Energy Transfer as A Driving Force in Nucleic Acid–Protein Interactions
Abstract
:1. Introduction
2. Results
2.1. Complexes of Proteins with Nucleic Acid Aptamers
- (1)
- X-ray structures have a resolution less than 3 Å;
- (2)
- Only binary complexes (1 protein, 1 aptamer) were chosen to minimize allosteric effects;
- (3)
- Apparent equilibrium constants for the complex formation are known.
- (1)
- Annotation of the amino acids that participate in polar contacts;
- (2)
- Annotation of the amino acids located within 4 Å vicinity to atoms that participate in polar contacts;
- (3)
- Annotation of the amino acids located within 4 Å vicinity to nucleotides that form 3 or more polar contacts (putative “hot spots”).
2.2. Complexes of HTH-type Proteins with DNA Double Helixes
- (1)
- X-ray structures have a resolution less than 3 Å;
- (2)
- X-ray structure is for the whole protein, not a protein domain;
- (3)
- DNA has unmodified nucleotides only;
- (4)
- Apparent equilibrium constants for the complex are known.
3. Discussion
4. Materials and Methods
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- RCSB PDB. Available online: www.Rcsb.org (accessed on 20 February 2019).
- Search BioNumbers—The Database of Useful Biological Numbers. Available online: www.Bionumbers.hms.harvard.edu (accessed on 20 February 2019).
- Enzyme Database—BRENDA. Available online: www.Brenda-enzymes.org (accessed on 20 February 2019).
- Goldberg, R. Thermodynamics of Enzyme-Catalyzed Reactions: Part 6—1999 Update. J. Phys. Chem. Ref. Data 1999, 28, 931–965. [Google Scholar] [CrossRef]
- BioCyc Pathway/Genome Database Collection. Available online: www.Biocyc.org (accessed on 20 February 2019).
- Carter, C. High-dimensional mutant and modular thermodynamic cycles, molecular switching, and free energy transduction. Ann. Rev. Biophys. 2017, 46, 433–453. [Google Scholar] [CrossRef] [PubMed]
- Selisko, B.; Papageorgiou, N.; Ferron, F.; Canard, B. Structural and functional basis of the fidelity of nucleotide selection by flavivirus RNA-dependent RNA polymerases. Viruses 2018, 10, 59. [Google Scholar] [CrossRef] [PubMed]
- Gallwitz, M.; Enoksson, M.; Thorpe, M.; Hellman, L. The extended cleavage specificity of human thrombin. PLoS ONE 2012, 7, e31756. [Google Scholar] [CrossRef]
- Micelli, C.; Rastelli, G. Histone deacetylases: Structural determinants of inhibitor selectivity. Drug Discov. Today 2015, 20, 718–735. [Google Scholar] [CrossRef] [PubMed]
- Koster, A.K.; Wood, C.A.; Thomas-Tran, R.; Chavan, T.S.; Almqvist, J.; Choi, K.H.; Du Bois, J.; Maduke, M. A selective class of inhibitors for the CLC-Ka chloride ion channel. Proc. Natl. Acad. Sci. USA 2018, 115, E4900–E4909. [Google Scholar] [CrossRef]
- Lake, E.W.; Muretta, J.M.; Thompson, A.R.; Rasmussen, D.M.; Majumdar, A.; Faber, E.B.; Ruff, E.F.; Thomas, D.D. Quantitative conformational profiling of kinase inhibitors reveals origins of selectivity for Aurora kinase activation states. Proc. Natl. Acad. Sci. USA 2018, 115, E11894–E11903. [Google Scholar] [CrossRef]
- De Vivo, M.; Cavalli, A. Recent advances in dynamic docking for drug discovery. Wiley Interdisc. Rev. Comp. Mol. Sci. 2017, 7, e1320. [Google Scholar] [CrossRef]
- PyMOL. Available online: Pymol.org (accessed on 20 February 2019).
