Tyrosine Kinase Inhibitors Are Promising Therapeutic Tools for Cats with HER2-Positive Mammary Carcinoma
Abstract
:1. Introduction
2. Materials and Methods
2.1. Feline and Human Mammary Carcinoma Cell Lines
2.2. In Vitro Cytotoxicity Assays
2.3. Immunoblotting
2.4. Animal Population
2.5. DNA Extraction, Amplification and Sequence Analysis of the Feline her2 TK Domain
2.6. Statistical Analysis
3. Results
3.1. Lapatinib and Neratinib Exert Antiproliferative Effects in All Feline Mammary Carcinoma Cell Lines
3.2. Lapatinib and Neratinib Inhibit the Phosphorylation of HER2 and Its Downstream Cascade
3.3. Rapamycin Does Not Induce Strong Antiproliferative Effects in Feline Cell Lines
3.4. Combined Exposures of TKi and mTOR Inhibitor Showed Strong Synergistic Antiproliferative Effects
3.5. Mutations Found in the her2 TK Domain of FMC Clinical Samples Were Not Associated with TKi Therapy Resistance
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Millanta, F.; Calandrella, M.; Citi, S.; della Santa, D.; Poli, A. Overexpression of HER-2 in feline invasive mammary carcinomas: An immunohistochemical survey and evaluation of its prognostic potential. Vet. Pathol. 2005, 42, 30–34. [Google Scholar] [CrossRef] [PubMed]
- Soares, M.; Ribeiro, R.; Najmudin, S.; Gameiro, A.; Rodrigues, R.; Cardoso, F.; Ferreira, F. Serum HER2 levels are increased in cats with mammary carcinomas and predict tissue HER2 status. Oncotarget 2016, 7, 17314–17326. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Soares, M.; Madeira, S.; Correira, J.; Peleteiro, M.; Cardoso, F.; Ferreira, F. Molecular based subtyping of feline mammary carcinomas and clinicopathological characterization. Breast 2016, 27, 44–51. [Google Scholar] [CrossRef] [PubMed]
- Cannon, C. Cats, Cancer and Comparative Oncology. Vet. Sci. 2015, 2, 111–126. [Google Scholar] [CrossRef]
- Porrello, A.; Cardelli, P.; Spugnini, E.P. Oncology of companion animals as a model for humans. An overview of tumor histotypes. J. Exp. Clin. Cancer Res. 2006, 25, 97–105. [Google Scholar]
- Vail, D.M.; Macewen, E.G. Spontaneously Occurring Tumors of Companion Animals as Models for Human Cancer. Cancer Investig. 2000, 18, 781–792. [Google Scholar] [CrossRef] [PubMed]
- Ranieri, G.; Pantaleo, M.; Piccinno, M.; Roncetti, M.; Mutinati, M.; Marech, I.; Patruno, R.; Rizzo, A.; Sciorsci, R.L. Tyrosine kinase inhibitors (TKIs) in human and pet tumours with special reference to breast cancer: A comparative review. Crit. Rev. Oncol. Hematol. 2013, 88, 293–308. [Google Scholar] [CrossRef]
- Vu, T.; Claret, F.X. Trastuzumab: Updated Mechanisms of Action and Resistance in Breast Cancer. Front. Oncol. 2012, 2, 1–6. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Budiarto, B.R. Detection of HER2 Gene Polymorphism in Breast Cancer: PCR Optimization Study. Sci. Pharm. 2016, 84, 103–111. [Google Scholar] [CrossRef] [Green Version]
- Soares, M.; Correia, J.; Rodrigues, P.; Simões, M.; Matos, A.; de Ferreira, F. Feline HER2 Protein Expression Levels and Gene Status in Feline Mammary Carcinoma: Optimization of Immunohistochemistry (IHC) and In Situ Hybridization (ISH) Techniques. Microsc. Microanal. 2013, 19, 876–882. [Google Scholar] [CrossRef]
