Next Article in Journal
Crop Species Production Diversity Enhances Revenue Stability in Low-Income Farm Regions of Mexico
Next Article in Special Issue
Molecular Markers and Their Applications in Marker-Assisted Selection (MAS) in Bread Wheat (Triticum aestivum L.)
Previous Article in Journal
Associations of Automatically Recorded Body Condition Scores with Measures of Production, Health, and Reproduction
Previous Article in Special Issue
Traditional and Conditional QTL Analysis of Kernel Size- and Shape-Related Traits in Wheat (Triticum aestivum L.)
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agriculture
Volume 12
Issue 11
10.3390/agriculture12111836
agriculture-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Broad-Spectrum Resistance to Leaf Rust in the Argentinean Wheat Cultivar “Klein Proteo” Is Controlled by LrKP Located on Chromosome 2BS

by
Shengsheng Bai
1,3,†,
Shuyong Pang
2,3,†,
Hongna Li
3,
Jinwei Yang
3,
Haitao Yu
4,
Shisheng Chen
1,3,* and
Xiaodong Wang
2,*
1
School of Advanced Agriculture Sciences, Peking University, Beijing 100871, China
2
State Key Laboratory of North China Crop Improvement and Regulation, College of Plant Protection, Hebei Agricultural University, Baoding 071000, China
3
Institute of Advanced Agricultural Sciences, Peking University, Weifang 261000, China
4
College of Agriculture, Xinjiang Agricultural University, Urumqi 830052, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Agriculture 2022, 12(11), 1836; https://0-doi-org.brum.beds.ac.uk/10.3390/agriculture12111836
Submission received: 25 August 2022 / Revised: 29 October 2022 / Accepted: 30 October 2022 / Published: 2 November 2022
(This article belongs to the Special Issue Molecular Markers and Marker-Assisted Breeding in Wheat)
Browse Figures
Review Reports Versions Notes

Abstract

:
Wheat leaf rust, caused by Puccinia triticina, is a severe fungal disease threatening global wheat production. The rational application of genetic loci controlling wheat resistance to leaf rust in breeding practice is still the best choice for disease control. A previous study indicated that the Argentinean wheat cultivar “Klein Proteo” might carry leaf rust resistance (Lr) genes Lr3a and Lr10, as well as an unknown Lr gene. In this study, seedlings of “Klein Proteo” showed high resistance to all the 20 Pt pathotypes isolated in China. Using bulked segregant RNA sequencing (BSR-seq) and developed CAPS markers, the single-dominant gene LrKP was initially mapped to a 114–168 Mb region on chromosome 2BS. Using gene-specific primers of a previously cloned chromosome 2BS-located Lr13 gene, we found that “Klein Proteo” also carried the Lr13 gene. Moreover, the expression of Lr13 in the resistant bulk was significantly higher than that in the susceptible bulk. Nevertheless, “Klein Proteo” showed a much broader and higher resistance compared with the near isogenic line and “ZhouMai 22” carrying Lr13. In conclusion, the wheat cultivar “Klein Proteo” showed great potential in the genetic improvement of wheat resistance to leaf rust in China and the genetic bases controlling the broad-spectrum resistance were initially revealed.

1. Introduction

Leaf rust, caused by Puccinia triticina (Pt), is a severe fungal disease on common wheat (Triticum aestivum L.). Worldwide, it occurs more frequently than other rust diseases [1]. Under favorable conditions, the yield loss caused by leaf rust can reach as high as 40% [2]. Considering the trends of global warming during the last decade, leaf rust has expanded its epidermic area to almost all the wheat-planting regions in China [3]. The rational utilization of resistant germplasms and genetic loci in breeding practice is still the most efficient way of controlling the disease.
Generally, there are two types of resistance to leaf rust: race-specific resistance and non-race-specific resistance [4]. Race-specific resistance, following the gene-for-gene theory, provides a high resistance to specific Pt pathotypes throughout the seedling and adult plant stages. Most of the cloned wheat leaf rust resistance (Lr) genes controlling race-specific resistance encode nucleotide-binding site-leucin-rich repeat (NBS-LRR) proteins, including Lr1, Lr10, Lr13, Lr21, Lr22a, and Lr42 [5,6,7,8,9]. As an exception, the cloned race-specific resistance Lr14a gene encodes a membrane-localized protein with 12 ankyrin (ANK) repeats and a Ca2+-permeable non-selective cation channels-like domain [10]. The non-race-specific resistance is normally functioning at adult plant stage of wheat, also referred as adult plant resistance (APR) or slow rusting. Currently, only two APR genes for leaf rust have been cloned, including Lr34 encoding an adenosine triphosphate-binding cassette (ABC) transporter and Lr67 encoding a hexose transporter [11,12].
Wheat chromosome 2BS is a hot zone carrying six formally designated Lr genes, including Lr13 [8,13], Lr16 [14], Lr23 [15], Lr35 [16], Lr48 [17], and Lr73 [18]. “Klein Proteo” (KP) is an Argentinean bread wheat cultivar. In a previous investigation, KP showed a high resistance toward most of the collected Argentinean leaf rust pathotypes (R:S = 14:3) at the seedling stage. Further gene postulation indicated that KP might carry Lr3a, Lr10, and an unknown Lr gene [19]. APR to wheat stripe rust was investigated in the recombinant inbred lines (RILs) developed from the cross between the “Klein Proteo” and another Argentinean cultivar “Klein Chajá”. A stripe rust resistance quantitative trait locus (QTL) on chromosome 4DL (QYr.ucw-4DL) from “Klein Proteo” explained approximately 9.7% of phenotypic variation in infection type and severity. Using gene-specific SNPs, QYr.ucw-4DL was proved not to be Lr67/Yr46, also on chromosome 4DL [20]. This study aims to clarify the features and genetic bases of leaf rust resistance in “Klein Proteo”.

