Two New Synonyms of Paraleuctra orientalis (Chu, 1928) (Plecoptera: Leuctridae) Based on Morphological and Molecular Data, with Notes on Paraleuctra cervicornis Du and Qian, 2012

Simple Summary

Paraleuctra Hanson, 1941, is a widespread genus distributed in the east and west Nearctic and in much of the Palaearctic, with 27 valid species currently known. In China, although six Paraleuctra species have been reported, the differences among these species have not been fully explained. After checking a large number of specimens of this genus from Zhejiang Province, two junior synonyms are proposed for the species Paraleuctra orientalis (Chu, 1928).

Abstract

We recently examined specimens of the genus Paraleuctra Hanson, 1941, from Zhejiang Province and Sichuan Province, China, and two new synonyms are established based on morphological and molecular data. Paraleuctra sinica Yang and Yang, 1995, and Paraleuctra tianmushana Li and Yang, 2010, are synonymized with Paraleuctra orientalis (Chu, 1928). Additionally, we provide new images of Paraleuctra cervicornis Du and Qian, 2012, to facilitate identification of this species.

1. Introduction

Paraleuctra Hanson, 1941, is a widespread genus mainly distributed in the east and west Nearctic and in much of the Palaearctic, with 27 valid species currently known [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15]. The stoneflies of this genus are common inhabitants of stream environments. The nymphs mainly live in cold streams, springs, rock fissure seepage and other water environments with high dissolved oxygen, feeding on mosquito larvae, plant fragments and algae. Their habitat adaptation range is narrow [16]. After emergence into adults, they inhabit the herbs, grasses or shrubs on the bank due to their weak flying ability. Adults live in groups, which is conducive to mating. After mating, the female flies back to the water to lay eggs. Adults can feed on algae, moss, lichens and leaves, allowing them to survive for days to weeks [17,18].

In China, at present, this genus remains poorly known with only six species reported: P. orientalis (Chu, 1928), P. sinica Yang and Yang, 1995, P. tianmushana Li and Yang, 2010, P. cervicornis Du and Qian, 2012, P. qilianshana Li and Yang, 2013, and P. cuihuashana Chen, 2019. The holotype of P. orientalis was destroyed and the numbers of the paratypes of P. sinica and P. tianmushana are small. The differences among these three species are not obvious or unique. The problem of how to identify these three species remains. Therefore, we went to the type locality (province) of these three species for collection to solve this problem.

The mitochondrial cytochrome C oxidase subunit 1 gene (mtCOI) and 18S rDNA of Plecoptera are stable; their gene arrangement is conserved, with few rearrangements, so they have been widely used in evolution, phylogeny, genetics, species identification [8,12,19]. After checking a large number of the specimens of Paraleuctra from Zhejiang Province, we established P. sinica and P. tianmushana as junior synonyms of P. orientalis based on the close agreement of morphological characters, COI gene sequence divergence, 18S rDNA sequence divergence and phylogenetic trees of the two genes. Additionally, we provide new images of P. cervicornis Du and Qian, 2012, to facilitate identification of this species.

2. Material and Methods

2.1. Specimen Preparation

Most of the adults of Paraleuctra live in the bushes or small trees near the clean and cold streams. Due to their weak flight ability, we used an insect catching net to shake the twigs or the branches, and the adults fell into the net. The adults of Paraleuctra have phototaxis, so they can also be collected by a light trapping method. Specimens were preserved in 75% ethanol. Male terminalia specimens were cleared in 10% NaOH. All specimens used in this study are deposited in the Insect Collection of Yangzhou University (ICYZU), Jiangsu Province, China.