- Michishita, M.; Ohtsuka, A.; Nakahira, R.; Tajima, T.; Nakagawa, T.; Sasaki, N.; Arai, T.; Takahashi, K. Anti-tumor effect of bevacizumab on a xenograft model of feline mammary carcinoma. J. Vet. Med. Sci. 2016, 78, 685–689. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Maria, R.D.; Olivero, M.; Iussich, S.; Nakaichi, M.; Murata, T.; Biolatti, B.; Flavia, M.; Renzo, D. Spontaneous Feline Mammary Carcinoma Is a Model of HER2 Overexpressing Poor Prognosis Human Breast Cancer. Cancer Res. 2005, 65, 907–912. [Google Scholar] [PubMed]
- Santos, S.; Baptista, C.S.; Abreu, R.M.; Bastos, E.; Amorim, I.; Gut, I.G.; Gärtner, F.; Chaves, R. ERBB2 in cat mammary neoplasias disclosed a positive correlation between RNA and protein low expression levels: A model for erbB-2 negative human breast cancer. PLoS ONE 2013, 8, e83673. [Google Scholar] [CrossRef]
- Tiwari, S.R.; Mishra, P.; Abraham, J. Neratinib, A Novel HER2-Targeted Tyrosine Kinase Inhibitor. Clin. Breast Cancer 2015, 16, 344–348. [Google Scholar] [CrossRef]
- Frogne, T.; Laenkholm, A.; Lyng, M.B.; Henriksen, K.L.; Lykkesfeldt, A.E. Research article Determination of HER2 phosphorylation at tyrosine 1221/1222 improves prediction of poor survival for breast cancer patients with hormone receptor-positive tumors. Breast Cancer Res. 2009, 11, 1–14. [Google Scholar] [CrossRef] [Green Version]
- Schroeder, R.L.; Stevens, C.L.; Sridhar, J. Small molecule tyrosine kinase inhibitors of ErbB2/HER2/Neu in the treatment of aggressive breast cancer. Molecules 2014, 19, 15196–15212. [Google Scholar] [CrossRef] [Green Version]
- Shi, H.; Zhang, W.; Zhi, Q.; Jiang, M. Lapatinib resistance in HER2+ cancers: Latest findings and new concepts on molecular mechanisms. Tumor Biol. 2016, 37, 15411–15431. [Google Scholar] [CrossRef] [PubMed]
- Sun, Y.; Feng, X.; Qu, J.; Han, W.; Liu, Z.; Li, X.; Zou, M.; Zhen, Y.; Zhu, J. Expression and Characterization of the Extracellular Domain of Human HER2 from Escherichia Coli, and Production of Polyclonal Antibodies against the Recombinant Proteins. Appl. Biochem. Biotechnol. 2015, 176, 1029–1043. [Google Scholar] [CrossRef] [PubMed]
- Kong, A.; Feldinger, K. Profile of neratinib and its potential in the treatment of breast cancer. Breast Cancer Targets Ther. 2015, 7, 147–162. [Google Scholar] [CrossRef] [Green Version]
- Nagpal, A.; Redvers, R.P.; Ling, X.; Ayton, S.; Fuentes, M.; Tavancheh, E.; Diala, I.; Lalani, A.; Loi, S.; David, S.; et al. Neoadjuvant neratinib promotes ferroptosis and inhibits brain metastasis in a novel syngeneic model of spontaneous HER2+ve breast cancer metastasis. Breast Cancer Res. 2019, 21, 1–19. [Google Scholar] [CrossRef] [PubMed]
- Lu, B.; Chen, X.B.; Ying, M.D.; He, Q.J.; Cao, J.; Yang, B. The role of ferroptosis in cancer development and treatment response. Front. Pharmacol. 2018, 8, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Hanker, A.B.; Brewer, M.R.; Sheehan, J.H.; Koch, J.P.; Sliwoski, G.R.; Nagy, R.; Lanman, R.; Berger, M.F.; Hyman, D.M.; Solit, D.B.; et al. An acquired HER2T798I gatekeeper mutation induces resistance to neratinib in a patient with HER2 mutant-driven breast cancer. Cancer Discov. 2017, 7, 575–585. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Canfiel, K.; Li, J.; Wilkins, O.M.; Morrison, M.M.; Ung, M.; Wells, W.; Williams, C.R.; Liby, K.T.; Vullhorst, D.; Buonanno, A.; et al. Receptor tyrosine kinase ERBB4 mediates acquired resistance to ERBB2 inhibitors in breast cancer cells. Cell Cycle 2015, 14, 648–655. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Noh, W.; Mondesire, W.H.; Peng, J.; Jian, W.; Zhang, H. Determinants of Rapamycin Sensitivity in Breast Cancer Cells. Clin. Cancer Res. 2004, 10, 1013–1023. [Google Scholar] [CrossRef] [Green Version]
