Next Article in Journal
Correlation Analysis of High-Throughput Fruit Phenomics and Biochemical Profiles in Native Peppers (Capsicum spp.) from the Primary Center of Diversification
Next Article in Special Issue
Modern Approaches for the Genetic Improvement of Rice, Wheat and Maize for Abiotic Constraints-Related Traits: A Comparative Overview
Previous Article in Journal
The Classification of Medicinal Plant Leaves Based on Multispectral and Texture Feature Using Machine Learning Approach
Previous Article in Special Issue
Genome-Wide Association Mapping of Freezing Tolerance Loci in Canola (Brassica napus L.)
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agronomy
Volume 11
Issue 2
10.3390/agronomy11020264
agronomy-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genome-Wide Identification of the NHX Gene Family in Punica granatum L. and Their Expressional Patterns under Salt Stress

by
Jianmei Dong
1,2,
Cuiyu Liu
1,2,
Yuying Wang
1,2,
Yujie Zhao
1,2,
Dapeng Ge
1,2 and
Zhaohe Yuan
1,2,*
1
Co-Innovation Center for Sustainable Forestry in Southern China, Nanjing Forestry University, Nanjing 210037, China
2
College of Forestry, Nanjing Forestry University, Nanjing 210037, China
*
Author to whom correspondence should be addressed.
Agronomy 2021, 11(2), 264; https://0-doi-org.brum.beds.ac.uk/10.3390/agronomy11020264
Submission received: 28 December 2020 / Revised: 27 January 2021 / Accepted: 28 January 2021 / Published: 30 January 2021
(This article belongs to the Special Issue Molecular Genetics, Genomics and Biotechnology of Crop Plants Breeding - Series Ⅱ)
Browse Figures
Review Reports Versions Notes

Abstract

:
Most cultivated lands are suffering from soil salinization, which is a global problem affecting agricultural development and economy. High NaCl concentrations in the soil result in the accumulation of toxic Cl− and Na+ in plants. Na+/H+ antiporter (NHX) can regulate Na+ compartmentalization or efflux to reduce Na+ toxicity. This study aims to identify the NHX genes in pomegranate (Punica granatum L.) from the genome sequences and investigate their expression patterns under different concentrations of NaCl stress. In this study, we used the sequences of PgNHXs to analyze the physicochemical properties, phylogenetic evolution, conserved motifs, gene structures, cis-acting elements, protein tertiary structure and expression pattern. A total of 10 PgNHX genes were identified, and divided into three clades. Conserved motifs and gene structures showed that most of them had an amiloride-binding site (FFI/LY/FLLPPI), except for the members of clade III. There were multiple cis-acting elements involved in abiotic stress in PgNHX genes. Additionally, protein-protein interaction network analysis suggested that PgNHXs might play crucial roles in keeping a balance of Na+ in cells. The qRT-PCR analysis suggested that PgNHXs had tissue-specific expressional patterns under salt stress. Overall, our findings indicated that the PgNHXs could play significant roles in response to salt stress. The theoretical foundation was established in the present study for the further functional characterization of the NHX gene family in pomegranate.