2.2. Observation and Description

Morphological details were examined with a Leica MZAPO microscope. Color illustrations were taken with a KEYENCE VHX-5000. The specimens were identified as Paraleuctra species by the following features: The Paraleuctra species is small, generally no more than 10 mm, and brown or dark brown. At rest, the wings roll into a tube to the abdomen. The subanal probe and epiproct of the male are specialized (Figure 1C–E,H–J). The tergum 10 of the male terminalia is divided into two parts (Figure 2A,D,G,J). Cerci sclerotize and form a dentate process (Figure 1A,B,F,G). The sternum 8 of the female forms an obvious subgenital plate; the cercus is simple with no change (Figure 3B,C). The terminology used for description follows Yang et al. (2015) [20].

2.3. DNA Extraction, Amplification and Sequencing

The five specimens used for molecular analyses and morphological identification were collected from Zhejiang Province, Tianmushan. Genomic DNA was extracted using AxyPrep DNA tissue kits (America), following the manufacturer’s instruction.

A 1745 bp fragment covering the entire mitochondrial COI gene was amplified using a pair of specific primers [8] (F: AAACTAATAGCCTTCAAAG, R: TATWTGGAGCTTAAATCCAT) with 50 °C annealing temperature and 35 PCR cycles. PCR products were purified and sequenced by Biozeron Biotech Co. (Shanghai, China) in both directions using the same primers as above. All sequences of the COI gene were aligned using ClustalW and then cut to 658 bp for analyses.

A 491 bp fragment of 18S rDNA was amplified using a pair of primers [19] (18S a0.7: ATTAAAGTTGTTGCGGTT, 18S b2.9: TATCTGATCGCCTTCGAACCTCT). PCR products were purified and sequenced by Biozeron Biotech Co. (Shanghai, China) in both directions using the same primers as above. All sequences of 18S rDNA were aligned using ClustalW. The sequences were deposited in GenBank under accession numbers, as listed in

Table 1. List of taxa included in this analysis.

Genus	Species	GenBank Accession No.
		COI Gene	18S rDNA
Paraleuctra	orientalis	OM836700	ON130265
Paraleuctra	sinica A	OM836702	ON130263
Paraleuctra	sinica B	OM203120	ON130264
Paraleuctra	tianmushana	OM836701	ON130266
Paraleuctra	sp. F	OM836704	ON130267
Paraleuctra	cuihuashana	MK995183
Paraleuctra	cercia	MK492251
Paraleuctra	vershina	MH840222	AY521878
Paraleuctra	sara	HQ938243
Paraleuctra	occidentalis	MG380092	EF622723
Perlomyia	isobeae	MK492252
Perlomyia	utahensis		EF622724
Rhopalopsole	bulbifera	MK111419
Leuctra	fusca	MK568475
Leuctra	inermis		EF622721

Note: F represents an undetermined female; A indicates the body color of this specimen is yellowish brown; B indicates the body color of this specimen is dark brown (the same as below).

.

2.4. Phylogenetic Analyses

To root the Paraleuctra section of the trees, we included as outgroups representatives of Leuctra, Perlomyia and Rhopolopsole available from GenBank (Table 1). We also added other species of Paraleuctra from either the Palearctic or Nearctic to add context to our target Paraleuctra species. Note that the outgroups and additional Paraleuctra species varied by gene used, necessitating the separation of genes for analyses.

The genetic distance and maximum likelihood (ML) analysis were computed using MEGA v. 7.0. The parameters of ML analysis are as follows—test of phylogeny: bootstrap method with 1000 bootstrap replications; substitution type: nucleotide; model/method: Kimura 2-parameter model; rates among sites: uniform rates; gaps/missing data treatment: complete deletion; ML heuristic method: nearest-neighbor-interchange (NNI); initial tree for ML: make initial tree automatically (Default-NJ/BioNJ); branch swap filter: none.

MrBayes v. 3.1.2 was utilized to generate the topology for the Bayesian inference (BI) analysis, the working procedure is as follows:

execute XXX.nex

outgroup XX, XX

lset nst = 6 rate = invgamma

showmodel

mcmc ngen = 100000 samplefreq = 100

If the value is greater than 0.01, continue; if it is less than 0.01, enter: sump burnin = 250 (total running generation/sampling frequency then divided by 4) sumt burnin = 250

3. Results

3.1. Paraleuctra orientalis (Chu, 1928)

Leuctra orientalis: Chu, 1928: 87 [2].

