Small extracellular vesicles derived from umbilical cord mesenchymal stem cells repair blood-spinal cord barrier disruption after spinal cord injury through down-regulation of Endothelin-1 in rats

Cell culture

The HUC-MSCs were purchased from Fuyuan Biotechnology (Fuyuan Biotechnology Co., Ltd. Shanghai, China). Cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Gibco, NY, USA) supplemented with 10% fetal bovine serum (FBS, Gibco, NY, USA) and 1% penicillin/streptomycin (Thermo Fisher Scientific, Waltham, MA, USA). Human brain microvascular endothelial cells (HBMECs) were purchased from Meisen Cell Technology (Meisen Cell Technology, Zhejiang, China). Cells were cultured in an endothelial cell medium (ScienCell Research Laboratories, San Diego, CA, USA) and incubated in a humidified atmosphere at 5% CO2 and 37 °C.

sEVs isolation and characterization

We adhered to the guidelines for the isolation, characterization, and functional analysis of EVs as stipulated in a consensus document published by the International Society of Extracellular Vesicles (Koeppen et al., 2021). Extracellular vesicles were harvested from passage (P) 3 to P5 of the hUC-MSCs. To isolate sEVs, the hUMSC-conditioned medium was first centrifuged at 500 g for 10 min to remove cells. Subsequently, the supernatant was centrifuged at 10,000 g for 30 min to eliminate apoptotic vesicles and other debris. The resulting liquid was then filtered through a 0.22 mm filter. The sEVs were then collected as a pellet using ultracentrifugation (Beckman Optima XPN, 45Ti) at 110,000 g for 70 min. The sEVs pellet was resuspended in phosphate-buffered saline (PBS) for purification and subjected to another round of ultracentrifugation at 110,000 g for 70 min to remove the contaminating proteins. Finally, the sEVs were resuspended in PBS. The Pierce BCA Protein Assay Kit (Thermo Fisher Scientific, Waltham, MA, USA) was used to assess the protein content of the sEVs. The hUC-MSCs-sEVs sample was stored at −80 °C for further analysis. The size of sEVs was determined by nanoparticle tracking analysis (NTA) using ZetaView S/N 17-310 (Particle Metrix, Meerbusch, Germany) along with its associated software. Additionally, transmission electron microscopy (TEM; JEOL Ltd., Tokyo, Japan) was used to morphologically examine isolated sEVs. Western blot analysis was utilized to determine the levels of CD63 (Abcam, Cambridge, UK) and TSG101 (Abcam, Cambridge, UK) in sEVs.

Experimental animals

All animal experimental protocols conformed to the Guide for the Care and Use of Laboratory Animals from the National Institutes of Health (NIH Publications (8023), and all procedures were approved by the Shanxi Provincial People’s Hospital Institutional Animal Care and Use Committee (Approval No. (2022-089). Adult female Sprague–Dawley rats weighing between 220 and 250 g were obtained from the Laboratory Animal Center of Shanxi Cancer Institute (animal production certificate # SCXK (Jin) 2017-0001; Shanxi, China). The entire experimental process was conducted at the same institution (animal usage certificate # SYXK (Jin) 2017-0003; Shanxi, China). Rats were housed in pathogen-free environments, with two to three animals per cage. They were provided with a standard commercial diet, had ad libitum access to water, and maintained under control humidity (40–60%) in a 12-hour light-dark cycle. After the assay, all the surviving animals were euthanized by an intraperitoneal injection of barbiturates at the Laboratory Animal Center of Shanxi Cancer Institute. The rats were randomly assigned to the following four groups: control (n = 20), SCI (n = 20), exo (n = 20), and ET-1 (n = 20) groups.

Spinal cord injury and treatment

Rats were anesthetized with 1% sodium pentobarbital (3 mL/kg, i.p.), and a median dorsal incision was performed at the T10 segment. The surrounding tissues were carefully dissected to expose the T10 vertebral body, spinous process, and spinal cord. The muscles were dissected layer by layer while preserving the integrity of the dura mater. In the sham-operated group, the wound was sutured layer by layer after sterilization. A spinal cord injury model was established using the modified Allen’s method for the remaining three groups. The spinal cord injury was created at the T10 level using a standardized force (10 g × 5 cm), and the successful modeling was confirmed by the presence of congestion, edema, double hind limb convulsions, and spastic tail swing at the site of injury in the spinal cord.