- Jhanwar-Uniyal, M.; Wainwright, J.V.; Mohan, A.L.; Tobias, M.E.; Murali, R.; Gandhi, C.D.; Schmidt, M.H. Diverse signaling mechanisms of mTOR complexes: mTORC1 and mTORC2 in forming a formidable relationship. Adv. Biol. Regul. 2019, 72, 51–62. [Google Scholar] [CrossRef] [PubMed]
- Almeida, F.; Gameiro, A.; Correia, J.; Ferreira, F. Histone Deacetylase Inhibitors and Microtubule Inhibitors Induce Apoptosis in Feline Luminal Mammary Carcinoma Cells. Animals 2021, 11, 502. [Google Scholar] [CrossRef]
- Okita, R.; Uhiko Shimizu, K.; Nojima, Y.; Yukawa, T.; Maeda, A.; Saisho, S.; Nakata, M. Lapatinib enhances trastuzumab-mediated antibody-dependent cellular cytotoxicity via upregulation of HER2 in malignant mesothelioma cells. Oncol. Rep. 2015, 34, 2864–2870. [Google Scholar] [CrossRef] [Green Version]
- Chiang, G.G.; Abraham, R.T. Phosphorylation of mammalian target of rapamycin (mTOR) at Ser-2448 is mediated by p70S6 kinase. J. Biol. Chem. 2005, 280, 25485–25490. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Soares, M.; Ribeiro, R.; Carvalho, S.; Peleteiro, M.; Correia, J.; Ferreira, F. Ki-67 as a Prognostic Factor in Feline Mammary Carcinoma: What Is the Optimal Cutoff Value? Vet. Pathol. 2016, 53, 37–43. [Google Scholar] [CrossRef] [Green Version]
- Elston, C.W.; Ellis, I.O. Assessment of Histological Grade. Syst. Pathol. 1998, 3, 365–384. [Google Scholar]
- Santos, S.; Sá, D.; Bastos, E.; Guedes-Pinto, H.; Gut, I.; Gärtner, F.; Chaves, R. An efficient protocol for genomic DNA extraction from formalin-fixed paraffin-embedded tissues. Res. Vet. Sci. 2009, 86, 421–426. [Google Scholar] [CrossRef] [PubMed]
- Ferreira, D.; Soares, M.; Correia, J.; Adega, F.; Ferreira, F.; Chaves, R. Assessment of ERRB2 and TOP2α gene status and expression profile in feline mammary tumors: Findings and guidelines. Aging 2019, 11, 4688. [Google Scholar] [CrossRef] [PubMed]
- Nascimento, C.; Urbano, A.C.; Gameiro, A.; Correia, J.; Ferreira, F. Serum PD-1/PD-L1 Levels, Tumor Expression and PD-L1 Somatic Mutations in HER2-Positive and Triple Negative Normal-Like Feline Mammary Carcinoma Subtypes. Cancers 2020, 12, 1386. [Google Scholar] [CrossRef]
- Stucky, B.J. Seqtrace: A graphical tool for rapidly processing DNA sequencing chromatograms. J. Biomol. Tech. 2012, 23, 90–93. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Soares, M.; Correia, J.; Peleteiro, M.C.; Ferreira, F. St Gallen molecular subtypes in feline mammary carcinoma and paired metastases—disease progression and clinical implications from a 3-year follow-up study. Tumor Biol. 2016, 37, 4053–4064. [Google Scholar] [CrossRef]
- Opdam, F.L.; Guchelaar, H.; Beijnen, J.H.; Schellens, J.H.M. Lapatinib for Advanced or Metastatic Breast Cancer. Oncologist 2012, 17, 536–542. [Google Scholar] [CrossRef] [Green Version]
- Frenel, J.S.; Bourbouloux, E.; Berton-Rigaud, D.; Sadot-Lebouvier, S.; Zanetti, A.; Campone, M. Lapatinib in metastatic breast cancer. Women’s Health 2009, 5, 603–612. [Google Scholar] [CrossRef] [Green Version]
- Segovia-Mendoza, M.; González-González, M.E.; Barrera, D.; Díaz, L.; García-Becerra, R. Efficacy and mechanism of action of the tyrosine kinase inhibitors gefitinib, lapatinib and neratinib in the treatment of her2-positive breast cancer: Preclinical and clinical evidence. Am. J. Cancer Res. 2015, 5, 2531–2561. [Google Scholar]