2. Materials and Methods

2.1. Plant Materials and Leaf Rust Inoculation

As a previous gene postulation assay indicated that KP might carry Lr3a and Lr10 [19], seedlings of KP, the susceptible control “ZhengZhou 5389” (ZZ5389), near isogenic lines (NILs) carrying Lr3a, Lr3bg, Lr3ka, and Lr10 in the genetic background of “Thatcher”, were grown in the greenhouse and inoculated with leaf rust. On the other hand, as Lr13, Lr16, and Lr23 are seedling resistance genes located on chromosome 2BS, NILs carrying these Lr genes were also included in the inoculation test. Plants were spray-inoculated with urediospores of 20 Pt pathotypes (PHSS-1, PHSS-2, PHQS, FHSS, PHTS-1, KHSS, PHTS-2, TGTS, FHJQ, NHJS, FRJS, FGBS, PGJS, FHSS, THSP, SHJT, PHJS, FHGS, PHTT, and FHGQ) collected in China following a previously described method [21]. After inoculation, plants were grown in growth chambers at 20 °C during the day and 18 °C during the night with an 16 h light/8 h dark photoperiod. Disease symptoms were recorded at roughly 12 days post-inoculation (dpi) using a Cobb’s scale [22]. The resistant parental line KP was crossed with the susceptible parental line ZZ5389, the latter of which has been widely used in the construction of genetic populations studying wheat leaf rust resistance [8,23,24]. Segregation populations with 125 F2:3 lines and 114 F3:4 lines from the cross KP × ZZ5389 were inoculated with Pt pathotypes PHQS and PHSS-1, respectively.

2.2. Bulked Segregant RNA-Seq (BSR-Seq)

Based on the leaf rust phenotypes of 125 F2:3 lines, plants from 20 homozygous resistant lines and 20 homozygous susceptible lines were selected and combined as resistant (R)-bulk and susceptible (S)-bulk, respectively. RNAs were extracted using the Direct-zolTM RNA kits (Zymo Research Co., Ltd., Irvine, CA, USA). RNA-sequencing was conducted using Nova-PE150 sequencing strategy on an Illumina HiSeq 2000 platform by Novogene Co., Ltd. (Beijing, China). Raw sequencing data were deposited at the NCBI (https://www.ncbi.nlm.nih.gov, accessed on 29 October 2022) under the BioProject accession PRJNA895679. Raw reads were cleaned using Fastp software to trim off adapters and remove low-quality reads. Clean reads were aligned with the common wheat “Chinese Spring” reference genome RefSeq v1.0 [25] using STAR software [26]. Then, single nucleotide polymorphism (SNP) calling was performed on the confident read alignments using the “HaplotypeCaller” module in GATK software v3.7 [27]. QTLs were detected using the R package in QTLseqr software v0.6.4 as described by Mansfeld and Grumet [28]. A modified G statistic was calculated for each SNP based on the observed and expected allele depths, and further smoothed using a tricube smoothing kernel [29]. The G’ value of each SNP was calculated with a smoothing window size of 100 Mb to identify genomic regions with G’ peaks as possible QTLs/genes.

2.3. Development of Molecular Markers

Based on the BSR-seq results, SNPs closely linked to the target gene were selected to develop cleaved amplified polymorphic sequence (CAPS) markers. CAPS markers were designed following previously described method [30]. The NEBcutter v2.0 tool (http://www.labtools.us/nebcutter-v2-0/, accessed on 2 September 2022) was used to detect possible restriction sites at each SNP. Primer 3 website (https://bioinfo.ut.ee/primer3-0.4.0/primer3/, accessed on 2 September 2022) was used to design genome-specific primers to amplify sequences flanking the targeted SNPs. PCR products were sequenced to determine the existence of the SNPs. Corresponding restriction enzymes (New England BioLabs Inc., Ipswich, MA, USA) were used to digest the amplified PCR products.

2.4. PCR Validation of Lr Genes in KP

Molecular markers for leaf rust resistance genes Lr3 (Xmwg798) [31], Lr10 (Fl.2245/Lr10-6/r2) [32], and Lr13 (HBAU-Lr13) [8] were used to detect these genes in KP (Table S1). The diagnostic marker for Lr13 (HBAU-Lr13) was used to genotype the 114 F3:4 lines inoculated with Pt pathotype PHSS-1. ZM22 and NILs carrying Lr3, Lr10, and Lr13 were included as positive controls, whereas ZZ5389 as a negative control. The coding regions of the Lr13 gene were amplified from genomic DNA of KP using primers Lr13F1/R1 and Lr13F5/R6 (Table S1) [13].

2.5. Gene Expression Analysis

BSR-seq data were employed to evaluate the expressions of genes in R-bulk and S-bulk. Counts of clean reads were calculated using Kallisto software [33]. Differentially expressed genes (DEGs) were identified using edgeR software [34] following the parameters of p-value < 0.05 and |log2-foldchange| > 1. DEGs within the 114–168 Mb interval of chromosome 2B were analyzed and a heatmap was generated. Expressions of LrKP-interval DEGs were further estimated using transcripts per million (TPM) values collected from previous transcriptomic studies on the wheat leaf rust resistance genes Lr47 and Lr57 [35,36].