- Laage, D.; Elsaesser, T.; Hynes, J. Water dynamics in the hydration shells of biomolecules. Chem. Rev. 2017, 117, 10694–10725. [Google Scholar] [CrossRef]
- Zavyalova, E.G.; Legatova, V.A.; Alieva, R.S.; Zalevsky, A.O.; Tashlitsky, V.N.; Arutyunyan, A.M.; Kopylov, A.M. Putative mechanisms underlying high inhibitory activities of bimodular DNA aptamers to thrombin. Biomolecules 2019, 9, 41. [Google Scholar] [CrossRef]
- Novoseltseva, A.; Zavyalova, E.; Golovin, A.; Kopylov, A. An insight into aptamer–protein complexes. Aptamers 2018, 2, 55–63. [Google Scholar]
- Yatime, L.; Maasch, C.; Hoehlig, K.; Klussmann, S.; Andersen, G.R.; Vater, A. Structural basis for the targeting of complement anaphylatoxin C5a using a mixed L-RNA/L-DNA aptamer. Nat. Commun. 2015, 6, 6481. [Google Scholar] [CrossRef]
- Oberthür, D.; Achenbach, J.; Gabdulkhakov, A.; Buchner, K.; Maasch, C.; Falke, S.; Rehders, D.; Klussmann, S.; Betzel, C. Crystal structure of a mirror-image L-RNA aptamer (Spiegelmer) in complex with the natural L-protein target CCL2. Nat. Commun. 2015, 6, 6923. [Google Scholar] [CrossRef]
- Miyakawa, S.; Nomura, Y.; Sakamoto, T.; Yamaguchi, Y.; Kato, K.; Yamazaki, S.; Nakamura, Y. Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G. RNA 2008, 14, 1154–1163. [Google Scholar] [CrossRef]
- Gupta, S.; Hirota, M.; Waugh, S.M.; Murakami, I.; Suzuki, T.; Muraguchi, M.; Shibamori, M.; Ishikawa, Y.; Jarvis, T.C.; Carter, J.D.; et al. Chemically modified DNA aptamers bind interleukin-6 with high affinity and inhibit signaling by blocking its interaction with interleukin-6 receptor. J. Biol. Chem. 2014, 289, 8706–8719. [Google Scholar] [CrossRef]
- Cheung, Y.W.; Kwok, J.; Law, A.W.; Watt, R.M.; Kotaka, M.; Tanner, J.A. Structural basis for discriminatory recognition of Plasmodium lactate dehydrogenase by a DNA aptamer. Proc. Natl. Acad Sci. USA 2013, 110, 15967–15972. [Google Scholar] [CrossRef]
- Jarvis, T.C.; Davies, D.R.; Hisaminato, A.; Resnicow, D.I.; Gupta, S.; Waugh, S.M.; Nagabukuro, A.; Wadatsu, T.; Hishigaki, H.; Gawande, B.; et al. Non-helical DNA triplex forms a unique aptamer scaffold for high affinity recognition of nerve growth factor. Structure 2015, 23, 1293–1304. [Google Scholar] [CrossRef]
- Spiridonova, V.A.; Barinova, K.V.; Glinkina, K.A.; Melnichuk, A.V.; Gainutdynov, A.A.; Safenkova, I.V.; Dzantiev, B.B. A family of DNA aptamers with varied duplex region length that forms complexes with thrombin and prothrombin. FEBS Lett. 2015, 589, 2043–2049. [Google Scholar] [CrossRef]
- Van Meervelt, V.; Soskine, M.; Maglia, G. Detection of two isomeric binding configurations in a protein–aptamer complex with a biological nanopore. ACS Nano 2014, 8, 12826–12835. [Google Scholar] [CrossRef]
- Trapaidze, A.; Hérault, J.P.; Herbert, J.M.; Bancaud, A.; Gué, A.M. Investigation of the selectivity of thrombin-binding aptamers for thrombin titration in murine plasma. Biosens. Bioelectron. 2016, 78, 58–66. [Google Scholar] [CrossRef]
