One hundred and thirty six HCC cases were retrieved from the pathology archives of Toranomon Hospital, and 10 HCC cases were retrieved from the pathology archives of Teikyo University Hospital from 2003 to 2010. Clinical data, including age, sex, HBV or HCV infection, and Child-Pugh classification, were retrieved from the clinical files.

All cases of HCC were surgically resected. If multiple nodules were present in a patient, a single representative lesion was evaluated. Paraffin tissue sections were stained with hematoxylin-eosin, Masson, and reticulin. Histological slides were reviewed by two hepatopathologists (M.I. and T.F.). The results of the evaluation of the two pathologists did not differ considerably. If there were any minor differences of opinion, a final decision was made after discussion. For each tumor, the following variables were systematically recorded: tumor size, differentiation, pseudo-glandular formations, nuclear grade, tumor stage, presence of fatty change, inflammation, fibrosis and cholestasis. Tumor differentiation was evaluated according to WHO classification[15]. Nuclear grade was evaluated as grades 1-4 according to Armed Forces Institute of Pathology grading system[16] and classified as low-grade (grade 1 or 2) or high-grade (grade 3 or 4). Tumor stage was evaluated according to the General Rules for the Clinical and Pathological Study of Primary Liver Cancer in Japan[17]. Fatty change was defined by the presence of fat droplets in more than 10% of tumor cells. Inflammation was defined by the presence of focal or diffuse inflammatory infiltrate at 100× magnification. Fibrosis was defined by the presence of fibrous septa. Cholestasis was defined by the presence of bile pigment in tumor cells or dilated canaliculi. In addition, the non-tumorous liver tissue was evaluated and classified as normal liver, chronic hepatitis or liver cirrhosis.

For immunohistochemical staining, tissue microarrays of 146 cases of HCC were prepared using 3-mm tissue cores. Formalin-fixed paraffin-embedded tissue sections, cut at 3-μm thickness, were deparaffinized with xylene and rehydrated with graded ethanol. Immunohistochemistry was performed using Dako Autostaniner Link 48 (Dakocytomation, Glostrup, Denmark) and the following primary antibodies: L-FABP (polyclonal; Abcam, Cambridge, United Kingdom; 1:50 dilution), cytokeratin (CK) 7 (clone: OV-TL12/30; Dakocytomation; 1:60 dilution), CK 19 (clone: RCK108; Progen Biotechnik GmbH, Heidelberg, Germany; 1:60 dilution), β-catenin (clone: 14; BD biosciences, Franklin Lakes, NJ, United States; 1:100 dilution), glutamine synthetase (GS) (clone: GS-6; Merk Millipore, Billerica, MA, United States; 1:500 dilution) and serum amyloid A (SAA) (clone: 115; Abcam; 1:350 dilution). Both CK 7 and CK 19 are markers of cholangiocytes, β-catenin and GS are markers of β-HCA, and SAA is a marker of IHCA. After pretreatment, by heating in a water bath with citrate buffer (pH 6.0) for L-FABP, CK 19, β-catenin, GS, and SAA, and with ethylenediaminetetraacetic acid buffer (pH 9.0) for CK 7 at 98 °C for 40 min, endogenous peroxidase was quenched with 3% hydrogen peroxide in distilled water for 5 min. The slides were incubated with primary antibodies for 30 min at room temperature, and the sections were then stained by a detection method using EnVison^TM FLEX (Dakocytomation), according to the manufacturer’s protocol, and counterstained with hematoxylin.

After staining for L-FABP, the results were considered as positive if more than 5% of tumor cells stained positive. For each L-FABP-negative case of HCC, further immunohistochemical staining for L-FABP was performed using a representative whole-tissue section to confirm the downregulation of L-FABP expression and to assess the intratumoral downregulation pattern. In the evaluation of immunohistochemistry using whole-tissue sections, the staining was considered negative if the L-FABP labeling index was less than 5% in some tumor areas. In such cases, the downregulation pattern was considered as diffuse if the L-FABP labeling index was less than 5% in the whole tumor tissue, and it was considered as focal if the L-FABP labeling index was more than 5% in distinctive areas within the tumor. For CK 7 and CK 19, the staining was considered positive if more than 5% of tumor cells stained positive. For β-catenin, the staining was considered positive if the nuclei of the tumor cells stained positive, irrespective of the number of positive cells. For GS, the staining was considered positive if strong and diffuse expression was observed in the tumor tissue. For SAA, the staining was considered positive if more than 30% of tumor cells stained positive.