- Scaltriti, M.; Verma, C.; Guzman, M.; Jimenez, J.; Parra, J.L.; Pedersen, K.; Smith, D.J.; Landolfi, S.; Ramon y Cajal, S.; Arribas, J.; et al. Lapatinib, a HER2 tyrosine kinase inhibitor, induces stabilization and accumulation of HER2 and potentiates trastuzumab-dependent cell cytotoxicity. Oncogene 2009, 28, 803–814. [Google Scholar] [CrossRef] [Green Version]
- Formisano, L.; Nappi, L.; Rosa, R.; Marciano, R.; D’Amato, C.; D’Amato, V.; Damiano, V.; Raimondo, L.; Iommelli, F.; Scorziello, A.; et al. Epidermal growth factor-receptor activation modulates Src-dependent resistance to lapatinib in breast cancer models. Breast Cancer Res. 2014, 16, 1–15. [Google Scholar] [CrossRef] [Green Version]
- Matsumoto, A.; Hayashida, T.; Takahashi, M.; Jinno, H.; Kitagawa, Y. Antitumor effect of lapatinib and cytotoxic agents by suppression of E2F1 in HER2-positive breast cancer. Mol. Med. Rep. 2018, 18, 958–964. [Google Scholar] [CrossRef]
- Hegde, P.S.; Rusnak, D.; Bertiaux, M.; Alligood, K.; Strum, J.; Gagnon, R.; Gilmer, T.M. Delineation of molecular mechanisms of sensitivity to lapatinib in breast cancer cell lines using global gene expression profiles. Mol. Cancer Ther. 2007, 6, 1629–1640. [Google Scholar] [CrossRef] [Green Version]
- Chen, Y.J.; Yeh, M.H.; Yu, M.C.; Wei, Y.L.; Chen, W.S.; Chen, J.Y.; Shih, C.Y.; Tu, C.Y.; Chen, C.H.; Hsia, T.C.; et al. Lapatinib-induced NF-kappaB activation sensitizes triple-negative breast cancer cells to proteasome inhibitors. Breast Cancer Res. 2013, 15. [Google Scholar] [CrossRef] [Green Version]
- Widatalla, S.E.; Korolkova, O.Y.; Whalen, D.S.; Goodwin, J.S.; Williams, K.P.; Ochieng, J.; Sakwe, A.M. Lapatinib-induced annexin A6 upregulation as an adaptive response of triple-negative breast cancer cells to EGFR tyrosine kinase inhibitors. Carcinogenesis 2019, 40, 998–1009. [Google Scholar] [CrossRef] [Green Version]
- Liu, C.Y.; Hu, M.H.; Hsu, C.J.; Huang, C.T.; Wang, D.S.; Tsai, W.C.; Chen, Y.T.; Lee, C.H.; Chu, P.Y.; Hsu, C.C.; et al. Lapatinib inhibits CIP2A/PP2A/p-Akt signaling and induces apoptosis in triple negative breast cancer cells. Oncotarget 2016, 7, 9135–9149. [Google Scholar] [CrossRef] [Green Version]
- Nielsen, T.O.; Hsu, F.D.; Jensen, K.; Cheang, M.; Karaca, G.; Hu, Z.; Hernandez-Boussard, T.; Livasy, C.; Cowan, D.; Dressler, L.; et al. Immunohistochemical and clinical characterization of the basal-like subtype of invasive breast carcinoma. Clin. Cancer Res. 2004, 10, 5367–5374. [Google Scholar] [CrossRef] [Green Version]
- Bouchalova, K.; Cizkova, M.; Cwiertka, K.; Trojanec, R.; Hajduch, M. Triple negative breast cancer—Current status and prospective targeted treatment based on her1 (EGFR), TOP2A and C-MYC gene assessment. Biomed. Pap. 2009, 153, 13–18. [Google Scholar] [CrossRef] [PubMed]
- Manning, B.D.; Toker, A. AKT/PKB Signaling: Navigating the Network. Cell 2017, 169, 381–405. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Appert-Collin, A.; Hubert, P.; Crémel, G.; Bennasroune, A. Role of ErbB receptors in cancer cell migration and invasion. Front. Pharmacol. 2015, 6, 1–10. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ma, Z.; Parris, A.B.; Xiao, Z.; Howard, E.W.; Kosanke, S.D.; Feng, X.; Yang, X. Short-term early exposure to lapatinib confers lifelong protection from mammary tumor development in MMTV-ERBB-2 transgenic mice. J. Exp. Clin. Cancer Res. 2017, 36, 1–13. [Google Scholar] [CrossRef] [Green Version]