- Abeydeera, N.D.; Egli, M.; Cox, N.; Mercier, K.; Conde, J.N.; Pallan, P.S.; Mizurini, D.M.; Sierant, M.; Hibti, F.E.; Hassell, T.; et al. Evoking picomolar binding in RNA by a single phosphorodithioate linkage. Nucleic Acids Res. 2016, 44, 8052–8064. [Google Scholar] [CrossRef]
- Hasegawa, H.; Taira, K.; Sode, K.; Ikebukuro, K. Improvement of aptamer affinity by dimerization. Sensors 2008, 8, 1090–1098. [Google Scholar] [CrossRef]
- Hansen, S.; Vulić, M.; Min, J.; Yen, T.J.; Schumacher, M.A.; Brennan, R.G.; Lewis, K. Regulation of the Escherichia coli HipBA toxin-antitoxin system by proteolysis. PLoS ONE 2012, 7, e39185. [Google Scholar] [CrossRef]
- Schumacher, M.A.; babu Chinnam, N.; Cuthbert, B.; Tonthat, N.K.; Whitfill, T. Structures of regulatory machinery reveal novel molecular mechanisms controlling B. subtilisnitrogen homeostasis. Genes Develop. 2015, 29, 451–464. [Google Scholar] [CrossRef]
- Stoyanov, J.; Hobman, J.; Brown, N. CueR (YbbI) of Escherichia coli is a MerR family regulator controlling expression of the copper exporter CopA. Mol. Microbiol. 2001, 39, 502–512. [Google Scholar] [CrossRef]
- Stella, S.; Cascio, D.; Johnson, R. The shape of the DNA minor groove directs binding by the DNA-bending protein Fis. Genes Develop. 2010, 24, 814–826. [Google Scholar] [CrossRef]
- Hancock, S.; Stella, S.; Cascio, D.; Johnson, R. DNA sequence determinants controlling affinity, stability and shape of DNA complexes bound by the nucleoid protein fis. PLoS ONE 2016, 11, e0150189. [Google Scholar] [CrossRef]
- Hancock, S.P.; Ghane, T.; Cascio, D.; Rohs, R.; Di Felice, R.; Johnson, R.C. Control of DNA minor groove width and Fis protein binding by the purine 2-amino group. Nucleic Acids Res. 2013, 41, 6750–6760. [Google Scholar] [CrossRef]
- Couñago, R.M.; Chen, N.H.; Chang, C.W.; Djoko, K.Y.; McEwan, A.G.; Kobe, B. Structural basis of thiol-based regulation of formaldehyde detoxification in H. influenza by a MerR regulator with no sensor region. Nucleic Acids Res. 2016, 44, 6981–6993. [Google Scholar] [CrossRef]
- Newman, J.; Rodrigues, C.; Lewis, R. Molecular basis of the activity of SinR protein, the master regulator of biofilm formation in Bacillus subtilis. J. Biol. Chem. 2013, 288, 10766–10778. [Google Scholar] [CrossRef]
- Brown, B.; Wood, T.; Peti, W.; Page, R. Structure of the Escherichia coli antitoxin MqsA (YgiT/b3021) bound to its gene promoter reveals extensive domain rearrangements and the specificity of transcriptional regulation. J. Biol. Chem. 2010, 286, 2285–2296. [Google Scholar] [CrossRef]
- Martin, R.; Rosner, J. Binding of purified multiple antibiotic-resistance repressor protein (MarR) to mar operator sequences. Proc. Natl. Acad. Sci. USA 1995, 92, 5456–5460. [Google Scholar] [CrossRef]
