Long Non Coding RNA H19: A New Player in Hypoxia-Induced Multiple Myeloma Cell Dissemination
Abstract
:1. Introduction
2. Results
2.1. Hypoxic Stimulation Induced LncH19 Overexpression in MM Cell Models
2.2. LncH19 Sustained Hypoxic Response in MM Cell Lines
2.3. H19 Silencing Affected the Hypoxia-Induced Adhesion of MM Cells on the Stroma
2.4. LncH19 Promoted HIF-1α Activation in Hypoxic MM Cells
3. Discussion
4. Materials and Methods
4.1. Cell Culture and Reagents
4.2. Cell Infection
4.3. RNA Extraction and Real-Time PCR
4.4. Nuclear Protein Extraction and ELISA
4.5. Adhesion Assay
4.6. Total Protein Extract and Western Blot Analysis
4.7. Statistical Analysis
Author Contributions
Funding
Conflicts of Interest
Appendix A
References
- Diamantopoulos, M.A.; Tsiakanikas, P.; Scorilas, A. Non-coding RNAs: The riddle of the transcriptome and their perspectives in cancer. Ann. Transl. Med. 2018, 6, 241. [Google Scholar] [CrossRef] [PubMed]
- Sun, H.; Huang, Z.; Sheng, W.; Xu, M.D. Emerging roles of long non-coding RNAs in tumor metabolism. J. Hematol. Oncol. 2018, 11, 106. [Google Scholar] [CrossRef] [PubMed]
- Raveh, E.; Matouk, I.J.; Gilon, M.; Hochberg, A. The H19 Long non-coding RNA in cancer initiation, progression and metastasis—A proposed unifying theory. Mol. Cancer 2015, 14, 184. [Google Scholar] [CrossRef] [PubMed]
- Yoshimura, H.; Matsuda, Y.; Yamamoto, M.; Kamiya, S.; Ishiwata, T. Expression and role of long non-coding RNA H19 in carcinogenesis. Front. Biosci. (Landmark Ed.) 2018, 23, 614–625. [Google Scholar] [PubMed]
- Zhou, J.; Yang, L.; Zhong, T.; Mueller, M.; Men, Y.; Zhang, N.; Xie, J.; Giang, K.; Chung, H.; Sun, X.; et al. H19 lncRNA alters DNA methylation genome wide by regulating S-adenosylhomocysteine hydrolase. Nat. Commun. 2015, 6, 10221. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kallen, A.N.; Zhou, X.B.; Xu, J.; Qiao, C.; Ma, J.; Yan, L.; Lu, L.; Liu, C.; Yi, J.S.; Zhang, H.; et al. The imprinted H19 lncRNA antagonizes let-7 microRNAs. Mol. Cell 2013, 52, 101–112. [Google Scholar] [CrossRef] [PubMed]
- Keniry, A.; Oxley, D.; Monnier, P.; Kyba, M.; Dandolo, L.; Smits, G.; Reik, W. The H19 lincRNA is a developmental reservoir of miR-675 that suppresses growth and Igf1r. Nat. Cell Biol. 2012, 14, 659–665. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, G.; Xiang, T.; Wu, Q.F.; Wang, W.X. Long Noncoding RNA H19-Derived miR-675 Enhances Proliferation and Invasion via RUNX1 in Gastric Cancer Cells. Oncol. Res. 2016, 23, 99–107. [Google Scholar] [CrossRef]
- Ma, L.; Tian, X.; Guo, H.; Zhang, Z.; Du, C.; Wang, F.; Xie, X.; Gao, H.; Zhuang, Y.; Kornmann, M.; et al. Long noncoding RNA H19 derived miR-675 regulates cell proliferation by down-regulating E2F-1 in human pancreatic ductal adenocarcinoma. J. Cancer 2018, 9, 389–399. [Google Scholar] [CrossRef] [Green Version]
- Yan, J.; Zhang, Y.; She, Q.; Li, X.; Peng, L.; Wang, X.; Liu, S.; Shen, X.; Zhang, W.; Dong, Y.; et al. Long Noncoding RNA H19/miR-675 Axis Promotes Gastric Cancer via FADD/Caspase 8/Caspase 3 Signaling Pathway. Cell. Physiol. Biochem. 2017, 42, 2364–2376. [Google Scholar] [CrossRef]
- Lo Dico, A.; Costa, V.; Martelli, C.; Diceglie, C.; Rajata, F.; Rizzo, A.; Mancone, C.; Tripodi, M.; Ottobrini, L.; Alessandro, R.; et al. MiR675-5p Acts on HIF-1alpha to Sustain Hypoxic Responses: A New Therapeutic Strategy for Glioma. Theranostics 2016, 6, 1105–1118. [Google Scholar] [CrossRef] [PubMed]
