Novel Toscana Virus Reverse Genetics System Establishes NSs as an Antagonist of Type I Interferon Responses
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cells and Viruses
2.2. Antibodies and Reagents
2.3. Plasmids
2.4. Rescue of Viruses from Plasmid DNAs
2.5. Virus Production, Purification, and Titration by Plaque-Forming Unit Assay
2.6. Western Blot Analysis
2.7. Infection Assay
2.8. IFN mRNA Quantification Assay
2.9. Statistical Analysis
3. Results
3.1. Recovery of TOSV H4906 from cDNA
3.2. Characterization of rTOSV Viral Particles
3.3. Growth Properties of the Rescued TOSV is Similar to Those of the WT Strain
3.4. Generation of a TOSV Mutant Lacking NSs Expression
3.5. NSs Silences IFN mRNA Expression
4. Discussion
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Moriconi, M.; Rugna, G.; Calzolari, M.; Bellini, R.; Albieri, A.; Angelini, P.; Cagarelli, R.; Landini, M.P.; Charrel, R.N.; Varani, S. Phlebotomine sand fly-borne pathogens in the Mediterranean Basin: Human leishmaniasis and phlebovirus infections. PLoS Negl. Trop. Dis. 2017, 11, e0005660. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Charrel, R.N.; Berenger, J.M.; Laroche, M.; Ayhan, N.; Bitam, I.; Delaunay, P.; Parola, P. Neglected vector-borne bacterial diseases and arboviruses in the Mediterranean area. New Microbes New Infect. 2018, 26, S31–S36. [Google Scholar] [CrossRef] [PubMed]
- Verani, P.; Ciufolini, M.G.; Nicoletti, L.; Balducci, M.; Sabatinelli, G.; Coluzzi, M.; Paci, P.; Amaducci, L. Ecological and epidemiological studies of Toscana virus, an arbovirus isolated from Phlebotomus. Ann. Ist Super. Sanita. 1982, 18, 397–399. [Google Scholar] [PubMed]
- Charrel, R.N.; Gallian, P.; Navarro-Mari, J.M.; Nicoletti, L.; Papa, A.; Sanchez-Seco, M.P.; Tenorio, A.; de Lamballerie, X. Emergence of Toscana virus in Europe. Emerg. Infect. Dis. 2005, 11, 1657–1663. [Google Scholar] [CrossRef]
- Albornoz, A.; Hoffmann, A.B.; Lozach, P.Y.; Tischler, N.D. Early Bunyavirus-Host Cell Interactions. Viruses 2016, 8, 143. [Google Scholar] [CrossRef] [Green Version]
- Uckeley, Z.M.; Koch, J.; Tischler, N.D.; Leger, P.; Lozach, P.Y. Cell biology of phlebovirus entry. Virologie (Montrouge) 2019, 23, 176–187. [Google Scholar]
- Elliott, R.M.; Brennan, B. Emerging phleboviruses. Curr. Opin. Virol. 2014, 5, 50–57. [Google Scholar] [CrossRef] [Green Version]
- Giorgi, C. Molecular Biology of Phleboviruses. In The Bunyaviridae; Elliott, R.M., Ed.; Springer-Verlag: Berlin/Heidelberg, Germany, 1996; pp. 105–128. [Google Scholar]
- Leger, P.; Lozach, P.Y. Bunyaviruses: From transmission by arthropods to virus entry into the mammalian host first-target cells. Future Virol. 2015, 10, 859–881. [Google Scholar] [CrossRef] [Green Version]
- de Boer, S.M.; Kortekaas, J.; de Haan, C.A.; Rottier, P.J.; Moormann, R.J.; Bosch, B.J. Heparan sulfate facilitates Rift Valley fever virus entry into the cell. J. Virol. 2012, 86, 13767–13771. [Google Scholar] [CrossRef] [Green Version]
- Pietrantoni, A.; Fortuna, C.; Remoli, M.E.; Ciufolini, M.G.; Superti, F. Bovine lactoferrin inhibits Toscana virus infection by binding to heparan sulphate. Viruses 2015, 7, 480–495. [Google Scholar] [CrossRef] [Green Version]