3. Results

3.1. Seedlings of “Klein Proteo” Showed High Resistance to Most of the Pt Pathotypes in China

Seedlings of KP, the susceptible control ZZ5389, Lr3a-NIL, Lr3bg-NIL, Lr3ka-NIL, Lr10-NIL, Lr13-NIL, Lr16-NIL, Lr23-NIL, and ZhouMai 22 (LrZH22/Lr13) were inoculated with 20 Pt pathotypes collected in China (Table 1). KP showed a high resistance to all the 20 Pt pathotypes. By contrast, ZZ5389, Lr3a-NIL, and Lr10-NIL were susceptible to most of the tested Pt pathotypes. As shown in Figure 1A, KP exhibited a typical hypersensitive response (HR) to a major Pt pathotype PHQS, whereas ZZ5389, Lr3-NILs, and Lr10-NIL were susceptible. To verify the presence of Lr3a and Lr10 genes in KP as indicated in a previous study [19], molecular markers specific for these genes were used to amplify genomic DNA of KP, ZZ5389, Lr3a-NIL, Lr3bg-NIL, Lr3ka-NIL, and Lr10-NIL. PCR results showed that KP carried Lr3bg (Figure 1B) and Lr10 (Figure 1C). All these data indicate that an unknown Lr gene in KP, but not Lr3 nor Lr10, might be responsible for the broad-spectrum resistance to leaf rust.

3.2. BSR-seq Analysis on “KP × ZZ5389” F2:3 Lines Revealed a Resistant Locus on Chromosome 2B

A genetic population was generated by crossing the resistant parental line KP with the susceptible parental line ZZ5389. A total of 125 F2:3 lines were inoculated with Pt pathotype PHQS. For the phenotypes of F2:3 lines, we identified 37 homozygous-resistant and 60 heterozygous- and 28 homozygous-susceptible lines (χ21:2:1 = 1.496). Another population consisting of 114 F3:4 lines from one selected segregating F3 families of “KP × ZZ5389” were challenged with the Pt pathotype PHSS-1. In this population, there were 30 homozygous-resistant and 55 heterozygous- and 29 homozygous-susceptible lines, fitting a ratio of 1:2:1 in Chi-squared test (χ21:2:1 = 0.158, Table S2). A further Pt inoculation test on 1054 individual plants from the progeny of 55 segregating F3:4 families resulted in 796 resistant plants and 258 susceptible ones, which also fits a 3:1 segregation ratio (χ2 = 0.153). These results indicate that leaf rust resistance to the Pt pathotypes PHQS and PHSS-1 in KP was controlled by a single dominant gene, temporally designated as LrKP.
To initially map the LrKP gene, RNA sequencing was applied on 20 selected homozygous resistant F2:3 lines (R-bulk) and 20 homozygous susceptible F2:3 lines (S-bulk). A BSR-seq analysis identified 5181 high-quality SNP variations between R-bulk and S-bulk. The G’ value for each SNP was calculated with a smoothing window size of 100 Mb and obvious G’ peaks were detected on chromosome 2B, indicating significant associations between these SNPs and disease resistant phenotypes (Figure 2A). We speculated that a major G’ peak located in the 100–600 Mb physical interval on chromosome 2B was possibly the region carrying LrKP.

3.3. LrKP Was Mapped to a 114–168 Mb Region on Chromosome 2BS Using the Designed CAPS Markers

Based on the BSR-seq results, six CAPS markers on chromosome 2BS, including Lrkp2B114 (located at 114 Mb), LrkpF299R300 (168 Mb), LrkpF286R286 (209 Mb), Lrkp197F2R2 (210 Mb), Lrkp2b01F4R4 (240 Mb), and Lrkp260F1R1 (260 Mb), were designed to verify the linkage between genotype and phenotype (Table 2). The 114 F3:4 lines were genotyped using these designed CAPS markers (Figure S1). As shown in Figure 2B, the CAPS marker LrkpF286R286 showed good polymorphism among the parental and homozygous F3:4 lines. A genetic map was constructed and the LrKP gene was initially mapped between the CAPS markers Lrkp2B114 and LrkpF299R300. The genetic distance between these two flanking markers was approximately 4.8 cM (Figure 3A). Based on the common wheat “Chinese Spring” reference genome v1.0, the physical positions of these CAPS markers were collected to generate a physical map, in which the LrKP gene was delimited to the 114–168 Mb region on chromosome 2BS (Figure 3B).

3.4. The Previously Cloned Lr13 Gene Located in the LrKP Interval

A total of six Lr genes, including Lr13, Lr16, Lr23, Lr35, Lr48, and Lr73, have been previously mapped to chromosome 2BS (Table S3). NILs carrying Lr13, Lr16, and Lr23, as well as ZhouMai 22 (ZM22) carrying Lr13, were also inoculated with those 20 Pt pathotypes (Table 1). Compared with Lr13-NIL, Lr16-NIL, Lr23-NIL, and ZM22, KP showed a much broader resistance to all the tested Pt pathotypes. Meanwhile, chromosome distributions of Lr13, Lr16, Lr23, Lr48, and Lr73 were profiled based on locations of their co-segregated or flanking markers in “Chinese Spring” reference genome v1.0 (Figure 3C). Only Lr13 (157 Mb) was located within the LrKP interval (114–168 Mb).
The diagnostic marker for Lr13 (HBAU-Lr13) was initially employed to verify the existence of this gene in KP. PCR and restriction enzyme digest results showed good polymorphism among the parental and selected F3:4 lines (Figure 4). When genotyping the 114 F3:4 lines with marker HBAU-Lr13, we found that this marker was completely linked to the LrKP region. The coding regions of the Lr13 gene were partially amplified from genomic DNA of KP using the gene-specific primers Lr13F1/R1 and Lr13F5/R6 (Figure S2). PCR products were sequenced, and the deduced sequences were identical to the corresponding segments of the cloned Lr13.

3.5. Lr13 Was Identified as a Differentially Expressed Gene (DEG) in the LrKP Interval

DEGs between R-bulk and S-bulk were analyzed using clean reads from the BSR-seq assay. A total of 907 DEGs (p-value < 0.05 and |log2-foldchange| > 1) were identified, including 189 up-regulated DEGs and 718 down-regulated DEGs. There were only 12 DEGs in the LrKP interval (114–168 Mb) on chromosome 2BS (Table S4). Among these 12 DEGs, only TraesCS2B02G182800, which was an orthologue of the cloned Lr13 gene, encoded an NBS-LRR protein. The expression of TraesCS2B02G182800 in R-bulk was significantly higher than that in S-bulk (Figure 5). We also profiled the expressions of all these 12 LrKP-interval DEGs in the Lr47- and Lr57-mediated resistance (Figure S3). Certain DEGs were also differentially expressed upon leaf rust infection in association with Lr47 or Lr57, except for the Lr13 gene. All these results indicate that Lr13 was specifically induced and might function in KP upon rust infection.

