Data Release
Cold-water Coral Microbiomes (Primnoa spp.) from Gulf of Alaska, Baltimore Canyon, and Norfolk Canyon: Raw Data
By Christina A. Kellogg and Dawn B. Goldsmith
USGS, St. Petersburg, Florida
Summary
The files in this data release are the raw DNA sequence files referenced in the journal article by Goldsmith and others (2018) entitled “Comparison of microbiomes of cold-water corals Primnoa pacifica and Primnoa resedaeformis, with possible link between microbiome composition and host genotype.” They represent a 16S rRNA gene amplicon survey of the corals’ microbiomes (Primnoa spp.) completed using Roche 454 pyrosequencing with the Titanium series reagents. The 16S rRNA gene was amplified using primers for the V4–V5 region (fwd: 5′ AYTGGGYDTAAAGNG, rev: 5′ CCGTCAATTYYTTTRAGTTT). The data also include two 23S rRNA gene Sanger sequences from bacteria in the Chlamydiales order from the microbiomes of Alaskan Primnoa corals. The 23S rRNA gene was amplified using forward primer 5′ GATGCCTTGGCATTGATAGGCGATGAAGGA and reverse primer 5′ TGGCTCATCATGCAAAAGGCA. Samples from Baltimore Canyon (in the Atlantic Ocean) were collected in 2012. Samples from Norfolk Canyon (in the Atlantic Ocean) were collected in 2012–2013. Samples from the Gulf of Alaska (Tracy Arm Fjord) were collected in 2011–2012. The raw data files associated with this study have also been submitted to the NCBI Sequence Read Archive under Bioproject number PRJNA348705. The 23S sequences have been submitted to NCBI (GenBank) under accession numbers KY010287 and KY010288. For more information, please see the README file.
Goldsmith, D.B., Kellogg, C.A., Morrison C.L., Gray, M.A., Stone, R.P., Waller, R.G., Brooke, S.D., and Ross, S.W., 2018, Comparison of microbiomes of cold-water corals Primnoa pacifica and Primnoa resedaeformis, with possible link between microbiome composition and host genotype: Scientific Reports, v. 8, Art. 12383, https://doi.org/10.1038/s41598-018-30901-z.
Data
File Name and Description | Metadata (XML format) | Metadata (text format) | Download File |
---|---|---|---|
Primnoa_raw_data.zip Zip file containing raw data (.fna, .qual, .sff) and MIMARKS metadata. |
Cold_water_coral_microbiomes_ Primnoa_spp_from_ Gulf_of_Alaska_Baltimore_Canyon_ and_Norfolk_Canyon_raw_data.xml |
Cold_water_coral_microbiomes_ Primnoa_spp_from_ Gulf_of_Alaska_Baltimore_Canyon_ and_Norfolk_Canyon_raw_data.txt |
Primnoa_raw_data.zip (1.98 GB) |
Chlamydiales_23S.txt Text file containing two Sanger sequences |
Not applicable | Not applicable | Chlamydiales_23S.txt (1 KB) |
Supplemental information | |||
Primnoa_workflow.txt Details the scripts run in the bioinformatic package QIIME version 1.9.1 |
Not applicable | Not applicable | Primnoa_workflow.txt (42 KB) |
README_Primnoa.txt Readme file explaining data |
Not applicable | Not applicable | README_Primnoa.txt (7 KB) |
Primnoa3008_map.txt Mapping file to accompany sequencing files ID2UZ7K01.sff and ID2UZ7K02.sff |
Not applicable | Not applicable | Primnoa3008_map.txt (2 KB) |
Primnoaprim1_map.txt Mapping file to accompany sequencing files H8MF54001.sff and H8MF54002.sff |
Not applicable | Not applicable | Primnoaprim1_map.txt (3 KB) |
Suggested Citation
Kellogg, C.A., and Goldsmith, D.B., 2018, Cold-water coral microbiomes (Primnoa spp.) from Gulf of Alaska, Baltimore Canyon, and Norfolk Canyon—raw data: U.S. Geological Survey data release, https://doi.org/10.5066/F7P55KMJ.