- Lozach, P.Y.; Kuhbacher, A.; Meier, R.; Mancini, R.; Bitto, D.; Bouloy, M.; Helenius, A. DC-SIGN as a receptor for phleboviruses. Cell Host Microbe 2011, 10, 75–88. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Leger, P.; Tetard, M.; Youness, B.; Cordes, N.; Rouxel, R.N.; Flamand, M.; Lozach, P.Y. Differential Use of the C-Type Lectins L-SIGN and DC-SIGN for Phlebovirus Endocytosis. Traffic 2016, 17, 639–656. [Google Scholar] [CrossRef] [PubMed]
- Amroun, A.; Priet, S.; Querat, G. Toscana virus cap-snatching and initiation of transcription. J. Gen. Virol. 2017. [Google Scholar] [CrossRef] [PubMed]
- Uckeley, Z.M.; Moeller, R.; Kühn, L.I.; Nilsson, E.; Robens, C.; Lasswitz, L.; Lindqvist, R.; Lenman, A.; Passos, V.; Voß, Y.; et al. Quantitative proteomics of Uukuniemi virus-host cell interactions reveals GBF1 as proviral host factor for phleboviruses. Mol. Cell. Proteo. 2019, 18, 2401–2417. [Google Scholar] [CrossRef]
- Wuerth, J.D.; Weber, F. Phleboviruses and the Type I Interferon Response. Viruses 2016, 8, 174. [Google Scholar] [CrossRef] [Green Version]
- Gori-Savellini, G.; Valentini, M.; Cusi, M.G. Toscana virus NSs protein inhibits the induction of type I interferon by interacting with RIG-I. J. Virol. 2013, 87, 6660–6667. [Google Scholar] [CrossRef] [Green Version]
- Wuerth, J.D.; Habjan, M.; Wulle, J.; Superti-Furga, G.; Pichlmair, A.; Weber, F. NSs Protein of Sandfly Fever Sicilian Phlebovirus Counteracts Interferon (IFN) Induction by Masking the DNA-Binding Domain of IFN Regulatory Factor 3. J. Virol. 2018, 92, 23. [Google Scholar] [CrossRef] [Green Version]
- Gori Savellini, G.; Anichini, G.; Gandolfo, C.; Prathyumnan, S.; Cusi, M.G. Toscana virus non-structural protein NSs acts as E3 ubiquitin ligase promoting RIG-I degradation. PLoS Pathog. 2019, 15, e1008186. [Google Scholar] [CrossRef]
- Ito, N.; Takayama-Ito, M.; Yamada, K.; Hosokawa, J.; Sugiyama, M.; Minamoto, N. Improved recovery of rabies virus from cloned cDNA using a vaccinia virus-free reverse genetics system. Microbiol. Immunol. 2003, 47, 613–617. [Google Scholar] [CrossRef]
- Gerbaud, S.; Pardigon, N.; Vialat, P.; Bouloy, M. Organization of Germiston bunyavirus M open reading frame and physicochemical properties of the envelope glycoproteins. J. Gen. Virol. 1992, 73, 2245–2254. [Google Scholar] [CrossRef]
- Backovic, M.; Johansson, D.X.; Klupp, B.G.; Mettenleiter, T.C.; Persson, M.A.; Rey, F.A. Efficient method for production of high yields of Fab fragments in Drosophila S2 cells. Protein Eng. Des. Sel. 2010, 23, 169–174. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hoffmann, A.B.; Mazelier, M.; Leger, P.; Lozach, P.Y. Deciphering Virus Entry with Fluorescently Labeled Viral Particles. Methods Mol. Biol. 2018, 1836, 159–183. [Google Scholar] [PubMed]
- Lozach, P.Y.; Mancini, R.; Bitto, D.; Meier, R.; Oestereich, L.; Overby, A.K.; Pettersson, R.F.; Helenius, A. Entry of bunyaviruses into mammalian cells. Cell Host Microbe 2010, 7, 488–499. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hofmann, H.; Pohlmann, S. DC-SIGN: Access portal for sweet viral killers. Cell Host Microbe 2011, 10, 5–7. [Google Scholar] [CrossRef] [Green Version]