4. Discussion

In the seedling inoculation assay, KP conferred high resistance to all the 20 Pt pathotypes in China (Table 1). Vanzetti et al. reported that seedlings of KP showed high resistance to 14 Pt pathotypes and susceptible to only three Pt pathotypes in Argentina [19]. All these data indicated that KP might be a valuable global germplasm for the genetic improvement of wheat resistance to leaf rust fungus. In addition, Vanzetti et al. also postulated the existence of Lr3a, Lr10, and an unknown Lr gene in KP.
The Lr3 locus was located on chromosome 6BL, including three alleles as Lr3a, Lr3bg, and Lr3ka [37]. Since Lr3 has not been cloned yet, it is a great challenge to distinguish different alleles of Lr3. The fragment length polymorphism (RFLP) marker Xmwg798 was co-segregated with the Lr3a allele in the common wheat cultivar “Sinvalocho MA” [38]. Künzel et al. then converted this RFLP marker to a PCR-based STS marker with the same name of Xmwg798 as an allele-specific one [39]. In this case, based on the amplification results in Figure 1B, we confirmed that KP was more likely to carry a Lr3bg allele, but not Lr3a. Lr10 is a typical race-specific resistance gene encoding a nucleotide-binding site leucine-rich repeat (NBS-LRR) protein [5]. The gene-specific STS marker Fl.2245/Lr10-6/r2 has been widely used for the identification of Lr10 [32]. Based on the PCR validation result in Figure 1C, we proved that KP indeed carried Lr10. Nevertheless, NILs carrying Lr3a, Lr3bg, Lr3ka, and Lr10 partially or completely lost their resistance to the 20 inoculated Pt pathotypes (Table 1), indicating that the broad spectrum and high resistance in KP might be controlled by unknown Lr genes.
Using BSR-seq analysis, LrKP was initially mapped to 114–168 Mb region on chromosome 2BS (Figure 2 and Figure 3). In previous investigations, a total of six Lr genes, including Lr13 [8,13], Lr16 [14], Lr23 [15], Lr35 [16], Lr48 [17], and Lr73 [18], have been mapped to chromosome 2BS (Figure 3 and Table S3). Among them, Lr35 was an APR gene originally introgressed from Triticum speltoides [16]. Using the co-segregation marker BCD260F1/35R2 for Lr35, we did not detect Lr35 in KP. NILs carrying Lr16 and Lr23 have lost their resistance to most of the 20 tested Pt pathotypes (Table 1). Moreover, the chromosome locations of Lr16, Lr23, Lr48, and Lr73 (3.5–93 Mb) were different from that of the mapped LrKP (114–168 Mb).
On the contrary, the other chromosome 2BS-located leaf rust resistance gene Lr13 was detected and highly expressed in KP (Figure 4, Figure 5 and Figure S2). The cloned Lr13 encoded a typical NBS-LRR protein [8,13]. Lr13 was initially considered as an APR gene and the NIL carrying Lr13 was susceptible to most of Pt pathotypes in China [40]. The Lr13-mediated seedling resistance seemed to be associated with moderately high temperature (25 °C), which was different from the LrKP-mediated resistance presented at normal temperature (18–20 °C). Moreover, this gene showed a different strength in resistance in different genetic background. For instance, the donor material for the gene cloning of Lr13, ZM22, showed a much broader and stronger resistance to various Pt pathotypes than Lr13-NIL (Table 1). Nevertheless, in the parallel leaf rust inoculation assay, KP showed an even more broad-spectrum resistance to all the Pt pathotypes than ZM22 (Table 1). This phenomenon might result from the altered resistance conferred by Lr13 in the genetic background of KP with Lr3bg and Lr10. On the other hand, LrKP might be a novel broad-spectrum resistance gene on chromosome 2BS closely linked with Lr13 that did not segregate with each other in our limited sample sizes of mapping populations.

5. Conclusions

In conclusion, the Argentinean wheat cultivar “Klein Proteo” showed a high resistance to 20 collected Puccinia triticina pathotypes in China, including the major pathotypes of PHTT, PHTS, and PHSS. A single-dominant LrKP gene, but not the detected Lr3 or Lr10, was responsible for the broad-spectrum resistance to leaf rust. Using BSR-seq analysis, LrKP was initially mapped to 114–168 Mb region on chromosome 2BS. The Lr13 gene was detected and highly expressed in “Klein Proteo”, but this Argentinean wheat cultivar showed much broader and higher resistance than the near isogenic line and “ZhouMai 22” carrying Lr13. “Klein Proteo” has a great potential in the genetic improvement of wheat resistance to leaf rust in China. The designated LrKP and its relationship with Lr13 remain to be explored.

Supplementary Materials

The following supporting information can be downloaded at: https://0-www-mdpi-com.brum.beds.ac.uk/article/10.3390/agriculture12111836/s1, Figure S1: CAPS markers were developed based on BSR-seq analysis and employed to initially map the LrKP gene; Figure S2: PCR amplification of the coding regions of the Lr13 gene in “Klein Proteo”; Figure S3: Expression profiles of LrKP-interval DEGs during Lr47- and Lr57-mediated wheat resistance to leaf rust; Table S1: Primers used for identification of Lr genes in the wheat cultivar “Klein Proteo”; Table S2: Segregation of seedling reactions to the Pt pathotype PHQS in “Klein Proteo”, “ZhengZhou 5389”, and their selected F3:4 lines; Table S3: Information of designated Lr genes on chromosome 2BS; Table S4: Information of 12 DEGs in the 114–168 Mb interval on chromosome 2B.