- Costa, V.; Lo Dico, A.; Rizzo, A.; Rajata, F.; Tripodi, M.; Alessandro, R.; Conigliaro, A. MiR-675-5p supports hypoxia induced epithelial to mesenchymal transition in colon cancer cells. Oncotarget 2017, 8, 24292–24302. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wu, W.; Hu, Q.; Nie, E.; Yu, T.; Wu, Y.; Zhi, T.; Jiang, K.; Shen, F.; Wang, Y.; Zhang, J.; et al. Hypoxia induces H19 expression through direct and indirect Hif-1alpha activity, promoting oncogenic effects in glioblastoma. Sci. Rep. 2017, 7, 45029. [Google Scholar] [CrossRef] [PubMed]
- Muz, B.; de la Puente, P.; Azab, F.; Azab, A.K. The role of hypoxia in cancer progression, angiogenesis, metastasis, and resistance to therapy. Hypoxia (Auckl.) 2015, 3, 83–92. [Google Scholar] [CrossRef] [PubMed]
- Irigoyen, M.; Garcia-Ruiz, J.C.; Berra, E. The hypoxia signalling pathway in haematological malignancies. Oncotarget 2017, 8, 36832–36844. [Google Scholar] [CrossRef] [PubMed]
- Muz, B.; de la Puente, P.; Azab, F.; Luderer, M.; Azab, A.K. The role of hypoxia and exploitation of the hypoxic environment in hematologic malignancies. Mol. Cancer Res. 2014, 12, 1347–1354. [Google Scholar] [CrossRef] [PubMed]
- Kazandjian, D. Multiple myeloma epidemiology and survival: A unique malignancy. Semin. Oncol. 2016, 43, 676–681. [Google Scholar] [CrossRef] [Green Version]
- Muz, B.; de la Puente, P.; Azab, F.; Luderer, M.; Azab, A.K. Hypoxia promotes stem cell-like phenotype in multiple myeloma cells. Blood Cancer J. 2014, 4, e262. [Google Scholar] [CrossRef] [PubMed]
- Azab, A.K.; Hu, J.; Quang, P.; Azab, F.; Pitsillides, C.; Awwad, R.; Thompson, B.; Maiso, P.; Sun, J.D.; Hart, C.P.; et al. Hypoxia promotes dissemination of multiple myeloma through acquisition of epithelial to mesenchymal transition-like features. Blood 2012, 119, 5782–5794. [Google Scholar] [CrossRef] [PubMed]
- Roccaro, A.M.; Mishima, Y.; Sacco, A.; Moschetta, M.; Tai, Y.T.; Shi, J.; Zhang, Y.; Reagan, M.R.; Huynh, D.; Kawano, Y.; et al. CXCR4 Regulates Extra-Medullary Myeloma through Epithelial-Mesenchymal-Transition-like Transcriptional Activation. Cell Rep. 2015, 12, 622–635. [Google Scholar] [CrossRef] [Green Version]
- Sun, Y.; Pan, J.; Zhang, N.; Wei, W.; Yu, S.; Ai, L. Knockdown of long non-coding RNA H19 inhibits multiple myeloma cell growth via NF-kappaB pathway. Sci. Rep. 2017, 7, 18079. [Google Scholar] [CrossRef] [PubMed]
- Pan, Y.; Chen, H.; Shen, X.; Wang, X.; Ju, S.; Lu, M.; Cong, H. Serum level of long noncoding RNA H19 as a diagnostic biomarker of multiple myeloma. Clin. Chim. Acta 2018, 480, 199–205. [Google Scholar] [CrossRef] [PubMed]
- Ghobrial, I.M. Myeloma as a model for the process of metastasis: Implications for therapy. Blood 2012, 120, 20–30. [Google Scholar] [CrossRef] [PubMed]
- Chachami, G.; Paraskeva, E.; Mingot, J.M.; Braliou, G.G.; Görlich, D.; Simos, G. Transport of hypoxia-inducible factor HIF-1alpha into the nucleus involves importins 4 and 7. Biochem. Biophys. Res. Commun. 2009, 390, 235–240. [Google Scholar] [CrossRef] [PubMed]
- Bhaskar, A.; Tiwary, B.N. Hypoxia inducible factor-1 alpha and multiple myeloma. Int. J. Adv. Res. (Indore) 2016, 4, 706–715. [Google Scholar]
- Karpova, D.; Bonig, H. Concise Review: CXCR4/CXCL12 Signaling in Immature Hematopoiesis—Lessons From Pharmacological and Genetic Models. Stem Cells 2015, 33, 2391–2399. [Google Scholar] [CrossRef] [PubMed]