- Meier, R.; Franceschini, A.; Horvath, P.; Tetard, M.; Mancini, R.; von Mering, C.; Helenius, A.; Lozach, P.Y. Genome-wide small interfering RNA screens reveal VAMP3 as a novel host factor required for Uukuniemi virus late penetration. J. Virol. 2014, 88, 8565–8578. [Google Scholar] [CrossRef] [Green Version]
- Li, S.; Zhu, X.; Guan, Z.; Huang, W.; Zhang, Y.; Kortekaas, J.; Lozach, P.Y.; Peng, K. NSs Filament Formation Is Important but Not Sufficient for RVFV Virulence In Vivo. Viruses 2019, 11, 834. [Google Scholar] [CrossRef] [Green Version]
- Wichgers Schreur, P.J.; Oreshkova, N.; Moormann, R.J.; Kortekaas, J. Creation of Rift Valley fever viruses with four-segmented genomes reveals flexibility in bunyavirus genome packaging. J. Virol. 2014, 88, 10883–10893. [Google Scholar] [CrossRef] [Green Version]
- Bouloy, M. Encyclopedia of Arthropod-Transmitted Infections of Man and Domesticated Animals: "Germiston Virus"; Cabi: Wallingford, UK, 2001; p. 608. [Google Scholar]
- Kalveram, B.; Ikegami, T. Toscana virus NSs protein promotes degradation of double-stranded RNA-dependent protein kinase. J. Virol. 2013, 87, 3710–3718. [Google Scholar] [CrossRef] [Green Version]
- Otsuki, K.; Maeda, J.; Yamamoto, H.; Tsubokura, M. Studies on avian infectious bronchitis virus (IBV). III. Interferon induction by and sensitivity to interferon of IBV. Arch. Virol. 1979, 60, 249–255. [Google Scholar] [CrossRef]
- Mosca, J.D.; Pitha, P.M. Transcriptional and Posttranscriptional Regulations of Exogenous Human Beta Interferon Gene in Simian Cells Defective in Interferon Synthesis. Mol. Cell. Biol. 1986, 6, 2279–2283. [Google Scholar] [CrossRef]
- Emeny, J.M.; Morgan, M.J. Susceptibility of Various Cells Treated with Interferon to the Toxic Effect of Poly(Ri).Poly(Rc) Treatment. J. Gen. Virol. 1979, 43, 253–255. [Google Scholar] [CrossRef] [PubMed]
- Tanabe, M.; Kurita-Taniguchi, M.; Takeuchi, K.; Takeda, M.; Ayata, M.; Ogura, H.; Matsumoto, M.; Seya, T. Mechanism of up-regulation of human Toll-like receptor 3 secondary to infection of measles virus-attenuated strains. Biochem Biophys. Res. Commun. 2003, 311, 39–48. [Google Scholar] [CrossRef] [PubMed]
- Papa, A.; Andriotis, V.; Tzilianos, M. Prevalence of Toscana virus antibodies in residents of two Ionian islands, Greece. Travel Med. Infect. Dis. 2010, 8, 302–304. [Google Scholar] [CrossRef] [PubMed]
- Ikegami, T.; Won, S.; Peters, C.J.; Makino, S. Rescue of infectious rift valley fever virus entirely from cDNA, analysis of virus lacking the NSs gene, and expression of a foreign gene. J. Virol. 2006, 80, 2933–2940. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Brennan, B.; Li, P.; Zhang, S.; Li, A.; Liang, M.; Li, D.; Elliott, R.M. Reverse genetics system for severe fever with thrombocytopenia syndrome virus. J. Virol. 2015, 89, 3026–3037. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mazelier, M.; Rouxel, R.N.; Zumstein, M.; Mancini, R.; Bell-Sakyi, L.; Lozach, P.Y. Uukuniemi Virus as a Tick-Borne Virus Model. J. Virol. 2016, 90, 6784–6798. [Google Scholar] [CrossRef] [Green Version]