Author Contributions

S.B. and S.P. performed most of the experimental work. H.L., J.Y. and H.Y. contributed the primers development and data analysis. S.B. wrote the first version of the manuscript. S.C. and X.W. proposed and supervised the project, obtained the funding, and generated the final version of the paper. All authors reviewed and commented on the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

Work at XW lab was supported by the Outstanding Youth Fund of Hebei Natural Science Foundation (C2022204010), Provincial Natural Science Foundation of Hebei (C2021204008), State Key Laboratory of North China Crop Improvement and Regulation (NCCIR2021ZZ-4). Work at SC lab was supported by the Provincial Natural Science Foundation of Shandong (ZR2021MC056 and ZR2021ZD30) and the Open Project Funding of the State Key Laboratory of Crop Stress Adaptation and Improvement.

Institutional Review Board Statement

Not applicable.

Data Availability Statement

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Bolton, M.; Kolmer, J.; Garvin, D. Wheat leaf rust caused by Puccinia triticina. Mol. Plant Pathol. 2008, 9, 563–575. [Google Scholar] [CrossRef]
  2. Herrera-Foessel, S.A.; Singh, R.P.; Huerta-Espino, J.; Crossa, J.; Yuen, J.; Djurle, A. Effect of leaf rust on grain yield and yield traits of durum wheats with race-specific and slow-rusting resistance to leaf rust. Plant Dis. 2006, 90, 1065–1072. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  3. Liu, Y.A.; Twga, B.; Zhang, P.; Li, Z.F.; Liu, D. Identification of leaf rust resistance genes in common wheat varieties from China and foreign countries. J. Integr. Agric. 2021, 20, 1302–1313. [Google Scholar] [CrossRef]
  4. Figueroa, M.; Hammond-Kosack, K.E.; Solomon, P.S. A review of wheat diseases-a field perspective. Mol. Plant Pathol. 2018, 19, 1523–1536. [Google Scholar] [CrossRef] [PubMed]
  5. Feuillet, C.; Travella, S.; Stein, N.; Albar, L.; Nublat, A.; Keller, B. Map-based isolation of the leaf rust disease resistance gene Lr10 from the hexaploid wheat (Triticum aestivum L.) genome. Proc. Natl. Acad. Sci. USA 2003, 100, 15253–15258. [Google Scholar] [CrossRef] [Green Version]
  6. Huang, L.; Brooks, S.A.; Li, W.; Fellers, J.P.; Trick, H.N.; Gill, B.S. Map-based cloning of leaf rust resistance gene Lr21 from the large and polyploid genome of bread wheat. Genetics 2003, 164, 655–664. [Google Scholar] [CrossRef]
  7. Thind, A.K.; Wicker, T.; Šimková, H.; Fossati, D.; Moullet, O.; Brabant, C.; Vrána, J.; Doležel, J.; Krattinger, S.G. Rapid cloning of genes in hexaploid wheat using cultivar-specific long-range chromosome assembly. Nat. Biotechnol. 2017, 35, 793–796. [Google Scholar] [CrossRef] [Green Version]
  8. Yan, X.; Li, M.; Zhang, P.; Yin, G.; Zhang, H.; Gebrewahid, T.W.; Zhang, J.; Dong, L.; Liu, D.; Liu, Z.; et al. High-temperature wheat leaf rust resistance gene Lr13 exhibits pleiotropic effects on hybrid necrosis. Mol. Plant 2021, 14, 1029–1032. [Google Scholar] [CrossRef]
  9. Lin, G.; Chen, H.; Tian, B.; Sehgal, S.K.; Singh, L.; Xie, J.; Rawat, N.; Juliana, P. Cloning of the broadly effective wheat leaf rust resistance gene Lr42 transferred from Aegilops tauschii. Nat. Commun. 2022, 13, 3044. [Google Scholar] [CrossRef]
  10. Kolodziej, M.C.; Singla, J.; Sánchez-Martín, J.; Zbinden, H.; Šimková, H.; Karafiátová, M.; Doležel, J.; Gronnier, J.; Poretti, M.; Glauser, G.; et al. A membrane-bound ankyrin repeat protein confers race-specific leaf rust disease resistance in wheat. Nat. Commun. 2021, 12, 956. [Google Scholar] [CrossRef]
  11. Krattinger, S.G.; Lagudah, E.S.; Spielmeyer, W.; Singh, R.P.; Huerta-Espino, J.; Mcfadden, H.; Bossolini, E.; Selter, L.L.; Keller, B. A putative ABC transporter confers durable resistance to multiple fungal pathogens in wheat. Science 2009, 323, 1360–1363. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  12. Moore, J.W.; Herrera-Foessel, S.; Lan, C.; Schnippenkoetter, W.; Ayliffe, M.; Huerta-Espino, J.; Lillemo, M.; Viccars, L.; Milne, R.; Periyannan, S.; et al. A recently evolved hexose transporter variant confers resistance to multiple pathogens in wheat. Nat. Genet. 2015, 47, 1494–1498. [Google Scholar] [CrossRef]
  13. Hewitt, T.; Zhang, J.; Huang, L.; Upadhyaya, N.; Li, J.; Park, R.; Hoxha, S.; McIntosh, R.; Lagudah, E.; Zhang, P. Wheat leaf rust resistance gene Lr13 is a specific Ne2 allele for hybrid necrosis. Mol. Plant 2021, 14, 4. [Google Scholar] [CrossRef] [PubMed]
