Nonstructural Protein NS1 of Influenza Virus Disrupts Mitochondrial Dynamics and Enhances Mitophagy via ULK1 and BNIP3
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cells, Viruses, and Reagents
2.2. Confocal Microscopy and Image Analysis
2.3. Quantitative Realtime PCR (qRT-PCR)
2.4. Small Interfering RNA (siRNA) Transfection
2.5. Mitochondrial Membrane Potential (MMP) Measurements
2.6. Mitochondrial Isolation and Immunoblot Analysis
2.7. Apoptosis Assay
2.8. Statistical Analysis
3. Results
3.1. IFV NS1 Promotes CCCP-Mediated Mitophagy in A549 Cells
3.2. Mitophagy Induction via CCCP Treatment Increases IFV Replication
3.3. IFV NS1 Induces Mitochondrial Fragmentation
3.4. ULK1 Translocates to Mitochondria upon IFV Infection and Supports Viral Replication
3.5. IFV NS1 Induces the Expression of the Mitophagy Receptor BNIP3, Which Is Essential for Viral Replication
4. Discussion
Supplementary Materials
Author Contributions
Funding
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Um, J.H.; Yun, J. Emerging role of mitophagy in human diseases and physiology. BMB Rep. 2017, 50, 299–307. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Youle, R.J.; Narendra, D.P. Mechanisms of mitophagy. Nat. Rev. Mol. Cell Biol. 2011, 12, 9–14. [Google Scholar] [CrossRef] [PubMed]
- Montava-Garriga, L.; Ganley, I.G. Outstanding Questions in Mitophagy: What We Do and Do Not Know. J. Mol. Biol. 2020, 432, 206–230. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Qin, Y.; Chen, M. Viral strategies for triggering and manipulating mitophagy. Autophagy 2018, 14, 1665–1673. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ding, B.; Zhang, L.; Li, Z.; Zhong, Y.; Tang, Q.; Qin, Y.; Chen, M. The Matrix Protein of Human Parainfluenza Virus Type 3 Induces Mitophagy that Suppresses Interferon Responses. Cell Host Microbe 2017, 21, 538–547. [Google Scholar] [CrossRef] [Green Version]
- Wang, R.; Zhu, Y.; Ren, C.; Yang, S.; Tian, S.; Chen, H.; Jin, M.; Zhou, H. Influenza A virus protein PB1-F2 impairs innate immunity by inducing mitophagy. Autophagy 2020, 5, 496–511. [Google Scholar] [CrossRef]
- Krammer, F.; Smith, G.J.D.; Fouchier, R.A.M.; Peiris, M.; Kedzierska, K.; Doherty, P.C.; Palese, P.; Shaw, M.L.; Treanor, J.; Webster, R.G.; et al. Influenza. Nat. Rev. Dis. Primers 2018, 4, 3. [Google Scholar] [CrossRef]
- Bloom, J.D.; Gong, L.I.; Baltimore, D. Permissive secondary mutations enable the evolution of influenza oseltamivir resistance. Science 2010, 328, 1272–1275. [Google Scholar] [CrossRef] [Green Version]
- Hsu, A.C. Influenza Virus: A Master Tactician in Innate Immune Evasion and Novel Therapeutic Interventions. Front. Immunol. 2018, 9, 743. [Google Scholar] [CrossRef] [Green Version]
- Marc, D. Influenza virus non-structural protein NS1: Interferon antagonism and beyond. J. Gen. Virol. 2014, 95 Pt 12, 2594–2611. [Google Scholar] [CrossRef]
- Seth, R.B.; Sun, L.; Ea, C.-K.; Chen, Z.J. Identification and characterization of MAVS, a mitochondrial antiviral signaling protein that activates NF-κB and IRF3. Cell 2005, 122, 669–682. [Google Scholar] [CrossRef] [Green Version]