Rhopalopsole orientalis: Illies, 1966: 118 [21].

Paraleuctra orientalis: Zwick, 1973: 410 [22]; Du and Sivec, 2005: 40 [23]; Li et al. 2010: 47 [5]; Du and Qian, 2012: 1062 [6]; Qian and Du, 2012: 3 [24]; Qian et al. 2014: 606 [25]; Yang et al. 2015: 84 [20]; Chen, 2019: 237 [8].

Paraleuctra sinicasyn. nov.: Yang and Yang, 1995: 24 [4]; Li et al. 2010: 47 [5]; Du and Qian, 2012: 1062 [6].

Paraleuctra tianmushanasyn. nov.: Li et al. 2010: 47 [5]; Du and Qian, 2012: 1062 [6]; Li et al. 2016: 94 [26].

Type locality: China, Zhejiang Province (Lin–an).

Material examined: 2 males, China, Zhejiang Province, Longwangshan, 1999-Ⅵ-4, leg. DU Yu-Zhou (ICYZU); 21 males, 51 females, China, Zhejiang Province, Tianmushan, 2006-Ⅲ-19, leg. WANG Zhi-Jie (ICYZU); 53 males, 63 females, China, Zhejiang Province, Tianmushan, 378.36 m, N: 30.2118, E: 119.283, 2021-Ⅲ-25, leg. HUO Qing-Bo, ZHAO Meng-Yuan and XIANG Ya-Nan (ICYZU).

Distribution: China (Henan, Shaanxi, Anhui, Hubei, Sichuan, Yunan, Zhejiang, Fujian); Russia.

Remarks: At present, only six species of the genus Paraleuctra Hanson, 1941, are reported in China. Pareleuctra orientalis is widespread in China; the adults are dark brown with uniform body color, cerci somewhat sclerotized, strongly forked into two sharp prongs; the upper prong is longer than the lower prong; a spine is present near base of upper prong, projecting backwards (Figure 1F,G, Figure 2A–C and Figure 4A). Yang et al. (2015) said that P. orientalis can be distinguished from P. tianmushan as the body color of P. tianmushan is yellowish brown. The difference between P. orientalis and P. sinica should be that the male cerci of P. sinica lacks a small bulge on the dorsal arm, tergum 9 with sclerotized median strips; the female subgenital plate lobes are slightly sclerotized, with the posterior margin more roundly expanded [4,5,20].

Results and Discussion: The holotype of P. orientalis was destroyed and the numbers of the paratypes of P. sinica and P. tianmushana are small. The differences among these three species are not obvious or unique. The problem of how to identify these three species remains. In order to solve this problem, we went to the type locality (province) to collect these three species many times. After checking a large number of specimens of this genus from Zhejiang Province, we have evidence that P. sinica and P. tianmushana are junior synonyms of P. orientalis:

After examining the specimens from Zhejiang Province, according to the original descriptions [4,5,20], we identified the specimen shown in Figure 2A–C and Figure 4A as P. orientalis; Figure 2D–F and Figure 4B as P. tianmushana; Figure 2G–I and Figure 4C (type B: the body color of this specimen is dark brown); Figure 2J–L and Figure 4D (type A: the body color of this specimen is yellowish brown) as P. sinica; although the types of P. sinica have not been examined, we can identified these two specimens as P. sinica by the specimens lacking a bulge on the cerci (Figure 2J–L) or having an almost invisible spine on the dorsal arm (Figure 2G–I).