  14. Kassa, M.T.; You, F.M.; Hiebert, C.W.; Pozniak, C.J.; Fobert, P.R.; Sharpe, A.G.; Menzies, J.G.; Humphreys, D.G.; Harrison, N.R.; Fellers, J.P.; et al. Highly predictive SNP markers for efficient selection of the wheat leaf rust resistance gene Lr16. BMC Plant Biol. 2017, 17, 45. [Google Scholar] [CrossRef] [Green Version]
  15. Chhetri, M.; Bariana, H.; Wong, D.; Sohail, Y.; Hayden, M.; Bansal, U. Development of robust molecular markers for marker-assisted selection of leaf rust resistance gene Lr23 in common and durum wheat breeding programs. Mol. Breed. 2017, 37, 21. [Google Scholar] [CrossRef]
  16. Seyfarth, R.; Feuillet, C.; Schachermayr, G.; Winzeler, M.; Keller, B. Development of a molecular marker for the adult plant leaf rust resistance gene Lr35 in wheat. Theor. Appl. Genet. 1999, 99, 554–560. [Google Scholar] [CrossRef]
  17. Nsabiyera, V.; Qureshi, N.; Bariana, H.S.; Wong, D.; Forrest, K.L.; Hayden, M.J.; Bansal, U.K. Molecular markers for adult plant leaf rust resistance gene Lr48 in wheat. Mol. Breed. 2016, 36, 65. [Google Scholar] [CrossRef]
  18. Park, R.F.; Mohler, V.; Nazari, K.; Singh, D. Characterisation and mapping of gene Lr73 conferring seedling resistance to Puccinia triticina in common wheat. Theor. Appl. Genet. 2014, 127, 2041–2049. [Google Scholar] [CrossRef]
  19. Vanzetti, L.S.; Campos, P.; Demichelis, M.; Lombardo, L.A.; Aurelia, P.R.; Vaschetto, L.M.; Bainottl, C.T.; Helguera, M. Identification of leaf rust resistance genes in selected Argentinean bread wheat cultivars by gene postulation and molecular markers. Electron. J. Biotechnol. 2011, 14, 9. [Google Scholar] [CrossRef]
  20. Cobo, N.; Pflüger, L.; Chen, X.; Dubcovsky, J. Mapping QTL for resistance to new virulent races of wheat stripe rust from two Argentinean wheat cultivars. Crop Sci. 2018, 58, 2470–2483. [Google Scholar] [CrossRef]
  21. Zhao, J.; Bi, W.; Zhao, S.; Su, J.; Li, M.; Ma, L.; Yu, X.; Wang, X. Wheat apoplast-localized lipid transfer protein TaLTP3 enhances defense responses against Puccinia triticina. Front. Plant Sci. 2021, 12, 771806. [Google Scholar] [CrossRef]
  22. Roelfs, A.P.; Singh, R.P.; Saari, E.E. Rust Diseases of Wheat: Concepts and Methods of Disease Management; CIMMYT: Batan, Mexico, 1992; p. 43. [Google Scholar]
  23. Zhou, H.; Xia, X.; He, Z.; Li, X.; Wang, C.; Li, Z.; Liu, D. Molecular mapping of leaf rust resistance gene LrNJ97 in Chinese wheat line Neijiang 977671. Theor. Appl. Genet. 2013, 126, 2141–2147. [Google Scholar] [CrossRef]
  24. Gebrewahid, T.W.; Zhang, P.; Zhou, Y.; Yan, X.; Xia, X.; He, Z.; Liu, D.; Li, Z. QTL mapping of adult plant resistance to stripe rust and leaf rust in a Fuyu 3/Zhengzhou 5389 wheat population. Ther. Crop J. 2020, 8, 655–665. [Google Scholar] [CrossRef]
  25. The International Wheat Genome Sequencing Consortium. Shifting the limits in wheat research and breeding using a fully annotated reference genome. Science 2018, 361, eaar7191. [Google Scholar] [CrossRef] [Green Version]
  26. Dobin, A.; Davis, C.A.; Schlesinger, F.; Drenkow, J.; Zaleski, C.; Jha, S.; Batut, P.; Chaisson, M.; Gingeras, T.R. STAR: Ultrafast universal RNA-seq aligner. Bioinformatics 2013, 29, 15–21. [Google Scholar] [CrossRef]
  27. Van der Auwera, G.A.; Carneiro, M.O.; Hartl, C.; Poplin, R.; Del Angel, G.; Levy-Moonshine, A.; Jordan, T.; Shakir, K.; Roazen, D.; Thibault, J.; et al. From FastQ data to high-confidence variant calls: The genome analysis toolkit best practices pipeline. Curr. Bioinform. 2013, 43, 11101–111033. [Google Scholar]
  28. Mansfeld, B.N.; Grumet, R. QTLseqr: An R package for bulk segregant analysis with next-generation sequencing. Plant Genome 2018, 11, 180006. [Google Scholar] [CrossRef] [Green Version]
  29. Imerovski, I.; Dedić, B.; Cvejić, S.; Miladinović, D.; Jocić, S.; Owens, G.L.; Tubić, N.K.; Rieseberg, L.H. BSA-seq mapping reveals major QTL for broomrape resistance in four sunflower lines. Mol. Breed. 2019, 39, 41. [Google Scholar] [CrossRef]
  30. Konieczny, A.; Ausubel, F.M. A procedure for mapping Arabidopsis mutations using co-dominant ecotype-specifc PCR-based markers. Plant J. 1993, 4, 403–410. [Google Scholar] [CrossRef]
  31. Herrera-Foessel, S.A.; Singh, R.P.; Huerta-Espino, J.; William, M.; Rosewarne, G.; Djurle, A.; Yuen, J. Identification and mapping of Lr3 and a linked leaf rust resistance gene in durum wheat. Crop Sci. 2007, 47, 1459–1466. [Google Scholar] [CrossRef] [Green Version]