- Gack, M.U.; Albrecht, R.A.; Urano, T.; Inn, K.S.; Huang, I.C.; Carnero, E.; Farzan, M.; Inoue, S.; Jung, J.U.; Garcia-Sastre, A. Influenza A virus NS1 targets the ubiquitin ligase TRIM25 to evade recognition by the host viral RNA sensor RIG-I. Cell Host Microbe 2009, 5, 439–449. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bergmann, M.; Garcia-Sastre, A.; Carnero, E.; Pehamberger, H.; Wolff, K.; Palese, P.; Muster, T. Influenza virus NS1 protein counteracts PKR-mediated inhibition of replication. J. Virol. 2000, 74, 6203–6206. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhirnov, O.P.; Klenk, H.D. Control of apoptosis in influenza virus-infected cells by up-regulation of Akt and p53 signaling. Apoptosis 2007, 12, 1419–1432. [Google Scholar] [CrossRef] [PubMed]
- Zhirnov, O.P.; Klenk, H.D. Influenza A virus proteins NS1 and hemagglutinin along with M2 are involved in stimulation of autophagy in infected cells. J. Virol. 2013, 87, 13107–13114. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhou, Z.; Jiang, X.; Liu, D.; Fan, Z.; Hu, X.; Yan, J.; Wang, M.; Gao, G.F. Autophagy is involved in influenza A virus replication. Autophagy 2009, 5, 321–328. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, R.; Chi, X.; Wang, S.; Qi, B.; Yu, X.; Chen, J.L. The regulation of autophagy by influenza A virus. Biomed. Res. Int. 2014, 2014, 498083. [Google Scholar] [CrossRef]
- Wang, R.; Zhu, Y.; Zhao, J.; Ren, C.; Li, P.; Chen, H.; Jin, M.; Zhou, H. Autophagy Promotes Replication of Influenza A Virus In Vitro. J. Virol. 2019, 93, 44–45. [Google Scholar] [CrossRef] [Green Version]
- Kim, Y.Y.; Um, J.H.; Yoon, J.H.; Kim, H.; Lee, D.Y.; Lee, Y.J.; Jee, H.J.; Kim, Y.M.; Jang, J.S.; Jang, Y.G.; et al. Assessment of mitophagy in mt-Keima Drosophila revealed an essential role of the PINK1-Parkin pathway in mitophagy induction in vivo. FASEB J. 2019, 33, 9742–9751. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sun, N.; Yun, J.; Liu, J.; Malide, D.; Liu, C.; Rovira, I.I.; Holmstrom, K.M.; Fergusson, M.M.; Yoo, Y.H.; Combs, C.A.; et al. Measuring In Vivo Mitophagy. Mol. Cell 2015, 60, 685–696. [Google Scholar] [CrossRef] [Green Version]
- Oh, S.J.; Lim, B.K.; Yun, J.; Shin, O.S. CVB3-Mediated Mitophagy Plays an Important Role in Viral Replication via Abrogation of Interferon Pathways. Front. Cell Infect. Microbiol. 2021, 11, 704494. [Google Scholar] [CrossRef]
- Manicassamy, B.; Manicassamy, S.; Belicha-Villanueva, A.; Pisanelli, G.; Pulendran, B.; Garcia-Sastre, A. Analysis of in vivo dynamics of influenza virus infection in mice using a GFP reporter virus. Proc. Natl. Acad. Sci. USA 2010, 107, 11531–11536. [Google Scholar] [CrossRef] [Green Version]
- Seong, R.K.; Seo, S.W.; Kim, J.A.; Fletcher, S.J.; Morgan, N.V.; Kumar, M.; Choi, Y.K.; Shin, O.S. Schlafen 14 (SLFN14) is a novel antiviral factor involved in the control of viral replication. Immunobiology 2017, 222, 979–988. [Google Scholar] [CrossRef]
- Oh, S.J.; Gim, J.A.; Lee, J.K.; Park, H.; Shin, O.S. Coxsackievirus B3 Infection of Human Neural Progenitor Cells Results in Distinct Expression Patterns of Innate Immune Genes. Viruses 2020, 12, 322. [Google Scholar] [CrossRef] [Green Version]
- Klionsky, D.J.; Abdel-Aziz, A.K.; Abdelfatah, S.; Abdellatif, M.; Abdoli, A.; Abel, S.; Abeliovich, H.; Abildgaard, M.H.; Abudu, Y.P.; Acevedo-Arozena, A.; et al. Guidelines for the use and interpretation of assays for monitoring autophagy. Autophagy 2021, 17, 1–382. [Google Scholar] [CrossRef]