1. Introduction

Soil salinization has become one of the harmful factors for the loss of cultivated land. Most of the world’s arable lands are suffering from soil salinization, which is a global problem affecting agricultural development and economy [1]. The total areas of global saline-alkali soil have even reached 1.0 × 108 hm2 since in the 1980s, which are still expanding [2]. Plant growth and development are affected by salt stress due to the destruction of osmotic balance and water deficiency [3,4,5].
When plants suffer from salt stress, Na+ will enter the cells through the non-selective ion channels and high-affinity K+ transporter-1 (HKT1) protein [6]. A high concentration of salt will disturb the balance of ions. Therefore, maintaining or reconstructing ionic equilibrium is essential for plants, the key of which is to reduce the concentration of Na+ in the cytoplasm. Plants relieve the harmful effects of excessive Na+ by separating Na+ into the vacuoles or removing Na+ from the cells [7]. The capacity of Na+ compartmentalization and exclusion was mainly relying on the activities of ion transporters [8]. Ion transporters mainly consist of HKT1 and Na+/H+ antiporter (NHX) in plants under salt stress [9,10]. The former can regulate the long-distance transport of Na+, while the latter can control the compartmentalization or efflux of Na+.
Na+/H+ antiporter is belongs to the NHX gene family and is widely distributed in all organisms [11]. Na+/H+ antiporter could be recognized as homodimers in the cell membrane, with 10–12 transmembrane regions at the N terminus. The highly conservative regions of TM6 and TM7 could transport Na+ and H+ [12]. NHX genes play significant roles in osmotic regulation, stoma regulation and flower development [13,14]. The salt-tolerant effect of NHX genes has been highlighted, with the production of salt-tolerant transgenic plants. The NHX genes have also been identified in many plants, but the number of members is varied. For instance, there are eight NHX genes in Arabidopsis thaliana. (L.) Heynh [15], six in grapevine (Vitis vinifera L.) [16], five in sugar beet (Beta vulgaris) [17], seven in sorghum (Sorghum bicolor (L.) Moench) [18], 10 in soybean (Glycine max (L.) Merr.) [6], and 25 in cotton (Gossypium barbadense L.) [19]. Among the eight NHX genes in Arabidopsis, AtNHX1, AtNHX2, AtNHX3, and AtNHX4 were located on the vacuolar membrane; AtNHX5, and AtNHX6 were located on the endosomal; and AtNHX7 (AtSOS1) and AtNHX8 were located on the plasma membrane. They were divided into Vacu-clade, Endo-clade, and Plas-clade, respectively, according to their subcellular location [15,17]. AtNHX1, AtNHX2, AtNHX3, AtNHX4, AtNHX5, and AtNHX6 could participate in vesicle transport and cell expansion activities and regulate pH and K+. AtNHX7 endowed plants with salt tolerance by the SOS (Salt overly sensitivity) pathway. The SOS pathway includes SOS1, SOS2 (serine/threonine protein kinase), and SOS3 (calcineurin), and the SOS2-SOS3 compound could regulate SOS1 to remove Na+ from the cell [20,21]. AtNHX8 located on the plasma membrane, was also considered a Li+/H+ antiporter [22,23].
Pomegranate (Punica granatum L.) belongs to the Lythraceae family, with significant ecological, cultural and economic values [24,25,26]. Pomegranate with moderate salt tolerance is predominantly grown in arid and semi-arid regions [27,28]. Bhantana et al. [29] pointed out that pomegranate could be listed as a model crop for perennial deciduous fruit trees, and it is of a great significance for investigation into the response mechanism to abiotic stress. Our previous study found that Na+ accumulation in pomegranate tissues was closely associated with its salt tolerance under NaCl stress [27,28]. Thus, studying the NHX genes and their expression patterns in pomegranate tissues will contribute to revealing the mechanisms of Na+ uptake and transport. However, there are few studies based on the Na+/H+ antiporter, despite many kinds of research focused on the pomegranate salt tolerance [30,31,32].
In the present study, the NHX gene family in pomegranate was identified based on the genome sequences (ASM220158v1) [33]. Additionally, various characteristics of PgNHX genes were analyzed, including their conserved domains, gene structures, phylogenetic relationship, cis-acting elements, protein-protein interaction network, and qRT-PCR analysis. Our results could reveal the roles of PgNHXs in response to salt stress, and our study aimed to provide a valuable reference for the further functional verification of the NHX genes in pomegranate.

2. Materials and Methods

2.1. Identification and Sequence Analysis of PgNHXs

We downloaded the protein sequences of the NHX genes in Arabidopsis from the Arabidopsis Information Resource (TAIR) database (http://www.arabidopsis.org/) [34]. We then used the BLASTP to search for candidate PgNHXs from the pomegranate genome (set the cut-off at E-value of ≤1×10−10) [35]. The conserved protein domains of putative PgNHXs were confirmed using the Conserved Domain Database (CDD) (https://0-www-ncbi-nlm-nih-gov.brum.beds.ac.uk/cdd) [36] and simple modular architecture research tool (SMART) (http://smart.embl-heidelberg.de) [37].
The physicochemical properties of PgNHX proteins were predicted by ExPASy online tools (http://expasy.org/protparam/) [38], including amino acid residue lengths, molecular weight (MW), and isoelectric point (pI). Signal peptide information on the PgNHX proteins was predicted by SignalP v4.1 Server (http://www.cbs.dtu.dk/services/SignalP-4.1/) [39]. Transmembrane helices (TMHs) in NHX protein sequences were predicted by using TMHMM Server v2.0 (http://www.cbs.dtu.dk/services/TMHMM-2.0/). Subcellular localization in the NHX protein sequences was predicted by Cell-Ploc v2.0 package (http://www.csbio.sjtu.edu.cn/bioinf/plant-multi/) [40].

2.2. Phylogenetic Analysis

Multiple sequence alignment was conducted by Clustal W (v2.1, Dublin, Ireland) using the NHX protein sequences from eight angiosperms, including two monocots Oryza sativa L. (Os, four sequences, 485–545 aa) and Zea mays L. (Zm, six sequences, 538–545 aa), and six core eudicots Arabidopsis thaliana (L.) Heynh. (At, eight sequences, 503–1146 aa), Citrus sinensis (L.) Osbeck (Cs, six sequences, 439–1148 aa), Eucalyptus grandis Hill ex Maiden (Eg, six sequences, 525–1145 aa), Pucica granatum L. (Pg), Populus euphratica Oliv. (Pe, seven sequences, 423–1145 aa), and Vitis vinifera L. (Vv, six sequences, 524–541 aa). All accession numbers and sequences of NHX proteins were presented in Supplementary File S1. The result of multiple sequence alignment of NHXs was visualized by Jalview [41]. A whole phylogenetic tree was constructed by MEGA (v5.0) [42] with the following settings: the neighbor-joining (NJ) method, 1000 bootstrap replicates, the Jones-Taylor-Thornton (JTT) model, and pairwise deletion. The EvolView (http://www.evolgenius.info/evolview/#login) [43] was then used to visualize it.