Clinicopathological features were compared between the L-FABP-negative and L-FABP-positive cases. We found that the immunohistochemical staining pattern for L-FABP tended to be different between smaller and larger HCCs; hence, we divided the cases into small (≤ 2 cm in diameter) and large (> 2 cm in diameter) HCC. In this study, we classified HCCs into small and large tumors using the above-mentioned standard, because tumor stage of HCC is classified using the same standard in the General Rules for the Clinical and Pathological Study of Primary Liver Cancer in Japan[17]. Actually, staging systems using the same standard have been reported to better reflect patients’ prognosis[18-20]. The ethics committee of Toranomon Hospital approved the overall design of the study.

To confirm downregulation of L-FABP expression in HCC in the in vitro system, we analyzed mRNA expression levels of the gene in six human HCC and two human cholangiocarcinoma cell lines by real-time reverse transcription polymerase chain reaction (real-time RT-PCR). We also analyzed mRNA expression levels of the GS gene using the same cell lines to confirm the correlation between L-FABP and GS expression. Six human HCC cell lines (HepG2, HuH7, PLC-PRF-5, Li-7, HLF, and HuH6) and two cholangiocarcinoma cell lines (HuCCT1 and RBE) were cultured, as previously described[21]. Total RNA was extracted from the eight cell lines using RNeasy Plus Mini kit (Qiagen, Valencia, CA, United States) and reverse transcribed using the QuantiTect Reverse Transcription kit (Qiagen). An Agilent 2100 Bioanalyzer (Agilent Technologies, Waldbronn, Germany) assessed the quality and quantity of the RNA samples. An ABI 7300 real-time PCR system and the Power SYBR Green PCR Master Mix kit (Life Technologies, Carlsbad, CA, United States) performed the quantitative real-time PCR. The primers for complementary DNA amplification of L-FABP, GS, and TATA box-binding protein (TBP) genes were as follows: L-FABP, (forward) GCTGGGTCCAAAGTGATCCA and (reverse) TGTCACCTTCCAACTGAACCA; GS, (forward) GGTACTGGAGAAGGACTGCG and (reverse) CCATCGAAATTCCACTCAGGC; TBP, (forward) ACCACGGCACTGATTTTCAGTT and (reverse) GCATATTTTCTTGCTGCCAGTCT. TBP was used as an internal control. All the samples were assayed in triplicate. Absolute quantification of the copy number of each gene was performed using a standard curve constructed with serially diluted control plasmids obtained by TA cloning from the PCR products of normal liver tissue. The expression level of TBP mRNA normalized the mRNA expression level of each gene.

Mutation analysis of HNF1A: We performed mutation analysis of HNF1A for all L-FABP-negative HCC tissues. After deparaffinization and rehydration, DNA extraction was performed using QIAamp DNA FFPE Tissue Kit (Qiagen), following the manufacturer’s protocol. In HCC cases with focal downregulation of L-FABP, DNA was extracted separately from the L-FABP-positive and L-FABP-negative areas. A mutation was detected in both L-FABP-negative and L-FABP-positive areas in one HCC case, and the non-tumorous liver tissue was also examined in that case. We chose to study exons 3 and 4 of HNF1A because more than half of the mutations are reported to occur in these exons in HCAs[10,22]. The primers used for the mutation analysis were as follows: exon 3, (forward) TCTGTGCCTGCAGAGTTCAC and (reverse) CACTAGCGTCTCTCGCTCCT; exon 4, (forward) AGGTGCGTGTCTACAACTGG and (reverse) CCTTGTCCCCACATACCACT. After PCR was performed using a Veriti Thermal Cycler (Life Technologies), the amplicons of these genes were directly sequenced using a 3130xl Genetic Analyzer (Life Technologies) to determine mutations.

Statistical analysis was performed for the 146 HCC cases. Patients’ age and tumor size are presented as mean ± SD. Student’s t-test was performed to assess the significance of differences for these variables. The Mann-Whitney U test was used to compare tumor differentiation, tumor stage, background liver tissue, and Child-Pugh classification. Other frequency and categorical data were compared using Fisher’s exact test. P values of < 0.05 were considered statistically significant.