- Xia, W.; Mullin, R.J.; Keith, B.R.; Liu, L.H.; Ma, H.; Rusnak, D.W.; Owens, G.; Alligood, K.J.; Spector, N.L. Anti-tumor activity of GW572016: A dual tyrosine kinase inhibitor blocks EGF activation of EGFR/erbB2 and downstream Erk1/2 and AKT pathways. Oncogene 2002, 21, 6255–6263. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tanizaki, J.; Okamoto, I.; Fumita, S.; Okamoto, W.; Nishio, K.; Nakagawa, K. Roles of BIM induction and survivin downregulation in lapatinib-induced apoptosis in breast cancer cells with HER2 amplification. Oncogene 2011, 30, 4097–4106. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Maccario, H.; Perera, N.M.; Davidson, L.; Downes, C.P.; Leslie, N.R. PTEN is destabilized by phosphorylation on Thr366. Biochem. J. 2007, 405, 439–444. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, Y.; Zhang, J.; Liu, C.; Du, S.; Feng, L.; Luan, X.; Zhang, Y.; Shi, Y.; Wang, T.; Wu, Y.; et al. Neratinib induces ErbB2 ubiquitylation and endocytic degradation via HSP90 dissociation in breast cancer cells. Cancer Lett. 2016, 382, 176–185. [Google Scholar] [CrossRef] [PubMed]
- Zhao, X.-Q.; Xie, J.-D.; Chen, X.-G.; Sim, H.M.; Zhang, X.; Liang, Y.-J.; Singh, S.; Talele, T.T.; Sun, Y.; Ambudkar, S.V.; et al. Neratinib Reverses ATP-Binding Cassette B1-Mediated Chemotherapeutic Drug Resistance In Vitro, In Vivo, and Ex Vivo. Mol. Pharmacol. 2012, 82, 47–58. [Google Scholar] [CrossRef] [Green Version]
- McGowan, P.M.; Mullooly, M.; Caiazza, F.; Sukor, S.; Madden, S.F.; Maguire, A.A.; Pierce, A.; McDermott, E.W.; Crown, J.; O’Donovan, N.; et al. ADAM-17: A novel therapeutic target for triple negative breast cancer. Ann. Oncol. 2013, 24, 362–369. [Google Scholar] [CrossRef]
- Mullooly, M.; Conklin, D.; McGowan, P.M.; O’Brien, N.A.; O’Donovan, N.; Slamon, D.J.; Crown, J.; Finn, R.S.; Duffy, M.J. Neratinib to inhibit the growth of triple-negative breast cancer cells. J. Clin. Oncol. 2015, 33, 1099. [Google Scholar] [CrossRef]
- Collins, D.M.; Conlon, N.T.; Kannan, S.; Verma, C.S.; Eli, L.D.; Lalani, A.S.; Crown, J. Preclinical characteristics of the irreversible pan-her kinase inhibitor neratinib compared with lapatinib: Implications for the treatment of HER2-positive and HER2-mutated breast cancer. Cancers 2019, 11, 737. [Google Scholar] [CrossRef] [Green Version]
- Crown, J.; O’Shaughnessy, J.; Gullo, G. Emerging targeted therapies in triple-negative breast cancer. Ann. Oncol. 2012, 23, vi56–vi65. [Google Scholar] [CrossRef]
- Rani, S.; Corcoran, C.; Shiels, L.; Germano, S.; Breslin, S.; Madden, S.; McDermott, M.S.; Browne, B.C.; O’Donovan, N.; Crown, J.; et al. Neuromedin U: A candidate biomarker and therapeutic target to predict and overcome resistance to HER-tyrosine kinase inhibitors. Cancer Res. 2014, 74, 3821–3833. [Google Scholar] [CrossRef] [Green Version]
- Garczyk, S.; Klotz, N.; Szczepanski, S.; Denecke, B.; Antonopoulos, W.; von Stillfried, S.; Knüchel, R.; Rose, M.; Dahl, E. Oncogenic features of neuromedin U in breast cancer are associated with NMUR2 expression involving crosstalk with members of the WNT signaling pathway. Oncotarget 2017, 8, 36246–36265. [Google Scholar] [CrossRef] [Green Version]
- Breslin, S.; Lowry, M.C.; O’Driscoll, L. Neratinib resistance and cross-resistance to other HER2-targeted drugs due to increased activity of metabolism enzyme cytochrome P4503A4. Br. J. Cancer 2017, 116, 620–625. [Google Scholar] [CrossRef]