- Rezelj, V.V.; Overby, A.K.; Elliott, R.M. Generation of mutant Uukuniemi viruses lacking the nonstructural protein NSs by reverse genetics indicates that NSs is a weak interferon antagonist. J. Virol. 2015, 89, 4849–4856. [Google Scholar] [CrossRef] [Green Version]
- Brisbarre, N.M.; Plumet, S.; de Micco, P.; Leparc-Goffart, I.; Emonet, S.F. Toscana virus inhibits the interferon beta response in cell cultures. Virology 2013, 442, 189–194. [Google Scholar] [CrossRef] [Green Version]
- Gori Savellini, G.; Weber, F.; Terrosi, C.; Habjan, M.; Martorelli, B.; Cusi, M.G. Toscana virus induces interferon although its NSs protein reveals antagonistic activity. J. Gen. Virol. 2011, 92, 71–79. [Google Scholar] [CrossRef]
- Ly, H.J.; Ikegami, T. Rift Valley fever virus NSs protein functions and the similarity to other bunyavirus NSs proteins. Virol. J. 2016, 13, 118. [Google Scholar] [CrossRef] [Green Version]
- Qu, B.; Qi, X.; Wu, X.; Liang, M.; Li, C.; Cardona, C.J.; Xu, W.; Tang, F.; Li, Z.; Wu, B.; et al. Suppression of the interferon and NF-kappaB responses by severe fever with thrombocytopenia syndrome virus. J. Virol. 2012, 86, 8388–8401. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Feng, K.; Deng, F.; Hu, Z.; Wang, H.; Ning, Y.J. Heartland virus antagonizes type I and III interferon antiviral signaling by inhibiting phosphorylation and nuclear translocation of STAT2 and STAT1. J. Biol. Chem. 2019, 294, 9503–9517. [Google Scholar] [CrossRef] [PubMed]
Name | Purified | Species | Virus | Antigens | Target Protein |
---|---|---|---|---|---|
T1 | No | Guinea pig | TOSV | Virus | N, GN, and GC |
T2 | No | Guinea pig | TOSV | Soluble GN | GN |
T3 | No | Guinea pig | TOSV | Soluble GC | GC |
T4 | Yes | Rabbit | TOSV | Full length N | N |
T5 | Yes | Rabbit | TOSV | Peptide NSs | NSs |
GR1 | No | Guinea pig | GERV | Virus | N, GN, and GC |
Name | Sense 1 | Sequence (5′ -> 3′) | Purpose 2 |
---|---|---|---|
IFN-b-F | For. | GCCGCATTGACCATCTAT | qRT-PCR |
IFN-b-R | Rev. | GTCTCATTCCAGCCAGTG | qRT-PCR |
HPRT1-F | For. | CCTGGCGTCGTGATTAGTGAT | qRT-PCR |
HPRT1-R | Rev. | AGACGTTCAGTCCTGTCCATAA | qRT-PCR |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Woelfl, F.; Léger, P.; Oreshkova, N.; Pahmeier, F.; Windhaber, S.; Koch, J.; Stanifer, M.; Roman Sosa, G.; Uckeley, Z.M.; Rey, F.A.; et al. Novel Toscana Virus Reverse Genetics System Establishes NSs as an Antagonist of Type I Interferon Responses. Viruses 2020, 12, 400. https://0-doi-org.brum.beds.ac.uk/10.3390/v12040400
Woelfl F, Léger P, Oreshkova N, Pahmeier F, Windhaber S, Koch J, Stanifer M, Roman Sosa G, Uckeley ZM, Rey FA, et al. Novel Toscana Virus Reverse Genetics System Establishes NSs as an Antagonist of Type I Interferon Responses. Viruses. 2020; 12(4):400. https://0-doi-org.brum.beds.ac.uk/10.3390/v12040400
Chicago/Turabian StyleWoelfl, Franziska, Psylvia Léger, Nadia Oreshkova, Felix Pahmeier, Stefan Windhaber, Jana Koch, Megan Stanifer, Gleyder Roman Sosa, Zina M. Uckeley, Felix A. Rey, and et al. 2020. "Novel Toscana Virus Reverse Genetics System Establishes NSs as an Antagonist of Type I Interferon Responses" Viruses 12, no. 4: 400. https://0-doi-org.brum.beds.ac.uk/10.3390/v12040400