Treatment

Postoperatively, the ET-1 group was injected 10 µL (1 µg/mL) of ET-1 directly into the injured site using a microinjector. The wound was subsequently sutured layer by layer after rinsing with saline and disinfection. The Sham and SCI groups were administered 200 µL PBS solution in the tail vein immediately after injury and 1 and 2 days post-injury, while 40 µg sEVs (200 µg/mL) solution was administered to the sEVs and ET-1 groups. This dosage was chosen based on previous study with sEVs in rats (Zhang et al., 2015). All rats were given intraperitoneal penicillin (200,000 U/d) for 3 days, while their bladder was manually massaged twice or thrice daily to facilitate urination until the urinary function was restored.

Behavioral tests

The Basso, Beattie, and Bresnahan (BBB) ratings were used to assess the functional impairments following SCI. Two independent examiners blinded to the experimental groups evaluated the BBB scores on an open-field scale. Evaluations were performed at 1, 3, 5, 7, 14, and 21 days after surgery to monitor the progression of functional recovery in the rats.

Western blot analysis

For western blot analysis, spinal cord tissue was mixed with RIPA lysate, lysed on ice for 30 min, and then centrifuged at 15,000× g for 10 min at 4 °C. For protein analysis in vitro, HBMECs were lysed in RIPA buffer with protease and phosphatase inhibitors. The protein content of the supernatants was quantified using the PierceTM BCA protein assay kit (Thermo Fisher Scientific, Waltham, MA, USA), and the supernatant was collected for subsequent protein analysis. A 10% gel was used to separate equivalent quantities of 20 mg of protein, which were then transferred onto a polyvinylidene difluoride (PVDF) membrane (Merck Millipore, Darmstadt, Germany). Following blocking with 5% nonfat milk in TBS with 0.05% Tween 20 for 1 h, the membrane was incubated with primary antibodies against ZO-1 (61-7300; Thermo Fisher Scientific, Waltham, MA, USA), beta-catenin (ab32572, Abcam, Cambridge, UK), occluding (ab216327, Abcam, Cambridge, MA, USA), claudin-5 (352500; Santa Cruz Biotechnology, Inc., Dallas, TX, USA), MMP-2 (ab92536, Abcam, Cambridge, MA, USA), and MMP-9 (ab76003, Abcam, Cambridge, MA, USA) at 4 °C overnight (around 20 h). After three TBS-T washes, the membranes were incubated with the secondary antibodies for 1 h at room temperature. The protein bands were visualized using an automated gel imaging system (Bio-Rad ChemiDoc MP, Bio-Rad, Hercules, CA, USA), while the band densities were measured using ImageJ software. The relative density ratios normalized to the Sham or Control group were used to describe the findings.

Real-Time PCR

Spinal cord tissue samples were subjected to isopropanol precipitations after total RNA extraction using the RNAiso plus protocol (TaKaRa Bio Inc., Shiga, Japan). The extracted total RNA was used to synthesize first-strand cDNA. Quantitative reverse transcription-polymerase chain reaction (RT-PCR) was used to measure mRNA levels using SYBR Green fluorescent probes. The SYBR Green Master Mix (TaKaRa Bio Inc., Shiga, Japan) was added to each reverse-transcription product, and the reaction mixture was then subjected to amplification using a CFX96 Touch Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA).

The following primer pairs were used for amplification:

Prepro-ET-1 Forward: 5 ′-GTGAGAACGGCGGGGAGAAAC-3 ′

Reverse: 5 ′- AATGATGTCCAGGTGGCAGAAGTAG -3 ′

GAPDH: Forward: 5 ′-CTCTGATTTGGTCGTATTGGG-3 ′

Reverse: 5 ′-TGGAAGATGGTGATGGGA TT-3 ′

Serial dilutions of each amplicon were also amplified to generate standard curves for the quantification of the PCR products. The copy numbers of each PCR product, equal to 1 µg of total RNA, was used to calculate the quantity of mRNA. The prepro-ET-1 mRNA expression levels were normalized to GAPDH values.

Evans blue dye assays

Evans Blue Dye Assays were performed to assess BSCB permeability. A 2% Evans blue saline solution (two mL/kg) was administered into the tail vein of rats 7 days after SCI. After 2 h, the rats were anesthetized with 1% sodium pentobarbital (three mL/kg), and saline was perfused through the heart until clear fluid began to flow from the right atrium. A 1 cm segment of the injured spinal cord, centered around the injury site, was carefully dissected, weighed, and homogenized in a 50% trichloroacetic acid solution. The homogenate was then centrifuged at 10,000 g for 10 min, and the supernatant was collected. The absorbance of the sample was measured using a spectrophotometer (with an excitation wavelength of 620 nm and an emission wavelength of 680 nm). The established standard curve was used to determine the quantity of Evans dye present in the tissue (µg/g).