- Kim, S.; Choi, S.; Kang, D. Quantitative and qualitative analysis of autophagy flux using imaging. BMB Rep. 2020, 53, 241–247. [Google Scholar] [CrossRef]
- Oh, S.J.; Lim, S.; Song, M.J.; Ahn, J.H.; Lee, C.H.; Shin, O.S. Whole Transcriptome Analyses Reveal Differential mRNA and microRNA Expression Profiles in Primary Human Dermal Fibroblasts Infected with Clinical or Vaccine Strains of Varicella Zoster Virus. Pathogens 2019, 8, 132. [Google Scholar] [CrossRef] [Green Version]
- Seong, R.K.; Lee, J.K.; Cho, G.J.; Kumar, M.; Shin, O.S. mRNA and miRNA profiling of Zika virus-infected human umbilical cord mesenchymal stem cells identifies miR-142-5p as an antiviral factor. Emerg. Microbes Infect. 2020, 9, 2061–2075. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.K.; Kim, J.A.; Oh, S.J.; Lee, E.W.; Shin, O.S. Zika Virus Induces Tumor Necrosis Factor-Related Apoptosis Inducing Ligand (TRAIL)-Mediated Apoptosis in Human Neural Progenitor Cells. Cells 2020, 9, 286. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.A.; Seong, R.K.; Kumar, M.; Shin, O.S. Favipiravir and Ribavirin Inhibit Replication of Asian and African Strains of Zika Virus in Different Cell Models. Viruses 2018, 10, 2782. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ehrhardt, C.; Wolff, T.; Pleschka, S.; Planz, O.; Beermann, W.; Bode, J.G.; Schmolke, M.; Ludwig, S. Influenza A virus NS1 protein activates the PI3K/Akt pathway to mediate antiapoptotic signaling responses. J. Virol. 2007, 81, 3058–3067. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mauthe, M.; Orhon, I.; Rocchi, C.; Zhou, X.; Luhr, M.; Hijlkema, K.J.; Coppes, R.P.; Engedal, N.; Mari, M.; Reggiori, F. Chloroquine inhibits autophagic flux by decreasing autophagosome-lysosome fusion. Autophagy 2018, 14, 1435–1455. [Google Scholar] [CrossRef] [PubMed]
- Um, J.H.; Kim, Y.Y.; Finkel, T.; Yun, J. Sensitive Measurement of Mitophagy by Flow Cytometry Using the pH-dependent Fluorescent Reporter mt-Keima. J. Vis. Exp. 2018, 1, 138. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wu, W.; Tian, W.; Hu, Z.; Chen, G.; Huang, L.; Li, W.; Zhang, X.; Xue, P.; Zhou, C.; Liu, L.; et al. ULK1 translocates to mitochondria and phosphorylates FUNDC1 to regulate mitophagy. EMBO Rep. 2014, 15, 566–575. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Weil, R.; Laplantine, E.; Curic, S.; Genin, P. Role of Optineurin in the Mitochondrial Dysfunction: Potential Implications in Neurodegenerative Diseases and Cancer. Front. Immunol. 2018, 9, 1243. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, J.; Ney, P.A. Role of BNIP3 and NIX in cell death, autophagy, and mitophagy. Cell Death Differ. 2009, 16, 939–946. [Google Scholar] [CrossRef] [Green Version]
- Novak, I.; Kirkin, V.; McEwan, D.G.; Zhang, J.; Wild, P.; Rozenknop, A.; Rogov, V.; Lohr, F.; Popovic, D.; Occhipinti, A.; et al. Nix is a selective autophagy receptor for mitochondrial clearance. EMBO Rep. 2010, 11, 45–51. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Quinsay, M.N.; Thomas, R.L.; Lee, Y.; Gustafsson, A.B. Bnip3-mediated mitochondrial autophagy is independent of the mitochondrial permeability transition pore. Autophagy 2010, 6, 855–862. [Google Scholar] [CrossRef] [Green Version]
- O‘Sullivan, T.E.; Johnson, L.R.; Kang, H.H.; Sun, J.C. BNIP3- and BNIP3L-Mediated Mitophagy Promotes the Generation of Natural Killer Cell Memory. Immunity 2015, 43, 331–342. [Google Scholar] [CrossRef] [Green Version]