- Rabindran, S.K.; Discafani, C.M.; Rosfjord, E.C.; Baxter, M.; Floyd, M.B.; Golas, J.; Hallett, W.A.; Johnson, B.D.; Nilakantan, R.; Overbeek, E.; et al. Antitumor activity of HKI-272, an orally active, irreversible inhibitor of the HER-2 tyrosine kinase. Cancer Res. 2004, 64, 3958–3965. [Google Scholar] [CrossRef] [Green Version]
- Watanabe, R.; Wei, L.; Huang, J. mTOR Signaling, Function, Novel Inhibitors, and Therapeutic Targets. J. Nucl. Med. 2011, 52, 497–501. [Google Scholar] [CrossRef] [Green Version]
- Maniscalco, L.; Millan, Y.; Iussich, S.; Denina, M.; Sanchez-Cespedes, R.; Gattino, F.; Biolatti, B.; Sasaki, N.; Nakagawa, T.; Di Renzo, M.F.; et al. Activation of mammalian target of rapamycin (mTOR) in triple negative feline mammary carcinomas. BMC Vet. Res. 2013, 9, 80. [Google Scholar] [CrossRef] [Green Version]
- Zheng, J.; Zou, X.; Yao, J. The Antitumor Effect of GDC-0941 Alone and in Combination with Rapamycin in Breast Cancer Cells. Chemotherapy 2012, 58, 273–281. [Google Scholar] [CrossRef] [PubMed]
- Walsh, S.; Flanagan, L.; Quinn, C.; Evoy, D.; McDermott, E.W.; Pierce, A.; Duffy, M.J. MTOR in breast cancer: Differential expression in triple-negative and non-triple-negative tumors. Breast 2012, 21, 178–182. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Yang, D.H.; Yang, Y.; Wang, J.Q.; Cai, C.Y.; Lei, Z.N.; Teng, Q.X.; Wu, Z.X.; Zhao, L.; Chen, Z.S. Overexpression of ABCB1 transporter confers resistance to mTOR inhibitor WYE-354 in cancer cells. Int. J. Mol. Sci. 2020, 21, 1387. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, B.; Fan, Z.; Edgerton, S.M.; Yang, X.; Lind, S.E.; Thor, A.D. Potent anti-proliferative effects of metformin on trastuzumab-resistant breast cancer cells via inhibition of ErbB2/IGF-1 receptor interactions. Cell Cycle 2011, 10, 2959–2966. [Google Scholar] [CrossRef] [Green Version]
- Zhang, J.W.; Zhao, F.; Sun, Q. Metformin synergizes with rapamycin to inhibit the growth of pancreatic cancer in vitro and in vivo. Oncol. Lett. 2018, 15, 1811–1816. [Google Scholar] [CrossRef]
- Liu, T.; Yacoub, R.; Taliaferro-Smith, L.D.; Sun, S.-Y.; Graham, T.R.; Dolan, R.; Lobo, C.; Tighiouart, M.; Yang, L.; Adams, A.; et al. Combinatorial Effects of Lapatinib and Rapamycin in Triple-Negative Breast Cancer Cells. Mol. Cancer Ther. 2011, 10, 1460–1469. [Google Scholar] [CrossRef] [Green Version]
- Ruprecht, B.; Zaal, E.A.; Zecha, J.; Wu, W.; Berkers, C.R.; Kuster, B.; Lemeer, S. Lapatinib Resistance in Breast Cancer Cells Is Accompanied by Phosphorylation-Mediated Reprogramming of Glycolysis. Cancer Res. 2017, 77, 1842–1854. [Google Scholar] [CrossRef] [Green Version]
- Liu, L.; Greger, J.; Shi, H.; Liu, Y.; Greshock, J.; Annan, R.; Halsey, W.; Sathe, G.M.; Martin, A.M.; Gilmer, T.M. Novel mechanism of lapatinib resistance in HER2-positive breast tumor cells: Activation of AXL. Cancer Res. 2009, 69, 6871–6878. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Takeda, T.; Yamamoto, H.; Suzawa, K.; Tomida, S.; Miyauchi, S.; Araki, K.; Nakata, K.; Miura, A.; Namba, K.; Shien, K.; et al. YES1 activation induces acquired resistance to neratinib in HER2-amplified breast and lung cancers. Cancer Sci. 2020, 111, 849–856. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mishra, R.; Hanker, A.B.; Garrett, J.T. Genomic alterations of ERBB receptors in cancer: Clinical implications. Oncotarget 2017, 8, 114371–114392. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Diederichs, S.; Bartsch, L.; Berkmann, J.C.; Fröse, K.; Heitmann, J.; Hoppe, C.; Iggena, D.; Jazmati, D.; Karschnia, P.; Linsenmeier, M.; et al. The dark matter of the cancer genome: Aberrations in regulatory elements, untranslated regions, splice sites, non-coding RNA and synonymous mutations. EMBO Mol. Med. 2016, 8, 442–457. [Google Scholar] [CrossRef]
- Santos, S.; Bastos, E.; Baptista, C.S.; Sá, D.; Caloustian, C.; Guedes-Pinto, H.; Gärtner, F.; Gut, I.G.; Chaves, R. Sequence variants and haplotype analysis of cat ERBB2 gene: A survey on spontaneous cat mammary neoplastic and non-neoplastic lesions. Int. J. Mol. Sci. 2012, 13, 2783–2800. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Høberg-Vetti, H.; Ognedal, E.; Buisson, A.; Vamre, T.B.A.; Ariansen, S.; Hoover, J.M.; Eide, G.E.; Houge, G.; Fiskerstrand, T.; Haukanes, B.I.; et al. The intronic BRCA1 c.5407-25T>A variant causing partly skipping of exon 23—A likely pathogenic variant with reduced penetrance? Eur. J. Hum. Genet. 2020, 28, 1078–1086. [Google Scholar] [CrossRef]
- Castagnoli, L.; Ladomery, M.; Tagliabue, E.; Pupa, S.M. The d16HER2 splice variant: A friend or foe of HER2-positive cancers? Cancers 2019, 11, 902. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Anczuków, O.; Buisson, M.; Léońe, M.; Coutanson, C.; Lasset, C.; Calender, A.; Sinilnikova, O.M.; Mazoyer, S. BRCA2 deep intronic mutation causing activation of a cryptic exon: Opening toward a new preventive therapeutic strategy. Clin. Cancer Res. 2012, 18, 4903–4909. [Google Scholar] [CrossRef] [Green Version]
- Sun, Z. Analysis of different HER-2 mutations in breast cancer progression and drug resistance The HER-2 mutations and variants. J. Cell. Mol. Med. 2015, 19, 2691–2701. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.E.; Narasanna, A.; Perez-Torres, M.; Xiang, B.; Wu, F.Y.; Yang, S.; Carpenter, G.; Gazdar, A.F.; Muthuswamy, S.K.; Arteaga, C.L. HER2 kinase domain mutation results in constitutive phosphorylation and activation of HER2 and EGFR and resistance to EGFR tyrosine kinase inhibitors. Cancer Cell 2006, 10, 25–38. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xu, X.; De Angelis, C.; Burke, K.A.; Nardone, A.; Hu, H.; Qin, L.; Veeraraghavan, J.; Sethunath, V.; Heiser, L.M.; Wang, N.; et al. HER2 reactivation through acquisition of the HER2 L755S mutation as a mechanism of acquired resistance to HER2-targeted therapy in HER2+breast cancer. Clin. Cancer Res. 2017, 23, 5123–5134. [Google Scholar] [CrossRef] [Green Version]
- Kancha, R.K.; von Bubnoff, N.; Bartosch, N.; Peschel, C.; Engh, R.A.; Duyster, J. Differential sensitivity of ERBB2 kinase domain mutations towards lapatinib. PLoS ONE 2011, 6, e26760. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Scott, G.K.; Robles, R.; Park, J.W.; Montgomery, P.A.; Daniel, J.; Holmes, W.E.; Lee, J.; Keller, G.A.; Li, W.L.; Fendly, B.M. A truncated intracellular HER2/neu receptor produced by alternative RNA processing affects growth of human carcinoma cells. Mol. Cell. Biol. 1993, 13, 2247–2257. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Drug Concentrations for the Cytotoxicity Assays | ||
---|---|---|
Lapatinib (nM) | Neratinib (nM) | Rapamycin (nM) |
195 | 0.195 | 0.195 |
390 | 0.39 | 0.39 |
