elicitor; (c) QN elicitor. Elicitors’ application first at day zero, and second application at day 42 after first application of elicitors. Abreviations: iafa: immediately after first application; bsa: before second application; iasa: immediately after second application; hpa: hours post application; dpa: days post application.
Ijms 14 10178f4aIjms 14 10178f4b
Figure 5. Gene expression in C. annuum L. var. Don Benito by effect elicitor’s application. Cat1, pal and pr1 expression of C. annuum L.var. Don Benito as result of unique applications of SA (10 Mm), H2O2 (18 mM), and QN (1000 μg/mL) elicitors at two different times. First application at day zero, and second application, at day 42 after first application. Abbreviations: iafa: immediately after first application; bsa: before second application; iasa: immediately after second application; dpa: days post application. Glyceraldehyde Phosphate Dehydrogenase (CaGPDH) gene from C. annuum L. was used as control.
Figure 5. Gene expression in C. annuum L. var. Don Benito by effect elicitor’s application. Cat1, pal and pr1 expression of C. annuum L.var. Don Benito as result of unique applications of SA (10 Mm), H2O2 (18 mM), and QN (1000 μg/mL) elicitors at two different times. First application at day zero, and second application, at day 42 after first application. Abbreviations: iafa: immediately after first application; bsa: before second application; iasa: immediately after second application; dpa: days post application. Glyceraldehyde Phosphate Dehydrogenase (CaGPDH) gene from C. annuum L. was used as control.
Ijms 14 10178f5
Table 1. Sequences of oligonucleotides used to evaluate the molecular response of the application of elicitors in C. annuum L.
Table 1. Sequences of oligonucleotides used to evaluate the molecular response of the application of elicitors in C. annuum L.
NameOligonucleotide sequence (5′-3′)Product size (bp)Genbank accession No.
CaCAT-FGTCCATGAGCGTGGAAGCCCCGAAT841AF227952
CaCAT-RCGCGATGCATGAAGTTCATGGCACC
CaPAL-FTGGTGGATTTTTCGAGTTGCAGCCG831EU616575
CaPAL-RTGGCAAAGCGCCACGAGATAGGTTG
CaPR1-FCTTTTGCTATATTTCACTCAACACAAGCCC522AF053343
CaPR1-RTGCTGGATTTATTTTCCTTTTAACACATGA
CaGPDH-FGGCCTTATGACTACAGTTCACTCC255AJ246011
CaGPDH-RGATCAACCACAGAGACATCCACAG

Share and Cite

MDPI and ACS Style

Mejía-Teniente, L.; Durán-Flores, F.d.D.; Chapa-Oliver, A.M.; Torres-Pacheco, I.; Cruz-Hernández, A.; González-Chavira, M.M.; Ocampo-Velázquez, R.V.; Guevara-González, R.G. Oxidative and Molecular Responses in Capsicum annuum L. after Hydrogen Peroxide, Salicylic Acid and Chitosan Foliar Applications. Int. J. Mol. Sci. 2013, 14, 10178-10196. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms140510178

AMA Style

Mejía-Teniente L, Durán-Flores FdD, Chapa-Oliver AM, Torres-Pacheco I, Cruz-Hernández A, González-Chavira MM, Ocampo-Velázquez RV, Guevara-González RG. Oxidative and Molecular Responses in Capsicum annuum L. after Hydrogen Peroxide, Salicylic Acid and Chitosan Foliar Applications. International Journal of Molecular Sciences. 2013; 14(5):10178-10196. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms140510178

Chicago/Turabian Style

Mejía-Teniente, Laura, Flor de Dalia Durán-Flores, Angela María Chapa-Oliver, Irineo Torres-Pacheco, Andrés Cruz-Hernández, Mario M. González-Chavira, Rosalía V. Ocampo-Velázquez, and Ramón G. Guevara-González. 2013. "Oxidative and Molecular Responses in Capsicum annuum L. after Hydrogen Peroxide, Salicylic Acid and Chitosan Foliar Applications" International Journal of Molecular Sciences 14, no. 5: 10178-10196. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms140510178

Article Metrics

Back to TopTop