- Alsayed, Y.; Ngo, H.; Runnels, J.; Leleu, X.; Singha, U.K.; Pitsillides, C.M.; Spencer, J.A.; Kimlinger, T.; Ghobrial, J.M.; Jia, X.; et al. Mechanisms of regulation of CXCR4/SDF-1 (CXCL12)-dependent migration and homing in multiple myeloma. Blood 2007, 109, 2708–2717. [Google Scholar] [CrossRef] [PubMed]
- Giuliani, N.; Storti, P.; Bolzoni, M.; Palma, B.D.; Bonomini, S. Angiogenesis and multiple myeloma. Cancer Microenviron. 2011, 4, 325–337. [Google Scholar] [CrossRef]
- Zhu, Y.X.; Kortuem, K.M.; Stewart, A.K. Molecular mechanism of action of immune-modulatory drugs thalidomide, lenalidomide and pomalidomide in multiple myeloma. Leuk. Lymphoma 2013, 54, 683–687. [Google Scholar] [CrossRef]
- Roccaro, A.M.; Hideshima, T.; Raje, N.; Kumar, S.; Ishitsuka, K.; Yasui, H.; Shiraishi, N.; Ribatti, D.; Nico, B.; Vacca, A.; et al. Bortezomib mediates antiangiogenesis in multiple myeloma via direct and indirect effects on endothelial cells. Cancer Res. 2006, 66, 184–191. [Google Scholar] [CrossRef]
- Highsmith, K.N.; Chen, S.E.; Horowitz, S. Carfilzomib and pomalidomide: Recent advances in the treatment of multiple myeloma. Pharmacotherapy 2014, 34, 927–940. [Google Scholar] [CrossRef] [PubMed]
- Rao, L.; de Veirman, K.; Giannico, D.; Saltarella, I.; Desantis, V.; Frassanito, M.A.; Solimando, A.G.; Ribatti, D.; Prete, M.; Harstrick, A.; et al. Targeting angiogenesis in multiple myeloma by the VEGF and HGF blocking DARPin((R)) protein MP0250: A preclinical study. Oncotarget 2018, 9, 13366–13381. [Google Scholar] [CrossRef] [PubMed]
- Monteleone, F.; Taverna, S.; Alessandro, R.; Fontana, S. SWATH-MS based quantitative proteomics analysis reveals that curcumin alters the metabolic enzyme profile of CML cells by affecting the activity of miR-22/IPO7/HIF-1alpha axis. J. Exp. Clin. Cancer Res. 2018, 37, 17. [Google Scholar] [CrossRef] [PubMed]
Gene | Primer forward | Primer Reverse |
---|---|---|
LncH19 | GCACCTTGGACATCTGGAGT | TTCTTTCCAGCCCTAGCTCA |
HIF-1α | TGATTGCATCTCCATCTCCTACC | GACTCAAAGCGACAGATAACACG |
VEGF | CGAGGGCCTGGAGTGTGT | CGCATAATCTGCATGGTGATG |
SNAIL | GCGAGCTGCAGGACTCTAAT | CCCGCAATGGTCCACAAAAC |
SLUG | CATGCCTGTCATACCACAAC | GGTGTCAGATGGAGGAGGG |
CXCR4 | TACACCGAGGAAATGGGCTCA | AGATGATGGAGTAGATGGTGG |
B−A TIN | ATCAAGATCATTGCTCCTCCTGA | CTGCTTGCTGATCCACATCTG |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Corrado, C.; Costa, V.; Giavaresi, G.; Calabrese, A.; Conigliaro, A.; Alessandro, R. Long Non Coding RNA H19: A New Player in Hypoxia-Induced Multiple Myeloma Cell Dissemination. Int. J. Mol. Sci. 2019, 20, 801. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms20040801
Corrado C, Costa V, Giavaresi G, Calabrese A, Conigliaro A, Alessandro R. Long Non Coding RNA H19: A New Player in Hypoxia-Induced Multiple Myeloma Cell Dissemination. International Journal of Molecular Sciences. 2019; 20(4):801. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms20040801
Chicago/Turabian StyleCorrado, Chiara, Viviana Costa, Gianluca Giavaresi, Annalisa Calabrese, Alice Conigliaro, and Riccardo Alessandro. 2019. "Long Non Coding RNA H19: A New Player in Hypoxia-Induced Multiple Myeloma Cell Dissemination" International Journal of Molecular Sciences 20, no. 4: 801. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms20040801