780 | 0.78 | 0.78 |
1560 | 1.56 | 1.56 |
3125 | 3.125 | 3.125 |
6250 | 6.25 | 6.25 |
12,500 | 12.5 | 12.5 |
25,000 | 25 | 25 |
50,000 | 50 | 50 |
100 × 103 | 100 | 100 |
250 × 103 | 250 | 250 |
500 × 103 | 500 | 500 |
1 × 106 | 750 | 750 |
1000 | 1000 | |
1500 | 1500 |
Primary Antibody. | Clone | Dilution |
---|---|---|
β-actin | AC-15 | 1:5000 |
HER2 | CB11 | 1:1000 |
HER2 pY1221 + Y1222 | Polyclonal | 1:1000 |
HER1 pY1173 | E124 | 1:500 |
HER4 pY1284 | Polyclonal | 1:500 |
AKT1 pS473 | EP2109Y | 1:2000 |
ERK1/2 pT202/pY204 + pT185/pY187 | MAPK-YT | 1:5000 |
PTEN pT366 | EP229 | 1:1000 |
mTOR pS2448 | EPR426(2) | 1:10,000 |
Clinicopathological Feature | Number (%) | Clinicopathological Feature | Number (%) |
---|---|---|---|
Breed | Age | ||
Indeterminate | 33 (82.5%) | <8years old | 3 (7.5%) |
Siamese | 4 (10%) | ≥8 years old | 37 (92.5%) |
Persian | 2 (5%) | ||
Norwegian Forest | 1 (2.5%) | Tumor size | |
<2cm | 9 (22.5%) | ||
2–3cm | 19 (47.5%) | ||
Spayed; 1 unknown | >3cm | 12 (30%) | |
Yes | 19 (47.5%) | ||
No | 20 (50%) | HP * classification | |
Contraceptives; 7 unknown | |||
Yes | 23 (57.5%) | Tubulopapillary carcinoma | 8 (20%) |
No | 10 (25%) | Solid carcinoma | 9 (22.5%) |
Cribiform carcinoma | 5 (12.5%) | ||
Treatment | Mucinous carcinoma | 5 (12.5%) | |
Mastectomy | 36 (90%) | Tubular Carcinoma | 11 (27.5%) |
Mastectomy + Chemo | 4 (10%) | Papillary-cystic carcinoma | 2 (5%) |
Multiple tumors | HP * Malignancy grade | ||
Yes | 31 (77.5%) | I | 2 (5%) |
No | 9 (22.5%) | II | 5 (12.5%) |
Regional lymph node status; 2 unknown | III | 33 (82.5%) | |
Positive | 14 (35%) | Tumor necrosis | |
Negative | 24 (60%) | Yes | 29 (72.5%) |
Stage (TNM classification) | No | 11 (27.5%) | |
I | 9 (22.5%) | Lymphatic invasion | |
II | 7 (17.5%) | Yes | 5 (12.5%) |
III | 21 (52.5%) | No | 35 (87.5%) |
IV | 3 (7.5%) | Lymphocytic infiltration | |
Mammary location | Yes | 27 (67.5%) | |
M1 | 11 (27.5%) | No | 13 (32.5%) |
M2 | 8 (20%) | Tumor ulceration | |
M3 | 14 (35%) | Yes | 3 (7.5%) |
M4 | 11 (27.5%) | No | 37 (92.5%) |
fHER2 status | Ki67 index | ||
Positive | 12 (30%) | Low (<14%) | 30 (75%) |
Negative | 28 (70%) | High (≥14%) | 10 (25%) |
ER status | PR status | ||
Positive | 12 (30%) | Positive | 20 (50%) |
Negative | 28 (70%) | Negative | 20 (50%) |
Forward (5′-3’) | Reverse (5′-3´) | Exons |
---|---|---|
CTAGTGGAGCCATGCCCAA | GGAGGTCCCTCCTGTACTCC | 18 and 19 |
AATCTTGGACGTAAGCCCCTC | AGGCCCCCTAAGTGCATACC | 20 |
CTGACATCCACCGTGCAGTT | CGTAGCTCCACACGTCACTC | 21 and 22 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gameiro, A.; Almeida, F.; Nascimento, C.; Correia, J.; Ferreira, F. Tyrosine Kinase Inhibitors Are Promising Therapeutic Tools for Cats with HER2-Positive Mammary Carcinoma. Pharmaceutics 2021, 13, 346. https://0-doi-org.brum.beds.ac.uk/10.3390/pharmaceutics13030346
Gameiro A, Almeida F, Nascimento C, Correia J, Ferreira F. Tyrosine Kinase Inhibitors Are Promising Therapeutic Tools for Cats with HER2-Positive Mammary Carcinoma. Pharmaceutics. 2021; 13(3):346. https://0-doi-org.brum.beds.ac.uk/10.3390/pharmaceutics13030346
Chicago/Turabian StyleGameiro, Andreia, Filipe Almeida, Catarina Nascimento, Jorge Correia, and Fernando Ferreira. 2021. "Tyrosine Kinase Inhibitors Are Promising Therapeutic Tools for Cats with HER2-Positive Mammary Carcinoma" Pharmaceutics 13, no. 3: 346. https://0-doi-org.brum.beds.ac.uk/10.3390/pharmaceutics13030346