- Fillenberg, S.; Grau, F.; Seidel, G.; Muller, Y. Structural insight into operator dre-sites recognition and effector binding in the GntR/HutC transcription regulator NagR. Nucleic Acids Res. 2015, 43, 1283–1296. [Google Scholar] [CrossRef]
- Fuhrmann, J.; Schmidt, A.; Spiess, S.; Lehner, A.; Turgay, K.; Mechtler, K.; Charpentier, E.; Clausen, T. McsB is a protein arginine kinase that phosphorylates and inhibits the heat-shock regulator CtsR. Science 2009, 324, 1323–1327. [Google Scholar] [CrossRef]
- Rajagopalan, S.; Teter, S.J.; Zwart, P.H.; Brennan, R.G.; Phillips, K.J.; Kiley, P.J. Studies of IscR reveal a unique mechanism for metal-dependent regulation of DNA binding specificity. Nat. Struct. Mol. Biol. 2013, 20, 740–747. [Google Scholar] [CrossRef]
- Kim, E.; Akimoto, S.; Tokutsu, R.; Yokono, M.; Minagawa, J. Fluorescence lifetime analyses reveal how the high light–responsive protein LHCSR3 transforms PSII light-harvesting complexes into an energy-dissipative state. J. Biol. Chem. 2017, 292, 18951–18960. [Google Scholar] [CrossRef]
- Pinnola, A.; Cazzaniga, S.; Alboresi, A.; Nevo, R.; Levin-Zaidman, S.; Reich, Z.; Bassi, R. Light-harvesting complex stress-related proteins catalyze excess energy dissipation in both photosystems of Physcomitrella patens. Plant. Cell 2015, 27, 3213–3227. [Google Scholar] [CrossRef]
- Pinnola, A.; Bassi, R. Molecular mechanisms involved in plant photoprotection. Biochem. Soc. Transact. 2018, 46, 467–482. [Google Scholar] [CrossRef]
- Lervik, A.; Bresme, F.; Kjelstrup, S.; Bedeaux, D.; Rubi, J.M. Heat transfer in protein–water interfaces. Phys. Chem. Chem. Phys. 2010, 12, 1610–1617. [Google Scholar] [CrossRef]
- Copperman, J.; Guenza, M. Coarse-grained Langevin equation for protein dynamics: Global anisotropy and a mode approach to local complexity. J. Phys. Chem. B 2014, 119, 9195–9211. [Google Scholar] [CrossRef]
- Ma, C.; Xiu, Z.; Zeng, A. A new concept to reveal protein dynamics based on energy dissipation. PLoS ONE 2011, 6, e26453. [Google Scholar] [CrossRef] [PubMed]
- Hertzog, D.E.; Michalet, X.; Jäger, M.; Kong, X.; Santiago, J.G.; Weiss, S.; Bakajin, O. Femtomole mixer for microsecond kinetic studies of protein folding. Anal. Chem. 2004, 76, 7169–7178. [Google Scholar] [CrossRef]
- Schneider, T. A brief review of molecular information theory. Nano Commun. Netw. 2010, 1, 173–180. [Google Scholar] [CrossRef] [PubMed]
- Schneider, T. 70% efficiency of bistate molecular machines explained by information theory, high dimensional geometry and evolutionary convergence. Nucleic Acids Res. 2010, 38, 5995–6006. [Google Scholar] [CrossRef] [PubMed]
- Davies, D.R.; Gelinas, A.D.; Zhang, C.; Rohloff, J.C.; Carter, J.D.; O’Connell, D.; Waugh, S.M.; Wolk, S.K.; Mayfield, W.S.; Burgin, A.B.; et al. Unique motifs and hydrophobic interactions shape the binding of modified DNA ligands to protein targets. Proc. Natl. Acad. Sci. USA 2012, 109, 19971–19976. [Google Scholar] [CrossRef] [PubMed]
Sample Availability: Samples of the compounds are not available from the authors. |
Aptamer | Protein | Organism | PDB Id | Resolu-tion, Å | #N | #AA | −ΔGb, kJ/mol [16] | ka, M−1 s−1 | kd, s−1 |
---|---|---|---|---|---|---|---|---|---|
RNA-2 | 30S ribosomal protein S8 | Bacillus anthracis | 4PDB | 2.6 | 38 | 155 | 36.9 | - | - |
NOX-D20 | C5a complement anaphylatoxin | Mus musculus | 4WB2 | 1.8 | 40 | 79 | 63.5 | 5 × 106 | 1.0 × 10−4 [17] |
RB011 | Ectonucleotide pyrophosphatase/phosphodiesterase family member 2 | Mus musculus | 5HRT | 2.0 | 34 | 831 | 50.2 | - | - |
NOXE36 | C-C motif chemokine 2 | Homo sapiens | 4R8I | 2.05 | 40 | 77 | 52.5 | 2 × 106 | 2.7 × 10−3 [18] |
Anti-Fc | Ig gamma-1 chain C region | Homo sapiens | 3AGV | 2.15 | 24 | 211 | 40.5 | 3 × 104 | 3.3 × 10−3 [19] |
SL1025 | Interleukin-6 | Homo sapiens | 4NI7 | 2.4 | 32 | 186 | 57.6 | 1.2 × 105 | 2.8 × 10−5 [20] |
SL1025 | Interleukin-6 | Homo sapiens | 4NI9 | 2.55 | 32 | 186 | 57.6 | 1.2 × 105 | 2.8 × 10−5 [20] |
SL1067 | Interleukin-1 alpha | Homo sapiens | 5UC6 | 2.1 | 23 | 159 | 46.4 | - | - |
2008s | L-lactate dehydrogenase | Plasmodium falciparum | 3ZH2 | 2.1 | 35 | 316 | 42.2 | 2.8 × 106 | 1.6 × 10−1 [21] |
pL1 | L-lactate dehydrogenase | Plasmodium vivax | 5HTO | 1.9 | 34 | 346 | 44.4 | - | - |
pL1 | L-lactate dehydrogenase | Plasmodium vivax | 5HRU | 1.71 | 32 | 346 | 44.4 | - | - |
MinF | Lysozyme C | Gallus gallus | 4M6D | 2.68 | 45 | 129 | 41.3 | - | - |
MinE | Lysozyme C | Gallus gallus | 4M4O | 2 | 49 | 129 | 44.0 | - | - |
SL1049 | Beta-nerve growth factor | Homo sapiens | 4ZBN | 2.45 | 28 | 120 | 57.6 | 8 × 105 | 2.5 × 10−4 [22] |
αp50RNA | Nuclear factor NF-kappa-B p105 subunit | Mus musculus | 1OOA | 2.45 | 29 | 326 | 47.2 | - | - |
SL4 | Platelet-derived growth factor subunit B | Homo sapiens | 4HQX | 2.3 | 24 | 102 | 50.9 | - | - |
SL5 | Platelet-derived growth factor subunit B | Homo sapiens | 4HQU | 2.2 | 24 | 109 | 61.0 | - | - |
ARC1172 | von Willebrand Factor | Homo sapiens | 3HXQ | 2.69 | 42 | 209 | 52.6 | - | - |
ARC1172 | von Willebrand Factor | Homo sapiens | 3HXO | 2.4 | 42 | 209 | 52.6 | - | - |
F5 | MS2 protein capsid | Escherichia phage MS2 | 5MSF | 2.8 | 18 | 129 | 48.8 | - | - |
F6 | MS2 protein capsid | Escherichia phage MS2 | 6MSF | 2.8 | 14 | 129 | 48.2 | - | - |
F5/2AP10 | MS2 protein capsid | Escherichia phage MS2 | 1U1Y | 2.85 | 17 | 129 | 51.7 | - | - |
HD1 (K+) | Thrombin | Homo sapiens | 4DII | 2.05 | 15 | 295 | 44.5 | 2.0 × 105 | 3.4 × 10−3 [23] |
T4W | Thrombin | Homo sapiens | 6EO6 | 1.69 | 15 | 295 | 52.2 | - | - |
T4K | Thrombin | Homo sapiens | 6EO7 | 2.24 | 15 | 295 | 54.6 | - | - |
mTBA | Thrombin | Homo sapiens | 3QLP | 2.14 | 15 | 295 | 43.4 | - | - |
RE31 | Thrombin | Homo sapiens | 5CMX | 2.98 | 31 | 295 | 52.8 | 1.1 × 107 | 6.2 × 10−3 [23] |
HD1 (Na+) | Thrombin | Homo sapiens | 4DIH | 1.8 | 15 | 295 | 43.3 | - | - |
HD1-ΔT3 | Thrombin | Homo sapiens | 4LZ4 | 2.56 | 15 | 295 | 41.4 | 4.2 × 106 | 9.3 × 10−2 [24] |
HD1-ΔT12 | Thrombin | Homo sapiens | 4LZ1 | 1.65 | 15 | 295 | 42.1 | 4.2 × 108 | 2.2 × 101 [24] |
NU172 (Na+) | Thrombin | Homo sapiens | 6GN7 | 2.8 | 26 | 295 | 44.3 | - | - |
NU172 (K+) | Thrombin | Homo sapiens | 6EVV | 2.5 | 26 | 295 | 52.8 | 8.1 × 106 | 3.1 × 10−3 [25] |
AF113-1 | Thrombin | Homo sapiens | 3DD2 | 1.9 | 26 | 295 | 50.6 | 2.9 × 105 | 5.3 × 10−4 [26] |
AF113-18 | Thrombin | Homo sapiens | 5DO4 | 1.86 | 25 | 295 | 67.9 | 7.3 × 105 | 1.3 × 10−6 [26] |
HD22 | Thrombin | Homo sapiens | 4I7Y | 2.4 | 27 | 295 | 42.6 | 4.4 × 105 | 1.5 × 10−3 [27] |
Parameters of AA within 4 Å Vicinity of Polar Contacts | All Aptamers | Excluding GQ Aptamers to Thrombin | GQ APTAMERS to thrombin |
---|---|---|---|
Number of polar contacts | 0.02 | 0.04 | 0.04 |
Number of AA | 0.09 | 0.08 | 0.05 |
Mean length of sidechain | 0.05 | 0.49 | 0.01 |
Total atoms in AA | 0.18 | 0.26 | 0.04 |
% of HP AA | 0.03 | 0.03 | 0.09 |
Number of AA in PC | 0.03 | 0.02 | 0.02 |
Mean length of SC of AA in PC | 0.01 | 0.23 | 0.04 |
Total atoms in AA in PC | 0.07 | 0.17 | 0.04 |
Number of AA in HS vicinity | 0.01 | 0.02 | 0.06 |
Mean length of SC of AA in HS | 0.11 | 0.47 | 0.13 |
Total atoms in AA in HS vicinity | 0.09 | 0.34 | 0.07 |
Number of aromatic AA | 0.05 | 0.14 | 0.03 |
Number of positively charged AA | 0.14 | 0.17 | 0.02 |
Parameters of AA within 4 Å Vicinity of Polar Contacts | kon | koff |
---|---|---|
Number of polar contacts | 0.63 | 0.02 |
Number of AA | 0.02 | 0.21 |
Mean length of sidechain | 0.05 | 0.27 |
Total atoms in AA | 0.02 | 0.25 |
% of HP AA | 0.07 | 0.14 |
Number of AA in PC | 0.27 | 0.01 |
Mean length of SC of AA in PC | 0.17 | 0.68 |
Total atoms in AA in PC | 0.02 | 0.33 |
Number of AA in vicinity to HS | 0.00 | 0.18 |
Mean length of SC of AA in vicinity to HS | 0.02 | 0.62 |
Total atoms in AA in vicinity to HS | 0.00 | 0.50 |
Number of aromatic AA | 0.03 | 0.05 |
Number of positively charged AA | 0.07 | 0.40 |
Protein | Organism | DNA (1 strand) | PDB Id | Resolu-tion, Å | #N | #AA | Kd, nM | −ΔGb, kJ/mol | ka, M−1 s−1 | kd, s−1 |
---|---|---|---|---|---|---|---|---|---|---|
Antitoxin HipB | Escherichia coli | ttatccgctctacgggataa | 4Z58 | 2.5 | 20 × 2 | 71 | 0.6 [28] | 50.0 | - | - |
Transcriptional regulator TnrA | Bacillus megaterium | cgtgtaaggaattctgacacg | 4R24 | 2.25 | 21 × 2 | 85 | 11.6 [29] | 45.3 | - | - |
Transcriptional regulator CueR | Escherichia coli | gaccttccccttgctggaaggtc | 4WLW | 2.8 | 23 × 2 | 135 | 15 [30] | 44.6 | - | - |
DNA-binding protein fis | Escherichia coli | aaatttgtttgaattttgagcaaattt | 3IV5 | 2.9 | 27 × 2 | 98 | 0.2 [31] | 51.4 | - | - |