FITC- dextran assays

The rats received an intravenous injection of 2% FITC-dextran (MW 70 kDa, 4 mg/kg; Sigma-Aldrich, Burlington, MA, USA) solution in PBS via the tail vein 1 day after SCI. After 2 h, the rats were injected with 10% chloral hydrate, followed by perfusion with 0.9% normal saline. The FITC-dextran-damaged spinal cord tissues were weighed, homogenized in PBS, and centrifuged. The optical density of the supernatant was measured using a spectrophotometer at an excitation wavelength of 493 nm and an emission wavelength of 517 nm to assess the presence of FITC-dextran.

Oxygen–glucose deprivation/reoxygenation procedure

Oxygen–glucose deprivation/reoxygenation (OGD/R) procedures were conducted following previously established protocols (Sun et al., 2017). Briefly, cultivated HBMECs were washed thrice with PBS and then transferred to serum-free DMEM without glucose (Gibco, Life Technologies, USA). Subsequently, the HBMECs were subjected to oxygen-glucose deprivation (OGD) by placing them in an anaerobic chamber containing 1% O2, 5% CO2, and 94% N2 at 37 °C for 6 h. After being exposed to OGD for 6 h, the HBMECs were washed once with PBS and then incubated under normal conditions (reoxygenation) for 24 h.

Cell viability assay

Cell counting kit-8 (CCK-8) assay was used to assess cell viability. HBMECs were cultured in endothelial cell media and seeded in 96-well plates. After 1, 2, 3, 4, and 5 days of incubation, 10 µL of CCK-8 reagent (Dojindo, Japan) was added to the culture medium. A microplate reader (Bio-Rad 680, Hercules, CA, USA) was then used to measure the absorbance of each well at 450 nm.

Paracellular permeability assay

HBMECs were seeded overnight in a 200- µL medium at a density of 1 × 105 cells/well on Transwell permeable supports (PET membrane 24-well cell culture inserts with 0.4-µm pore size; Corelle; Corning Life Sciences, Corning, NY, USA). Subsequently, the cells were subjected to OGD for 6 h, followed by reoxygenation for 22 h (OGD6h/R22h). The cells were then exposed to media containing FITC-dextran (1 mg/ml) for 2 h. The amount of FITC-dextran passing through the Transwell (in the lower chambers) was determined using an enzyme-labeled meter with an excitation wavelength of 493 nm and an emission wavelength of 517 nm.

Statistical analysis

All the experiments were performed three times at least. All data are shown as mean ± standard deviation, and statistical analysis was performed in GraphPad Prism (version 8.0, GraphPad Software Inc., USA). One-way ANOVA followed by Tukey’s post hoc analysis was used for multiple comparisons. P-value < 0.05 was considered statistically significant.

hUC-MSCs-sEVs attenuate SCI-induced BSCB disruption

The successful isolation of the hUC-MSCs-sEVs was confirmed by TEM, which revealed their characteristic cup-shaped morphology (Fig. 1A). The hUC-MSCs-sEVs isolates were further identified using NTA, showing that particles with a diameter of 100 to 140 nm were the predominant populations (Fig. 1B). Western blot analysis of the sEVs lysates demonstrated significant positive bands for CD63 and TSG101, indicating the presence of exosomal markers, while GAPDH was employed as a control for purity (Fig. 1C).

The BBB scores were utilized to evaluate the functional recovery. Comparison of locomotor activity between the Exo group and the SCI Group 3–21 days post-injury revealed a remarkable improvement in locomotor function following sEVs therapy (Fig. 1D). Evaluation of BSCB integrity was performed using Evans blue and FITC-dextran fluorescence assays. hUC-MSCs-sEVs significantly reduced the fluorescence intensity of Evans blue in the injured spinal cord (Fig. 1E), and the penetration of FITC-dextran (Fig. 1F). Collectively, these findings demonstrate that hUC-MSCs-sEVs mitigate BSCB disruption in rats after SCI.

hUC-MSCs-sEVs reduce SCI-induced ET-1 expression

Previous studies demonstrated an increase in ET-1 levels in the spinal cord tissue of SCI rats, suggesting that excessive ET-1 production following SCI contributes to vasoconstriction, which is closely associated with spinal cord ischemia and hypoxia symptoms (A et al., 2019). Therefore, we examined the effects of hUC-MSCs-sEVs on SCI-induced ET-1 production. Our results revealed a significant increase in the expression of prepro-ET-1 mRNA and ET-1 peptide following SCI. However, the administration of hUC-MSCs-sEVs at 200 ug/day after SCI reduced the SCI-induced upregulation of prepro-ET-1 mRNA (Fig. 2A) and ET-1 peptide (Fig. 2B).