  32. Schachermayr, G.; Feuillet, C.; Keller, B. Molecular markers for the detection of the wheat leaf rust resistance gene Lr10 in diverse genetic backgrounds. Mol. Breed. 1997, 3, 65–74. [Google Scholar] [CrossRef]
  33. Bray, N.L.; Pimentel, H.; Melsted, P.; Pachter, L. Near-optimal probabilistic RNA-seq quantification. Nat. Biotechnol. 2016, 34, 525–527. [Google Scholar] [CrossRef] [PubMed]
  34. Robinson, M.D.; McCarthy, D.J.; Smyth, G.K. edgeR: A Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 2010, 26, 139–140. [Google Scholar] [CrossRef] [Green Version]
  35. Wu, J.; Gao, J.; Bi, W.; Zhao, J.; Yu, X.; Li, Z.; Liu, D.; Liu, B.; Wang, X. Genome-wide expression profiling of genes associated with the Lr47-mediated wheat resistance to leaf rust (Puccinia triticina). Int. J. Mol. Sci. 2019, 20, 4498. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  36. Yadav, I.S.; Sharma, A.; Kaur, S.; Nahar, N.; Bhardwaj, S.C.; Sharma, T.R.; Chhuneja, P. Comparative temporal transcriptome profiling of wheat near isogenic line carrying Lr57 under compatible and incompatible interactions. Front. Plant Sci. 2016, 7, 1943. [Google Scholar] [CrossRef] [Green Version]
  37. Haggag, M.E.A.; Dyck, P.L. The inheritance of leaf rust resistance in four common wheat varieties possessing genes at or near the Lr3 locus. Can. J. Genet. Cytol. 1973, 15, 127–134. [Google Scholar] [CrossRef]
  38. Sacco, F.; Suárez, E.Y.; Naranjo, T. Mapping of the leaf rust resistance gene Lr3 on chromosome 6B of Sinvalocho Ma wheat. Genome 1998, 41, 686–690. [Google Scholar] [CrossRef]
  39. Künzel, G.; Korzun, L.; Meister, A. Cytologically integrated physical Restriction Fragment Length Polymorphism maps for the barley genome based on translocation breakpoints. Genetics 2000, 154, 397–412. [Google Scholar] [CrossRef]
  40. Gebrewahid, T.W.; Yao, Z.J.; Yan, X.C.; Gao, P.; Li, Z.F. Identification of leaf rust resistance genes in Chinese common wheat cultivars. Plant Dis. 2017, 101, 1729–1737. [Google Scholar] [CrossRef]
Agriculture 12 01836 g001 550
Figure 1. An unknown Lr gene in “Klein Proteo” conferred broad-spectrum resistance to leaf rust. (A) Phenotypes of wheat lines to Pt pathotype PHQS. R: resistance, S: susceptible. (B) PCR validation of Lr3 in “Klein Proteo”. (C) PCR validation of Lr10 in “Klein Proteo”. M: DNA marker DL2000, 1: Lr3a-NIL, 2: Lr3bg-NIL, 3: Lr3ka-NIL, 4: Lr10-NIL, 5: ZhengZhou 5389, 6: Klein Proteo.
Figure 1. An unknown Lr gene in “Klein Proteo” conferred broad-spectrum resistance to leaf rust. (A) Phenotypes of wheat lines to Pt pathotype PHQS. R: resistance, S: susceptible. (B) PCR validation of Lr3 in “Klein Proteo”. (C) PCR validation of Lr10 in “Klein Proteo”. M: DNA marker DL2000, 1: Lr3a-NIL, 2: Lr3bg-NIL, 3: Lr3ka-NIL, 4: Lr10-NIL, 5: ZhengZhou 5389, 6: Klein Proteo.
Agriculture 12 01836 g001
Agriculture 12 01836 g002 550
Figure 2. BSR-seq analysis revealed a leaf-rust-resistant locus on chromosome 2BS in “Klein Proteo”. (A) Distribution of SNPs associated with leaf rust resistance was revealed by BSR-seq. (B) Validation of associated SNPs using the designed CAPS marker LrkpF286R286. M: DNA marker DL2000, 1: Klein Proteo, 2: ZhengZhou 5389, 3–7: homozygous-resistant lines, 8–12: homozygous-susceptible lines.
Figure 2. BSR-seq analysis revealed a leaf-rust-resistant locus on chromosome 2BS in “Klein Proteo”. (A) Distribution of SNPs associated with leaf rust resistance was revealed by BSR-seq. (B) Validation of associated SNPs using the designed CAPS marker LrkpF286R286. M: DNA marker DL2000, 1: Klein Proteo, 2: ZhengZhou 5389, 3–7: homozygous-resistant lines, 8–12: homozygous-susceptible lines.
Agriculture 12 01836 g002
Agriculture 12 01836 g003 550
Figure 3. Genetic and physical maps of LrKP. (A) Genetic map of LrKP was generated based on linkage between phenotypes of 114 F3:4 lines and genotypes using six developed CAPS markers. The LrKP gene was mapped between two flanking CAPS markers Lrkp2B114 and LrkpF299R300 on chromosome 2BS. (B) Physical positions of CAPS markers were collected from the “Chinese Spring” reference genome v1.0. The LrKP gene was mapped to the 114–168 Mb region on chromosome 2BS. (C) Physical positions of known Lr genes located on chromosome 2BS were estimated based on locations of their co-segregated or flanking markers in the “Chinese Spring” reference genome v1.0.