We evaluated the clinicopathological characteristics of 146 cases of HCC (Table 1). Sixteen (10.9%) of the 146 cases tested negative for L-FABP after immunohistochemical staining of tissue microarrays (Figure 1A, B). For each L-FABP-negative HCC, further immunohistochemical staining for L-FABP was performed using a representative whole-tissue section to confirm the downregulation of L-FABP expression and to assess the intratumoral heterogeneity of the staining pattern. As a result, the absence of L-FABP expression was confirmed using the whole-tissue section for all 16 cases. Among the above-mentioned 16 L-FABP-negative cases, ten cases exhibited focal downregulation (Figure 1C), and six cases exhibited diffuse downregulation (Figure 1D). Non-tumorous hepatocytes were positive for L-FABP in all cases.

Open in New Tab   Full Size Figure   Download Figure

Figure 1 Immunohistochemical staining of liver fatty acid-binding protein in hepatocellular carcinoma. A: Representative liver fatty acid-binding protein (L-FABP)-negative case of hepatocellular carcinoma (HCC) identified by examination using tissue microarrays; B: Representative L-FABP-positive case of HCC identified by examination using tissue microarrays; C: Focal downregulation of L-FABP expression was observed in a case of small HCC (white arrows show the boundary between L-FABP-negative and L-FABP-positive areas, and black arrows show the boundary between tumorous and non-tumorous areas); D: Diffuse downregulation was observed in a case of large HCC (black arrows show the boundary between tumorous and non-tumorous areas).

When the correlation between the downregulation pattern of L-FABP expression and tumor size was examined, among the above-mentioned 16 L-FABP-negative cases, most small HCC cases (≤ 2 cm in diameter) exhibited focal downregulation, and most large HCC cases (> 2 cm in diameter) exhibited diffuse downregulation. The correlation was statistically significant (P = 0.036) (Table 2). In small HCCs, the L-FABP-negative area often corresponded to a “nodule-in-nodule” appearance. The downregulation pattern of L-FABP expression tended to be different between small and large HCC; therefore, we divided the cases into small and large HCC in subsequent analyses.

Table 3 shows the relationship between the expression of L-FABP and clinical features. Among patients with small HCC, those who were negative for L-FABP were significantly older than those who were positive for L-FABP (71.3 ± 7.6 years vs 63.4 ± 9.3 years, P = 0.009). Conversely, in cases of large HCC, L-FABP-negative patients were significantly younger than L-FABP-positive patients (54.6 ± 10.8 years vs 64.8 ± 10.7 years, P = 0.044). No significant correlations were observed between the expression of L-FABP and sex, viral infection, or Child-Pugh classification.

Table 4 shows the relationship between the expression of L-FABP and pathological features. Tumor differentiation was significantly poorer in L-FABP-negative small HCCs than in L-FABP-positive small HCCs (P = 0.032) (Figure 2A, B). All L-FABP-negative HCCs were moderately or poorly differentiated, irrespective of the tumor size. Furthermore, in small HCCs, the frequency of intratumoral inflammation was significantly lower in L-FABP-negative cases than in L-FABP-positive cases (P = 0.009) (Figure 2C, D). In large HCCs, no significant correlations were observed between the expression of L-FABP and the pathological features examined.

Open in New Tab   Full Size Figure   Download Figure

Figure 2 Pathological features of liver fatty acid-binding protein-negative and liver fatty acid-binding protein-positive cases of small hepatocellular carcinoma. A: Most liver fatty acid-binding protein (L-FABP)-negative cases of hepatocellular carcinoma (HCC) were moderately differentiated tumors; B: L-FABP-positive cases of HCC were often well differentiated tumors; C: Intratumoral inflammation was rare in L-FABP-negative cases of HCC; D: Intratumoral inflammation was often observed in L-FABP-positive cases of HCC (arrows) (hematoxylin and eosin stain).

Table 5 shows the relationship between the expression of L-FABP and the expression of other immunohistochemical markers. The frequency of positivity for β-catenin (Figure 3A, B) and GS (Figure 3C, D) was significantly higher in L-FABP-negative small HCCs than in L-FABP-positive small HCCs (P = 0.009 and P = 0.000, respectively). In large HCCs, no significant correlations were observed between the expression of L-FABP and the expression of other immunohistochemical markers.

Open in New Tab   Full Size Figure   Download Figure

Figure 3 Immunohistochemical features of liver fatty acid-binding protein-negative and liver fatty acid-binding protein-positive cases of small hepatocellular carcinoma. A: Intranuclear β-catenin was often expressed in liver fatty acid-binding protein (L-FABP)-negative cases of hepatocellular carcinoma (HCC); B: Intranuclear β-catenin was usually not expressed in L-FABP-positive cases of HCC; C: Glutamine synthetase (GS) was often positive in L-FABP-negative cases of HCC; D: GS was usually negative in L-FABP-positive cases of HCC.