- Kim, S.J.; Khan, M.; Quan, J.; Till, A.; Subramani, S.; Siddiqui, A. Hepatitis B virus disrupts mitochondrial dynamics: Induces fission and mitophagy to attenuate apoptosis. PLoS Pathog. 2013, 9, e1003722. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kim, S.J.; Syed, G.H.; Siddiqui, A. Hepatitis C virus induces the mitochondrial translocation of Parkin and subsequent mitophagy. PLoS Pathog. 2013, 9, e1003285. [Google Scholar] [CrossRef] [Green Version]
- Xia, M.; Gonzalez, P.; Li, C.; Meng, G.; Jiang, A.; Wang, H.; Gao, Q.; Debatin, K.M.; Beltinger, C.; Wei, J. Mitophagy enhances oncolytic measles virus replication by mitigating DDX58/RIG-I-like receptor signaling. J. Virol. 2014, 88, 5152–5164. [Google Scholar] [CrossRef] [Green Version]
- Li, S.; Wang, J.; Zhou, A.; Khan, F.A.; Hu, L.; Zhang, S. Porcine reproductive and respiratory syndrome virus triggers mitochondrial fission and mitophagy to attenuate apoptosis. Oncotarget 2016, 7, 56002–56012. [Google Scholar] [CrossRef] [Green Version]
- Gou, H.; Zhao, M.; Xu, H.; Yuan, J.; He, W.; Zhu, M.; Ding, H.; Yi, L.; Chen, J. CSFV induced mitochondrial fission and mitophagy to inhibit apoptosis. Oncotarget 2017, 8, 39382–39400. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vilmen, G.; Glon, D.; Siracusano, G.; Lussignol, M.; Shao, Z.; Hernandez, E.; Perdiz, D.; Quignon, F.; Mouna, L.; Pous, C.; et al. BHRF1, a BCL2 viral homolog, disturbs mitochondrial dynamics and stimulates mitophagy to dampen type I IFN induction. Autophagy 2020, 10, 1296–1315. [Google Scholar] [CrossRef] [PubMed]
- Sin, J.; McIntyre, L.; Stotland, A.; Feuer, R.; Gottlieb, R.A. Coxsackievirus B Escapes the Infected Cell in Ejected Mitophagosomes. J. Virol. 2017, 91, 1790. [Google Scholar] [CrossRef] [Green Version]
- Lupfer, C.; Thomas, P.G.; Anand, P.K.; Vogel, P.; Milasta, S.; Martinez, J.; Huang, G.; Green, M.; Kundu, M.; Chi, H.; et al. Receptor interacting protein kinase 2-mediated mitophagy regulates inflammasome activation during virus infection. Nat. Immunol. 2013, 14, 480–488. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Perot, B.P.; Boussier, J.; Yatim, N.; Rossman, J.S.; Ingersoll, M.A.; Albert, M.L. Autophagy diminishes the early interferon-beta response to influenza A virus resulting in differential expression of interferon-stimulated genes. Cell Death Dis. 2018, 9, 539. [Google Scholar] [CrossRef]
- Bu, L.; Wang, H.; Hou, P.; Guo, S.; He, M.; Xiao, J.; Li, P.; Zhong, Y.; Jia, P.; Cao, Y.; et al. The Ubiquitin E3 Ligase Parkin Inhibits Innate Antiviral Immunity Through K48-Linked Polyubiquitination of RIG-I and MDA5. Front. Immunol. 2020, 11, 1926. [Google Scholar] [CrossRef] [PubMed]
- Kuroki, T.; Osari, S.; Nagata, K.; Kawaguchi, A. Influenza A Virus NS1 Protein Suppresses JNK1-Dependent Autophagosome Formation Mediated by Rab11a Recycling Endosomes. Front. Microbiol. 2018, 9, 3120. [Google Scholar] [CrossRef] [PubMed]
- Robb, N.C.; Chase, G.; Bier, K.; Vreede, F.T.; Shaw, P.C.; Naffakh, N.; Schwemmle, M.; Fodor, E. The influenza A virus NS1 protein interacts with the nucleoprotein of viral ribonucleoprotein complexes. J. Virol. 2011, 85, 5228–5231. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tian, W.; Li, W.; Chen, Y.; Yan, Z.; Huang, X.; Zhuang, H.; Zhong, W.; Chen, Y.; Wu, W.; Lin, C.; et al. Phosphorylation of ULK1 by AMPK regulates translocation of ULK1 to mitochondria and mitophagy. FEBS Lett. 2015, 589, 1847–1854. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Egan, D.F.; Shackelford, D.B.; Mihaylova, M.M.; Gelino, S.; Kohnz, R.A.; Mair, W.; Vasquez, D.S.; Joshi, A.; Gwinn, D.M.; Taylor, R.; et al. Phosphorylation of ULK1 (hATG1) by AMP-activated protein kinase connects energy sensing to mitophagy. Science 2011, 331, 456–461. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kim, J.; Kundu, M.; Viollet, B.; Guan, K.L. AMPK and mTOR regulate autophagy through direct phosphorylation of Ulk1. Nat. Cell Biol. 2011, 13, 132–141. [Google Scholar] [CrossRef] [Green Version]
- Meineke, R.; Rimmelzwaan, G.F.; Elbahesh, H. Influenza Virus Infections and Cellular Kinases. Viruses 2019, 11, 1568. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Moseley, C.E.; Webster, R.G.; Aldridge, J.R. Peroxisome proliferator-activated receptor and AMP-activated protein kinase agonists protect against lethal influenza virus challenge in mice. Influenza Other Respir. Viruses 2010, 4, 307–311. [Google Scholar] [CrossRef]
- Seong, R.K.; Kim, J.A.; Shin, O.S. Wogonin, a flavonoid isolated from Scutellaria baicalensis, has anti-viral activities against influenza infection via modulation of AMPK pathways. Acta Virol. 2018, 62, 78–85. [Google Scholar] [CrossRef]
- Vo, M.T.; Smith, B.J.; Nicholas, J.; Choi, Y.B. Activation of NIX-mediated mitophagy by an interferon regulatory factor homologue of human herpesvirus. Nat. Commun. 2019, 10, 3203. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, T.; Xue, L.; Li, L.; Tang, C.; Wan, Z.; Wang, R.; Tan, J.; Tan, Y.; Han, H.; Tian, R.; et al. BNIP3 Protein Suppresses PINK1 Kinase Proteolytic Cleavage to Promote Mitophagy. J. Biol. Chem. 2016, 291, 21616–21629. [Google Scholar] [CrossRef] [Green Version]
Gene | Primer-Forward | Primer-Reverse |
---|---|---|
IFV M1 | ATGAGYCTTYTAACCGAGGTCGAAACG | TGGACAAANCGTCTACGCTGCAG |
IFV PA | CGGTCCAAATTCCTGCTGAT | CATTGGGTTCCTTCCATCCA |
PINK1 | GGACACGAGACGCTTGCA | TTACCAATGGACTGCCCTATCA |
BNIP3 | CAGGGCTCCTGGGTAGAACT | CTACTCCGTCCAGACTCATGC |
BNIP3L | TTGGATGCACAACATGAATCAGG | TCTTCTGACTGAGAGCTATGGTC |
β-actin | GAGCACAGAGCCTCGCCTTT | ACATGCCGGAGCCGTTGTC |
siRNA | Sense | Antisense |
---|---|---|
PINK1 | CAGACAUCUGAAAAGUGAA | UUCACUUUUCAGAUGUCUG |
BNIP3 | GAGAGAAAAACAGCUCACA | UGUGAGCUGUUUUUCUCUC |
BNIP3L | CAGUUGACAGCGUUCUGAA | UUCAGAACGCUGUCAACUG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lee, J.-H.; Oh, S.-J.; Yun, J.; Shin, O.S. Nonstructural Protein NS1 of Influenza Virus Disrupts Mitochondrial Dynamics and Enhances Mitophagy via ULK1 and BNIP3. Viruses 2021, 13, 1845. https://0-doi-org.brum.beds.ac.uk/10.3390/v13091845
Lee J-H, Oh S-J, Yun J, Shin OS. Nonstructural Protein NS1 of Influenza Virus Disrupts Mitochondrial Dynamics and Enhances Mitophagy via ULK1 and BNIP3. Viruses. 2021; 13(9):1845. https://0-doi-org.brum.beds.ac.uk/10.3390/v13091845
Chicago/Turabian StyleLee, Jae-Hwan, Soo-Jin Oh, Jeanho Yun, and Ok Sarah Shin. 2021. "Nonstructural Protein NS1 of Influenza Virus Disrupts Mitochondrial Dynamics and Enhances Mitophagy via ULK1 and BNIP3" Viruses 13, no. 9: 1845. https://0-doi-org.brum.beds.ac.uk/10.3390/v13091845