Figure 3. Genetic and physical maps of LrKP. (A) Genetic map of LrKP was generated based on linkage between phenotypes of 114 F3:4 lines and genotypes using six developed CAPS markers. The LrKP gene was mapped between two flanking CAPS markers Lrkp2B114 and LrkpF299R300 on chromosome 2BS. (B) Physical positions of CAPS markers were collected from the “Chinese Spring” reference genome v1.0. The LrKP gene was mapped to the 114–168 Mb region on chromosome 2BS. (C) Physical positions of known Lr genes located on chromosome 2BS were estimated based on locations of their co-segregated or flanking markers in the “Chinese Spring” reference genome v1.0.
Agriculture 12 01836 g003
Agriculture 12 01836 g004 550
Figure 4. PCR validation of Lr13 in “Klein Proteo”. Lr13-gene-specific CAPS marker HBAU-Lr13 was employed to detect Lr13 in KP. M: DNA marker DL2000, 1: ZhouMai 22, 2: Chinese Spring, 3: Klein Proteo, 4: ZhengZhou 5389, 5–8: homozygous susceptible lines of “KP × ZZ5389” F3:4 population; 9–12: heterozygous lines; 13–16: homozygous resistant lines.
Figure 4. PCR validation of Lr13 in “Klein Proteo”. Lr13-gene-specific CAPS marker HBAU-Lr13 was employed to detect Lr13 in KP. M: DNA marker DL2000, 1: ZhouMai 22, 2: Chinese Spring, 3: Klein Proteo, 4: ZhengZhou 5389, 5–8: homozygous susceptible lines of “KP × ZZ5389” F3:4 population; 9–12: heterozygous lines; 13–16: homozygous resistant lines.
Agriculture 12 01836 g004
Agriculture 12 01836 g005 550
Figure 5. Expressions of DEGs located in the LrKP interval (114–168 Mb) on chromosome 2BS. DEGs between R-bulk and S-bulk were identified using clean reads from the BSR-seq assay. Only 12 DEGs located in the LrKP interval (114–168 Mb) on chromosome 2BS, including the cloned Lr13 gene (TraesCS2B02G182800).
Figure 5. Expressions of DEGs located in the LrKP interval (114–168 Mb) on chromosome 2BS. DEGs between R-bulk and S-bulk were identified using clean reads from the BSR-seq assay. Only 12 DEGs located in the LrKP interval (114–168 Mb) on chromosome 2BS, including the cloned Lr13 gene (TraesCS2B02G182800).
Agriculture 12 01836 g005
Table
Table 1. Infection types of tested wheat materials to 20 collected Pt pathotypes in China.
Table 1. Infection types of tested wheat materials to 20 collected Pt pathotypes in China.
Pt PathotypePHSS-1PHSS-2PHQSFHSSPHTS-1KHSSPHTS-2TGTSFHJQNHJS
Klein Proteo112111+111;
Lr3a-NIL44343+443+23
Lr3bg-NIL33343+4431+3
Lr3ka-NIL3+3+33+33+4221
Lr10-NIL33+333+44433
ZhengZhou 5389443+3+43+443+3+
Lr13-NIL3+43+43+433+3+3
Lr16-NIL3+444344443
Lr23-NIL33+33+3+3+4443
ZhouMai 22 (LrZH22/Lr13)3+22321;243
PtPathotypeFRJSFGBSPGJSFHSSTHSPSHJTPHJSFHGSPHTTFHGQ
Klein Proteo;;;;11;1;;
Lr3a-NIL3+3+33+233333
Lr3bg-NIL33+33233333+
Lr3ka-NIL223c3111232
Lr10-NIL33+3233+3333
ZhengZhou 53893+3+43+3+3+3+3+3+3+
Lr13-NIL3333333333
Lr16-NIL33+33+3+333+33+
Lr23-NIL33+32213333
ZhouMai 22 (LrZH22/Lr13)1213331221
Table
Table 2. CAPS markers designed based on BSR-seq.
Table 2. CAPS markers designed based on BSR-seq.
CAPS MarkersPrimer Sequence (5′-3′)SNP LocationExpected Size aAnnealing TemperatureRestriction Enzyme
Lrkp2B114CAAACCCTCACCTTGGAAGC114 Mb1021 bp58 °CAatII
GCCCTGGAGGTTTTCACGA
LrkpF299R300GTGCAGACGTTAGAGCGTAG168 Mb337 bp55 °CTaqI
TGATGTACATTTTTGTGGGGAAT
LrkpF286R286ATCCGCAGCAAGCACATAC209 Mb510 bp55 °CMboII
ACACAAAGAGATTAGGGCGTGT
Lrkp197F2R2AACTTCATGTACGCCCTGT210 Mb921 bp52 °CNdeI
GTTGGTCACCTAAACTGCC
Lrkp2b01F4R4ATGAACCCTCTCTGTGTTTGAGC240 Mb760 bp60 °CMspI
TACTGTGCCGCAGTGTCGC
Lrkp260F1R1GACACCTTAGCAGCTCCCTA260 Mb679 bp55 °CHindIII
ATGTTTGCTACTTCTTCCGTC
a The expected PCR product size before digestion.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Bai, S.; Pang, S.; Li, H.; Yang, J.; Yu, H.; Chen, S.; Wang, X. Broad-Spectrum Resistance to Leaf Rust in the Argentinean Wheat Cultivar “Klein Proteo” Is Controlled by LrKP Located on Chromosome 2BS. Agriculture 2022, 12, 1836. https://0-doi-org.brum.beds.ac.uk/10.3390/agriculture12111836

AMA Style

Bai S, Pang S, Li H, Yang J, Yu H, Chen S, Wang X. Broad-Spectrum Resistance to Leaf Rust in the Argentinean Wheat Cultivar “Klein Proteo” Is Controlled by LrKP Located on Chromosome 2BS. Agriculture. 2022; 12(11):1836. https://0-doi-org.brum.beds.ac.uk/10.3390/agriculture12111836

Chicago/Turabian Style

Bai, Shengsheng, Shuyong Pang, Hongna Li, Jinwei Yang, Haitao Yu, Shisheng Chen, and Xiaodong Wang. 2022. "Broad-Spectrum Resistance to Leaf Rust in the Argentinean Wheat Cultivar “Klein Proteo” Is Controlled by LrKP Located on Chromosome 2BS" Agriculture 12, no. 11: 1836. https://0-doi-org.brum.beds.ac.uk/10.3390/agriculture12111836

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop