Anti-Melanogenic Effects of Ethanol Extracts of the Leaves and Roots of Patrinia villosa (Thunb.) Juss through Their Inhibition of CREB and Induction of ERK and Autophagy
Abstract
:1. Introduction
2. Results and Discussion
2.1. Anti-Melanogenesis Effects of Ethanol Extracts of Patrinia villosa Prepared fron Leaf (lPv-EE) and Root (rPv-EE) in α-Melanocyte Stimulating Hormone (α-MSH)-Treated B16F10 Cells
2.2. Effect of lPv-EE and rPv-EE on MITF mRNA Expression Condition in α-MSH-Treated B16F10 Cells
2.3. Anti-Melanogenesis Mechanism of lPv-EE and rPv-EE in α-MSH-Treated B16F10 Cells
2.4. Effect of Ethanol Extract of Patrinia villosa (Pc-EE) on Autophagy
3. Materials and Methods
3.1. Materials
3.2. Cell Culture
3.3. High-Performance Liquid Chromatography (HPLC)
3.4. Cell Viability Assay
3.5. Melanin Formation Test
3.6. Tyrosinase Assay
3.7. Analysis of mRNA Levels by Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR)
3.8. Plasmid Transfection and Luciferase Reporter Gene Assay
3.9. Immunoblotting
3.10. Statistical Analysis
4. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Glick, D.; Barth, S.; Macleod, K.F. Autophagy: Cellular and molecular mechanisms. J. Pathol. 2010, 221, 3–12. [Google Scholar] [CrossRef] [Green Version]
- Saha, S.; Panigrahi, D.P.; Patil, S.; Bhutia, S.K. Autophagy in health and disease: A comprehensive review. Biomed. Pharmacother. 2018, 104, 485–495. [Google Scholar] [CrossRef] [PubMed]
- Jeong, D.; Qomaladewi, N.P.; Lee, J.; Park, S.H.; Cho, J.Y. The Role of Autophagy in Skin Fibroblasts, Keratinocytes, Melanocytes, and Epidermal Stem Cells. J. Investig. Dermatol. 2020, 140, 1691–1697. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.Y.; Kim, J.; Ahn, Y.; Lee, E.J.; Hwang, S.; Almurayshid, A.; Park, K.; Chung, H.J.; Kim, H.J.; Lee, S.H.; et al. Autophagy induction can regulate skin pigmentation by causing melanosome degradation in keratinocytes and melanocytes. Pigment Cell Melanoma Res. 2020, 33, 403–415. [Google Scholar] [CrossRef] [PubMed]
- Cho, Y.H.; Park, J.E.; Lim, D.S.; Lee, J.S. Tranexamic acid inhibits melanogenesis by activating the autophagy system in cultured melanoma cells. J. Dermatol. Sci. 2017, 88, 96–102. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kim, E.S.; Jo, Y.K.; Park, S.J.; Chang, H.; Shin, J.H.; Choi, E.S.; Kim, J.B.; Seok, S.H.; Kim, J.S.; Oh, J.S.; et al. ARP101 inhibits α-MSH-stimulated melanogenesis by regulation of autophagy in melanocytes. FEBS Lett. 2013, 587, 3955–3960. [Google Scholar] [CrossRef] [PubMed]
- Yun, W.J.; Kim, E.-Y.; Park, J.-E.; Jo, S.Y.; Bang, S.H.; Chang, E.-J.; Chang, S.E. Microtubule-associated protein light chain 3 is involved in melanogenesis via regulation of MITF expression in melanocytes. Sci. Rep. 2016, 6, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Valverde, P.; Healy, E.; Jackson, I.; Rees, J.L.; Thody, A.J. Variants of the melanocyte–stimulating hormone receptor gene are associated with red hair and fair skin in humans. Nat. Genet. 1995, 11, 328–330. [Google Scholar] [CrossRef]
- Busca, R.; Ballotti, R. Cyclic AMP a key messenger in the regulation of skin pigmentation. Pigment Cell Res. 2000, 13, 60–69. [Google Scholar] [CrossRef]
- Videira, I.F.d.S.; Moura, D.F.L.; Magina, S. Mechanisms regulating melanogenesis. An. Bras. Dermatol. 2013, 88, 76–83. [Google Scholar] [CrossRef] [Green Version]
- Song, Y.S.; Balcos, M.C.; Yun, H.-Y.; Baek, K.J.; Kwon, N.S.; Kim, M.-K.; Kim, D.-S. ERK Activation by Fucoidan Leads to Inhibition of Melanogenesis in Mel-Ab Cells. Korean J. Physiol. Pharmacol. 2015, 19, 29–34. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Heo, J. Donguibogam; Namsandang: Seoul, Korea, 1994; p. 90. [Google Scholar]
- Zheng, Y.; Jin, Y.; Zhu, H.B.; Xu, S.T.; Xia, Y.X.; Huang, Y. The anti-inflammatory and anti-nociceptive activities of Patrinia villosa and its mechanism on the proinflammatory cytokines of rats with pelvic inflammation. Afr. J. Tradit. Complement. Altern. Med. 2012, 9, 295–302. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, N.; Zhao, B.; Yu, Y.F.; Dong, X.P. Studies on anti-inflammation chemical constitutes of Patrinia villosa. Zhong Yao Cai 2008, 31, 51–53. [Google Scholar] [PubMed]
- Zhang, T.; Li, Q.; Li, K.; Li, Y.; Li, J.; Wang, G.; Zhou, S. Antitumor effects of saponin extract from Patrinia villosa (Thunb.) Juss on mice bearing U14 cervical cancer. Phytother. Res. 2008, 22, 640–645. [Google Scholar] [CrossRef] [PubMed]
- Park, H.J.; Jo, D.S.; Choi, H.; Bae, J.E.; Park, N.Y.; Kim, J.B.; Choi, J.Y.; Kim, Y.H.; Oh, G.S.; Chang, J.H.; et al. Melasolv induces melanosome autophagy to inhibit pigmentation in B16F1 cells. PLoS ONE 2020, 15, e0239019. [Google Scholar] [CrossRef] [PubMed]
- Park, H.J.; Jo, D.S.; Choi, D.S.; Bae, J.E.; Park, N.Y.; Kim, J.B.; Chang, J.H.; Shin, J.J.; Cho, D.H. Ursolic acid inhibits pigmentation by increasing melanosomal autophagy in B16F1 cells. Biochem. Biophys. Res. Commun. 2020, 531, 209–214. [Google Scholar] [CrossRef]
- Qomaladewi, N.P.; Kim, M.Y.; Cho, J.Y. Rottlerin Reduces cAMP/CREB-Mediated Melanogenesis via Regulation of Autophagy. Int. J. Mol. Sci. 2019, 20, 2081. [Google Scholar] [CrossRef] [Green Version]
- Katsuyama, Y.; Taira, N.; Yoshioka, M.; Okano, Y.; Masaki, H. Disruption of melanosome transport in melanocytes treated with theophylline causes their degradation by autophagy. Biochem. Biophys. Res. Commun. 2017, 485, 126–130. [Google Scholar] [CrossRef]
- Jeong, D.; Lee, J.; Park, S.H.; Kim, Y.A.; Park, B.J.; Oh, J.; Sung, G.H.; Aravinthan, A.; Kim, J.H.; Kang, H.; et al. Antiphotoaging and Antimelanogenic Effects of Penthorum chinense Pursh Ethanol Extract due to Antioxidant- and Autophagy-Inducing Properties. Oxid. Med. Cell. Longev. 2019, 2019, 9679731. [Google Scholar] [CrossRef]
- D’Mello, S.A.; Finlay, G.J.; Baguley, B.C.; Askarian-Amiri, M.E. Signaling pathways in melanogenesis. Int. J. Mol. Sci. 2016, 17, 1144. [Google Scholar] [CrossRef] [Green Version]
- Rodríguez, C.I.; Setaluri, V. Cyclic AMP (cAMP) signaling in melanocytes and melanoma. Arch. Biochem. Biophys. 2014, 563, 22–27. [Google Scholar] [CrossRef] [PubMed]
- Peng, H.Y.; Lin, C.C.; Wang, H.Y.; Shih, Y.; Chou, S.T. The melanogenesis alteration effects of Achillea millefolium L. essential oil and linalyl acetate: Involvement of oxidative stress and the JNK and ERK signaling pathways in melanoma cells. PLoS ONE 2014, 9, e95186. [Google Scholar] [CrossRef] [PubMed]
- Inamdar, G.S.; Madhunapantula, S.V.; Robertson, G.P. Targeting the MAPK pathway in melanoma: Why some approaches succeed and other fail. Biochem. Pharm. 2010, 80, 624–637. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shen, T.; Heo, S.I.; Wang, M.H. Involvement of the p38 MAPK and ERK signaling pathway in the anti-melanogenic effect of methyl 3,5-dicaffeoyl quinate in B16F10 mouse melanoma cells. Chem. Biol. Interact. 2012, 199, 106–111. [Google Scholar] [CrossRef]
- Kim, E.S.; Chang, H.; Choi, H.; Shin, J.H.; Park, S.J.; Jo, Y.K.; Choi, E.S.; Baek, S.Y.; Kim, B.G.; Chang, J.W.; et al. Autophagy induced by resveratrol suppresses α-MSH-induced melanogenesis. Exp. Dermatol. 2014, 23, 204–206. [Google Scholar] [CrossRef]
- Seok, S.; Fu, T.; Choi, S.-E.; Li, Y.; Zhu, R.; Kumar, S.; Sun, X.; Yoon, G.; Kang, Y.; Zhong, W. Transcriptional regulation of autophagy by an FXR-CREB axis. Nature 2014, 516, 108–111. [Google Scholar] [CrossRef] [Green Version]
- Qomaladewi, N.P.; Kim, M.Y.; Cho, J.Y. Autophagy and its regulation by ginseng components. J. Ginseng Res. 2019, 43, 349–353. [Google Scholar] [CrossRef]
- Han, S.Y.; Kim, J.; Kim, E.; Kim, S.H.; Seo, D.B.; Kim, J.H.; Shin, S.S.; Cho, J.Y. AKT-targeted anti-inflammatory activity of Panax ginseng calyx ethanolic extract. J. Ginseng Res. 2018, 42, 496–503. [Google Scholar] [CrossRef]
- Iershov, A.; Nemazanyy, I.; Alkhoury, C.; Girard, M.; Barth, E.; Cagnard, N.; Montagner, A.; Chretien, D.; Rugarli, E.I.; Guillou, H. The class 3 PI3K coordinates autophagy and mitochondrial lipid catabolism by controlling nuclear receptor PPARα. Nat. Commun. 2019, 10, 1–18. [Google Scholar]
- Wu, Y.T.; Tan, H.L.; Shui, G.; Bauvy, C.; Huang, Q.; Wenk, M.R.; Ong, C.N.; Codogno, P.; Shen, H.M. Dual role of 3-methyladenine in modulation of autophagy via different temporal patterns of inhibition on class I and III phosphoinositide 3-kinase. J. Biol. Chem. 2010, 285, 10850–10861. [Google Scholar] [CrossRef] [Green Version]
- Heckmann, B.L.; Yang, X.; Zhang, X.; Liu, J. The autophagic inhibitor 3-methyladenine potently stimulates PKA-dependent lipolysis in adipocytes. Br. J. Pharm. 2013, 168, 163–171. [Google Scholar] [CrossRef] [PubMed]
- Choi, E.; Kim, E.; Kim, J.H.; Yoon, K.; Kim, S.; Lee, J.; Cho, J.Y. AKT1-targeted proapoptotic activity of compound K in human breast cancer cells. J. Ginseng Res. 2019, 43, 692–698. [Google Scholar] [CrossRef] [PubMed]
- Kim, E.; Kim, D.; Yoo, S.; Hong, Y.H.; Han, S.Y.; Jeong, S.; Jeong, D.; Kim, J.H.; Cho, J.Y.; Park, J. The skin protective effects of compound K, a metabolite of ginsenoside Rb1 from Panax ginseng. J. Ginseng Res. 2018, 42, 218–224. [Google Scholar] [CrossRef] [PubMed]
- Jeong, D.; Lee, J.; Jeong, S.-G.; Hong, Y.H.; Yoo, S.; Han, S.Y.; Kim, J.H.; Kim, S.; Kim, J.S.; Chung, Y.S. Artemisia asiatica ethanol extract exhibits anti-photoaging activity. J. Ethnopharmacol. 2018, 220, 57–66. [Google Scholar] [CrossRef] [PubMed]
- Hong, Y.H.; Kim, D.; Nam, G.; Yoo, S.; Han, S.Y.; Jeong, S.G.; Kim, E.; Jeong, D.; Yoon, K.; Kim, S.; et al. Photoaging protective effects of BIOGF1K, a compound-K-rich fraction prepared from Panax ginseng. J. Ginseng Res. 2018, 42, 81–89. [Google Scholar] [CrossRef] [PubMed]
- Torres-Quiroz, F.; Filteau, M.; Landry, C.R. Feedback regulation between autophagy and PKA. Autophagy 2015, 11, 1181–1183. [Google Scholar] [CrossRef] [Green Version]
- Hu, S.; Wang, L.; Zhang, X.; Wu, Y.; Yang, J.; Li, J. Autophagy induces transforming growth factor-beta-dependent epithelial-mesenchymal transition in hepatocarcinoma cells through cAMP response element binding signalling. J. Cell. Mol. Med. 2018, 22, 5518–5532. [Google Scholar] [CrossRef]
- Liu-Smith, F.; Meyskens, F.L. Molecular mechanisms of flavonoids in melanin synthesis and the potential for the prevention and treatment of melanoma. Mol. Nutr. Food Res. 2016, 60, 1264–1274. [Google Scholar] [CrossRef] [Green Version]
- Huang, W.W.; Tsai, S.C.; Peng, S.F.; Lin, M.W.; Chiang, J.H.; Chiu, Y.J.; Fushiya, S.; Tseng, M.T.; Yang, J.S. Kaempferol induces autophagy through AMPK and AKT signaling molecules and causes G2/M arrest via downregulation of CDK1/cyclin B in SK-HEP-1 human hepatic cancer cells. Int. J. Oncol. 2013, 42, 2069–2077. [Google Scholar] [CrossRef]
Name | Sequence (5′ to 3′) | |
---|---|---|
Mouse | ||
Tyrosinase | F | GTCCACTCACAGGGATAGCAG |
R | AGAGTCTCTGTTATGGCCGA | |
TYRP1 | F | ATGGAACGGGAGGACAAACC |
R | TCCTGACCTGGCCATTGAAC | |
TYRP2 | F | CAGTTTCCCCGAGTCTGCAT |
R | GTCTAAGGCGCCCAAGAACT | |
MITF | F | GGGAGCTCACAGCGTGTATT |
R | CTAGCCTGCATCTCCAGCTC | |
GAPDH | F | ACCACAGTCCATGCCATCAC |
R | CCACCACCCTGTTGCTGTAG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jeong, D.; Park, S.H.; Kim, M.-H.; Lee, S.; Cho, Y.K.; Kim, Y.A.; Park, B.J.; Lee, J.; Kang, H.; Cho, J.Y. Anti-Melanogenic Effects of Ethanol Extracts of the Leaves and Roots of Patrinia villosa (Thunb.) Juss through Their Inhibition of CREB and Induction of ERK and Autophagy. Molecules 2020, 25, 5375. https://0-doi-org.brum.beds.ac.uk/10.3390/molecules25225375
Jeong D, Park SH, Kim M-H, Lee S, Cho YK, Kim YA, Park BJ, Lee J, Kang H, Cho JY. Anti-Melanogenic Effects of Ethanol Extracts of the Leaves and Roots of Patrinia villosa (Thunb.) Juss through Their Inhibition of CREB and Induction of ERK and Autophagy. Molecules. 2020; 25(22):5375. https://0-doi-org.brum.beds.ac.uk/10.3390/molecules25225375
Chicago/Turabian StyleJeong, Deok, Sang Hee Park, Min-Ha Kim, Sarah Lee, Yoon Kyung Cho, You Ah Kim, Byoung Jun Park, Jongsung Lee, Hakhee Kang, and Jae Youl Cho. 2020. "Anti-Melanogenic Effects of Ethanol Extracts of the Leaves and Roots of Patrinia villosa (Thunb.) Juss through Their Inhibition of CREB and Induction of ERK and Autophagy" Molecules 25, no. 22: 5375. https://0-doi-org.brum.beds.ac.uk/10.3390/molecules25225375