Figure 4A, B show the expression levels of L-FABP and GS mRNA in each cell line, as determined by real-time RT-PCR. Among the six HCC cell lines examined, HepG2, HuH7, PLC, and HuH6 showed higher expression of L-FABP. However, Li-7 and HLF showed lower expression of L-FABP; in particular, L-FABP expression was almost undetectable in HLF. Expression levels of L-FABP were very low or undetectable in the two CC cell lines examined (HuCCT1 and RBE). No obvious correlation was observed between L-FABP and GS expression in HCC cell lines.

Open in New Tab   Full Size Figure   Download Figure

Figure 4 Expression levels of liver fatty acid-binding protein and glutamine synthetase mRNA in human hepatocellular carcinoma and cholangiocarcinoma cell lines. A: Among six hepatocellular carcinoma (HCC) cell lines examined, HepG2, HuH7, PLC, and HuH6 showed higher expression of liver fatty acid-binding protein (L-FABP). However, Li-7 and HLF showed lower expression of L-FABP. In particular, L-FABP expression was almost undetectable in HLF. Expression levels of L-FABP were very low in two CC cell lines examined (HuCCT1 and RBE); B: No obvious correlation was observed between L-FABP and glutamine synthetase expression in HCC cell lines.

Mutation of HNF1A in L-FABP-negative HCCs: We performed mutation analysis of exons 3 and 4 of HNF1A for the 16 L-FABP-negative HCC cases and found that two cases had mutations. Both of the cases showed focal downregulation of L-FABP. One case had a missense mutation (926C>T, P309L) only in the L-FABP-negative area (Figure 5). The other case had a frame-shift mutation (872_873delC, P291fs) in both the L-FABP-negative and L-FABP-positive tumor areas. In this case, the L-FABP labeling index in the L-FABP-positive tumor area was relatively low (approximately 10%). Mutations were not observed in the non-tumorous liver tissue in this case. The remaining 14 tumors had no mutations.

Open in New Tab   Full Size Figure   Download Figure

Figure 5 Mutation analysis of HNF1A. One liver fatty acid-binding protein (L-FABP)-negative hepatocellular carcinoma case had a missense mutation (926C>T, P309L), only in the L-FABP-negative tumor area.

Although the downregulation of liver fatty acid-binding protein (L-FABP) expression is critically important in the diagnostic classification of hepatocellular adenoma (HCA) and it is correlated with various clinicopathological features, the significance of the downregulation of L-FABP expression in hepatocellular carcinoma (HCC) is largely unknown.

In recent years, HCA has been divided into four subtypes, and immunohistochemical staining for L-FABP, β-catenin, glutamine synthetase, and serum amyloid A is critical for the pathological diagnosis of these four subtypes. Although the significance of these immunohistocehmical markers in HCA has been studied in detail, the significance of them, especially L-FABP in HCC, has not been studied in detail.

In the present study, the authors performed immunohistochemical staining for L-FABP in 146 cases of HCC. The authors found that, in small HCCs, L-FABP downregulation probably occurs because of phenotypic changes during tumor progression; furthermore, it was correlated with tumor differentiation and intratumoral inflammation.

By examining the significance of L-FABP downregulation in HCC, this study determined an aspect of the clinicopathological characteristics of HCC. This may lead to more accurate pathological diagnosis of HCC.

FABPs bind/sequester potentially toxic long-chain fatty acids in the cytosol so that they may be rapidly removed via oxidative or storage organelles. Mammals have a large family of FABPs, and L-FABP (or FABP1) was the first FABP described. It is expressed in very high levels in the liver, intestine and kidneys. FABP1 is positively regulated by HNF1α.

In this paper, the authors studied the significance of L-FABP expression in HCC using immunohistochemical staining. This study found that most of the small HCCs (≤ 2 cm in diameter) exhibited focal downregulation and most of the large HCCs (> 2 cm in diameter) exhibited diffuse downregulation. In small HCCs, L-FABP downregulation probably occurs because of phenotypic changes during tumor progression. Moreover, L-FABP downregulation was correlated with tumor differentiation and intratumoral inflammation. These topics are important for understanding tumor differentiation and intratumoral inflammation.