aaatttgtttaaattttgagcaaattt | 3JR9 | 2.9 | 0.2 [31] | 51.4 | - | - | ||||
aaatttggtcatttcttaactaaattt | 3JRA | 3.11 | 8 [31] | 42.9 | - | - | ||||
aaatttgtttgttttttgagcaaattt | 3JRB | 3.1 | 0.5 [31] | 49.3 | - | - | ||||
aaatttgtttgggcgctgagcaaattt | 3JRC | 3.08 | 140 [31] | 36.3 | - | - | ||||
aaatttgtttgttaaatgagcaaattt | 3JRD | 3.1 | 1 [31] | 47.7 | - | - | ||||
aaatttgtttgaaaaatgagcaaattt | 3JRE | 3.17 | 0.5 [31] | 49.3 | - | - | ||||
aaatttgtttgaactttgagcaaattt | 3JRF | 3.05 | 0.6 [31] | 48.9 | - | - | ||||
aaatttgttggaattttcagcaaattt | 3JRG | 3.11 | 2 [31] | 46.1 | - | - | ||||
aaatttgtttcaatttggagcaaattt | 3JRH | 2.88 | 40 [31] | 39.2 | - | - | ||||
aaatttgttgtaatttgtagcaaattt | 3JRI | 3.11 | 33 [31] | 39.7 | - | - | ||||
aaatttggaggaattttctccaaattt | 5E3O | 2.78 | 28 [32] | 40.1 | - | - | ||||
aaatttgtaggaattttctgcaaattt | 5E3N | 2.66 | 21 [32] | 40.7 | - | - | ||||
aaattagtttgaatctcgagctaattt | 5E3M | 2.89 | 15 [32] | 41.5 | - | - | ||||
aaattggtttgaattttgagccaattt | 5E3L | 2.66 | 30 [32] | 39.9 | - | - | ||||
aaattcgtttgaattttgagcgaattt | 5DTD | 2.64 | 2.1 [32] | 46.0 | - | - | ||||
aaattagtttgaattttgagctaattt | 5DS9 | 2.56 | 0.7 [32] | 48.5 | - | - | ||||
aaatttgtttgagcgttgagcaaattt | 4IHV | 2.72 | 28 [33] | 40.1 | - | - | ||||
MerR family regulator protein | Hemophilus influenzae | cttagagttcactctaag | 5D8C | 2.25 | 18 × 2 | 137 | 25.2 [34] | 43.3 | - | - |
Transcriptional regulator SinR | Bacillus subtilis | aaagttctctttagagaacaa | 3ZKC | 3.0 | 21 × 2 | 111 | 270 [35] | 37.5 | 1 × 105 | 2 × 10−2 |
Transcriptional regulator ygiT | Escherichia coli | agttataacctaaaaggttaattaca | 3O9X | 2.10 | 26 × 2 | 133 | 0.8 [36] | 48.2 | - | - |
Multiple antibiotic resistance protein MarR | Escherichia coli | catacttgcctgggcaatatt | 5H3R | 2.67 | 21 × 2 | 147 | 1.0 [37] | 51.3 | - | - |
Transcriptional repressor YvoA | Bacillus subtilis | cagtggtctagaccactgg | 4WWC | 2.90 | 19 × 2 | 246 | 0.028 [38] | 60.2 | 1.4 × 107 | 2.3 × 10−4 |
Heat-shock regulator CtsR | Geobacillus stearothermophilus | gattaaggtcaaatatagtcaaaata | 3H0D | 2.4 | 26 × 2 | 155 | 22 [39] | 44.4 | - | - |
Transcriptional regulator IscR | Escherichia coli | ataaatccacacagtttgtattgttttgt | 4HF1 | 2.22 | 29 × 2 | 170 | 17-24 [40] | 43.9 | - | - |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zavyalova, E.; Kopylov, A. Energy Transfer as A Driving Force in Nucleic Acid–Protein Interactions. Molecules 2019, 24, 1443. https://0-doi-org.brum.beds.ac.uk/10.3390/molecules24071443
Zavyalova E, Kopylov A. Energy Transfer as A Driving Force in Nucleic Acid–Protein Interactions. Molecules. 2019; 24(7):1443. https://0-doi-org.brum.beds.ac.uk/10.3390/molecules24071443
Chicago/Turabian StyleZavyalova, Elena, and Alexey Kopylov. 2019. "Energy Transfer as A Driving Force in Nucleic Acid–Protein Interactions" Molecules 24, no. 7: 1443. https://0-doi-org.brum.beds.ac.uk/10.3390/molecules24071443