ET-1 is involved in the effects of hUC-MSCs-sEVs on SCI repair

To investigate the role of ET-1 in the cell neurological repair effects of hUC-MSCs-sEVs on the BSCB after SCI, ET-1 was administered at the injury site after SCI. Our results demonstrated that ET-1 injection significantly reduced the therapeutic effect of sEVs on motor activity 3-21 days post-SCI (Fig. 3A). Furthermore, at 24 h following SCI, Evans blue dye extravasation was assessed. The findings of the Evans blue dye (Fig. 3B) and Evans blue extravasation tests (Fig. 3C) revealed that ET-1 reversed the protective effect conferred by hUC-MSCs-sEVs. Additionally, FITC-dextran penetration, which was decreased by the administration of hUC-MSCs-sEVs, was significantly increased following ET-1 injection (Fig. 3D). According to the aforementioned data, hUC-MSCs-sEVs enhances functional recovery and lessens BSCB disruption following SCI via ET-1.

hUC-MSCs-sEVs increase the expression of junction proteins after SCI by downregulation of ET-1

We performed a Western blot analysis to examine whether hUC-MSCs-sEVs can protect the integrity of the BSCB by regulating tight junction proteins and adhesion junction proteins. Our results demonstrated a significant reduction in the expression levels of ZO-1, β-catenin, occludin, and claudin-5 following SCI. However, treatment with hUC-MSCs-sEVs attenuated these changes, thereby promoting the restoration of BSCB integrity. Notably, the therapeutic effect of sEVs was also significantly compromised upon ET-1 injection (Figs. 4A–4E). According to the aforementioned data, hUC-MSCs-sEVs enhances expression of cell junction proteins following SCI via downregulation of ET-1.

hUC-MSCs-sEVs decreases expression of inflammatory mediators in SCI rats by downregulation of ET-1

Previous studies have highlighted the crucial role of matrix metalloproteinase (MMP) in the recovery process following SCI (Yu et al., 2008). Notably, MMP-2 and MMP-9 are known to be modulated by ET-1 (He, Prasanna & Yorio, 2007; Wang et al., 2010). Therefore, we subsequently evaluated the levels of MMP-2 and MMP-9 to confirm that the impact of hUC-MSCs-sEVs therapy in SCI rats was caused by the reduced expression of ET-1. Western blot analysis revealed significantly elevated expression levels of MMP-2 and MMP-9 in SCI rats compared to the Sham group. However, the administration of hUC-MSCs-sEVs resulted in a significant decrease in MMP-2 and MMP-9 expression. The therapeutic effect of sEVs was reduced upon ET-1 injection (Figs. 5A–5C).

hUC-MSCs-sEVs increase the expression of junction proteins in HBMECs after OGD/R by downregulation of ET-1

To detect the effects of hUC-MSCs-sEVs on OGD/R-injured HBMECs, we conducted a series of experiments, including Western blot analysis, Cell Viability Assay, and Paracellular Permeability Assay. The expressions of junctional proteins, including Claudin-5, Occludin, beta-Catenin, and ZO-1, were significantly decreased in HCMECs subjected to OGD/R. However, the presence of hUC-MSCs-sEVs notably reversed this decrease in expression, and this therapeutic effect was reduced upon ET-1 administration (Figs. 6A–6E). Moreover, we detected that hUC-MSCs-sEVs significantly enhanced cell viability, whereas ET-1 exerted an inhibitory effect (Fig. 6F). To investigate the impact of OGD/R and ET-1 on the integrity of HBMECs, FITC-dextran was added to the cells. Our results confirmed that OGD/R significantly increased cell permeability, while hUC-MSCs-sEVs addition significantly attenuated this effect. Interestingly, the introduction of ET-1 significantly increased endothelial barrier permeability (Fig. 6G).