According to the identification results, we further found that the Paraleuctra specimens from the same site (Tianmushan) had two types of cerci: A spine present near the base of the upper prong (Figure 1F,G and Figure 2B,E), another type without a spine (Figure 2K) or with an almost invisible spine (Figure 2H); two types of color patterns of the body (Figure 1, Figure 2, Figure 3 and Figure 4); the same patterns of epiproct and subanal probe (Figure 1C–E,H–J and Figure 2); all the female specimens had only one pattern of subgenital plates (Figure 3B,C). When we dissected the cercus of the specimens without a spine from all views (Figure 2J–L), the cercus also had an almost invisible spine near the base of the upper prong (Figure 1A,B). It turns out that different color patterns, with or without a spinule can be found on the same species, and this result could overturn the identification basis [20] used to distinguish these three species. Therefore, we have come to the conclusion that the difference in color patterns or spinules consists merely of individual variation and, to some degree, the age of the specimens. Additionally, we think without examining a large number of specimens of the species from this genus, the differences among all species cannot be fully explained, unless a species has unique character, such as the shape of the cerci of P. cervicornis, which is like an antler (Figure 5B), and differs from all other Paraleuctra species.

The genetic distance data and phylogenetic analyses using gene sequence data both provide ample evidence for the new junior synonym status of P. sinica and P. tianmushana (Table 1,

Table 2. Genetic distance of the COI gene (nucleotides) among the species used in this study.

	Genetic Distance (%)
Name	P. orientalis	P. sinica A	P. sinica B	P. tianmushana	P. undet.	P. cuihuashana	P. cercia	P. vershina	P. sara	P. occidentalis	P. isobeae	R. bulbifera
P. orientalis
P. sinica A	0.0
P. sinica B	0.0	0.0
P. tianmushana	0.0	0.0	0.0
P. undet.	0.0	0.0	0.0	0.0
P. cuihuashana	11.7	11.7	11.7	11.7	11.7
P. cercia	18.3	18.3	18.3	18.3	18.3	15.3
P. vershina	17.4	17.4	17.4	17.4	17.4	17.1	14.8
P. sara	19.5	19.5	19.5	19.5	19.5	19.4	14.7	13.0
P. occidentalis	20.4	20.4	20.4	20.4	20.4	20.7	18.8	19.3	19.8
P. isobeae	24.3	24.3	24.3	24.3	24.3	22.8	19.5	21.7	21.1	19.0
R. bulbifera	24.9	24.9	24.9	24.9	24.9	23.2	20.0	22.7	23.3	20.5	15.4
L. fusca	23.0	23.0	23.0	23.0	23.0	22.6	22.6	24.4	23.6	19.6	19.9	20.1

,

Table 3. Genetic distance of the 18S rDNA (nucleotides) among the species used in this study.

	Genetic Distance (%)
Name	P. orientalis	P. sinica A	P. sinica B	P. tianmushana	P.undet.	P. vershina	P. occidentalis	P. utahensis
P. orientalis
P. sinica A	0.2
P. sinica B	0.2	0.0
P. tianmushana	0.6	0.4	0.4
P. undet.	0.0	0.2	0.2	0.6
P. vershina	5.6	5.4	5.4	4.9	5.6
P. occidentalis	9.5	9.3	9.3	8.8	9.5	9.0
P. utahensis	30.3	30.0	30.0	29.3	30.3	30.9	29.3
L. inermis	28.0	27.7	27.7	27.0	28.0	24.8	26.9	14.8

and

Table 4. Methods used to prove P. sinica and P. tianmushana are junior synonyms of P. orientalis in this study.

Species Name	Methods
	Morphology	Genetic Distance of the COI Gene	Genetic Distance of the 18S rDNA	Phylogenetic Trees of COI Gene	Phylogenetic Trees of 18S rDNA
P. orientalis	Share similar features such as head, pronotum, male terminalia and female terminalia.	Genetic distance of the COI gene among the three species is below 2%.	Genetic distance of the 18S rDNA is below 2%.	The three species are grouped in the same clade with high support values.	The three species are grouped in the same clade with high support values.
P. sinica A
P. sinica B
P. tianmushana
P. undet.

, Figure 6 and Figure 7). The genetic distance of the COI gene among the specimens of these three species is 0% and the value is lower than the commonly used 3% for species delimitation with DNA barcoding [27,28]. The genetic distance of 18S rDNA among the specimens of these three species ranges 0–1% also supports the synonymy of P. sinica and P. tianmushana with P. orientalis [29]. We also sequence the COI gene and 18S rDNA for one female collected from the same sites, and the genetic distances among the five specimens are also below the commonly used values.

In the maximum likelihood (ML) and Bayesian inference (BI) trees (Figure 6 and Figure 7), P. orientalis, P. tianmushan, P. sinica type A, type B (A, B represent different color patterns) and P. sp. (a female one) are grouped in the same clade, separated from the clade of other Paraleuctra species. The topology of the ML tree and BI tree are highly supported, with high support values on most nodes. Additionally, in terms of specimen collection location, it supports that specimens collected from the same place belong to the same species. At the genus level, the monophyly of the genus is supported by all phylogenetic trees (Figure 6 and Figure 7). Among them, the phylogenetic relationship between Paraleuctra and Leuctra is the closest, and the genetic distance between the 18S rDNA of Paraleuctra and Perlomyia is the largest (Table 3), indicating that the 18S rDNA may have obvious sequence differences between Paraleuctra and Perlomyia. The genetic distance of the COI gene among the specimens collected from China is below 12%; in contrast to the specimens of Paraleuctra not collected from China, this value is over 15% (Table 2). In addition, in the phylogenetic trees, the clades of them separated from the clades of the specimens of Paraleuctra not collected from China (Figure 6 and Figure 7). The genetic distances of 18S rDNA among the Paraleuctra species are below 10% (Table 3); it seems that 18S rDNA is more stable than COI gene of species in the genus Paraleuctra. Due to the limited samples, the phylogenetic status of Rhopalopsole, Leuctra and Perlomyia still require further study by supplementary sampling.

Molecular data used in this study have proved their efficiency in identifying the morphologically similar species, such as those in the genus Paraleuctra. Combined morphological and molecular evidence (Table 4), we propose that P. sinica and P. tianmushana are junior synonyms of P. orientalis.

3.2. Paraleuctra cervicornis Du and Qian, 2012

Paraleuctra cervicornis: Du and Qian, 2012: 1059 [6].

Type locality: China, Sichuan Province (Mt Niba).

Material examined: Holotype (male): Mt Niba (N: 29.6644, E: 102.6039, 2250 m), Yingjing county, Sichuan Province, 1996-Ⅵ-17, Leg. DU Yu-Zhou; Paratypes: 1 male and 4 females same data as holotype; 1 male and 2 females, Mt Erlang, N: 29.8486, E: 102.3045, 2380 m), Tianquan County, Sichuan Province, 1996-Ⅵ-7, Leg. DU Yu-Zhou.

Distribution: Russia; China (Henan, Shaanxi, Anhui, Hubei, Sichuan, Yunan, Zhejiang, Fujian).

Supplementary Description: This species had been well described by Du and Qian [6]. In this study, we provide the color figures of this species to facilitate identification. The heads of the males and females of this species are much flatter than the pronotum (Figure 8 and Figure 9A). Cerci strongly forked into two prongs, the upper prong sharp, pointed and bearing a small, ventrally directed mesal spine, whereas the lower prong is rounded or somewhat truncate with an emarginated apex (Figure 5B).

Remarks: The shape of cerci in the male is unique among all Asian Paraleuctra species. It seems that all the males of Paraleuctra species in China have a spine on the cercus, but it is obvious in some specimens (Figure 1F,G, Figure 2B,E and Figure 5B) and not in some (Figure 1A,B and Figure 2H,K). The subgenital plate of the female of this species can also be distinguished from all other species from China in this genus by the lobes being subrectangular.