2.3. Motif Identification and Gene Structure Analysis

Multiple Expectation Maximization for Motif Elicitation (MEME) (http://meme-suite.org/tools/meme) [44] could be used to acquire the conserved motifs of NHX proteins from eight species. Parameter settings that influence the query execution result were set as followed: the maximum number of motifs 10, and the optimum motif width ≥6 and ≤50.
The coding sequence (CDS) was aligned with the corresponding pomegranate genomic DNA sequences to generate the intron/exons of PgNHX genes and analyze gene structures. Gene structures could be demonstrated using the TBtools (v1.075, Guangzhou, China) [45].

2.4. Protein Tertiary Structure and Protein Interaction Network Analysis

To investigate the tertiary structure of PgNHX proteins, I-TASSER (https://zhanglab.ccmb.med.umich.edu/I-TASSER/) [46] was used to predict the structure of 10 PgNHX proteins. The Local Meta-Threading Server (LOMETS) was a multiple threading approach that could be used to search structure templates from the Protein Data Bank (PDB). Then we constructed a table about structural dependent modelling parameters for the PgNHX proteins.
We analyzed the interaction network of PgNHX proteins using a model plant Arabidopsis on the String protein interaction database (http://string-db.org/) [47].

2.5. Cis-Acting Elements Located in NHX Gene Promoters

Based on the pomegranate genome, 1500 bp upstream sequences of NHX genes were acquired. PlantCARE (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/) [48] was used to analyze them, with the default parameter.

2.6. Plant Material, Treatment, and qRT-PCR Analysis

One-year-old ‘Taishanhong’ pomegranate cuttings were grown in pots (32 cm×25 cm) filled with a mixture substrate (turf and perlite 1:1), which were put in a phytotron of the Nanjing Forestry University (Nanjing, China) with a photoperiod of 14 h lighting/10 h darkness, temperatures of 28 °C (lighting)/22 °C (darkness), and 60% humidity. Three completely randomized blocks were designed in the present study with a total of 24 pots. Every eight pots were designed as a block, and there were two pots per biological replicate, each plot containing one plant. The mixed solution containing 0 (control), 100, 200, or 300 mM NaCl (Guangzhou Chemical Reagent Factory, Guangzhou, China) supplemented with half-strength Hoagland’s nutrient solution (Shanghai yuanye Bio-Technology Co., Ltd, Shanghai, China) was watered in each pot every 6 days, respectively. Moisture was maintained by placing a saucer under each container. All samples of leaves and roots were collected separately after 18 days of treatments.
Total RNA was extracted from pomegranate leaves and roots using a Trizol Total RNA Kit (Bio Teke, Wuxi, China). After that, the extracted RNA was used as a template for reverse transcription to obtain cDNA using the PrimeScriptTM RT reagent kit with gDNA Eraser (TaKaRa, Beijing, China). As shown in Table 1, there were sequences of primers used for qRT-PCR. The PCRs were performed on 7500 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) with a TB Green Premix Ex TaqTM II Kit (TaKaRa, Beijing, China). The thermal cycler was set as follows: (a) 95 °C for 34 s, 95 °C for 5 s, 60 °C for 34 s for 40 cycles, and at the second step of each cycle, fluorescence was obtained; (b) a dissolution curve was acquired as followed: 95 °C for 15 s, 60 °C for 60 s and 95 °C for 15 s. Three biological replicates were used for this study. The method of 2−ΔΔCT [49] was adopted to represent relative expression levels of the PgNHX genes. The logarithm (base 2) was taken for the relative expression values, and represented by TBtools with heatmap.

3. Results

3.1. Identification and Sequence Analysis of PgNHXs

In total, 10 putative PgNHX genes were identified from the pomegranate genome. All the PgNHX genes were renamed according to the order of protein id. The physical and chemical properties showed that the CDS length of 10 PgNHXs ranged from 1419 bp (PgNHX09) to 3582 bp (PgNHX10) (Table 2). The amino acid lengths were exhibited from 472 aa (PgNHX09) to 1193 aa (PgNHX10). The molecular weight ranged from 52.60 kDa (PgNHX09) to 132.31 kDa (PgNHX10). The predicted pI ranged from 5.45 (PgNHX07) to 9.32 (PgNHX09). The PgNHX04 and PgNHX07 were unstable proteins with high protein instability index (45.44 and 43.64 respectively), while other PgNHX proteins were stable. The grand average of hydropathy (GRAVY) value varied from 0.103 (PgNHX10) to 0.577 (PgNHX09), suggesting that all PgNHX proteins were hydrophobins. None of the PgNHX were secretory proteins and none had any signal peptide (Figure S1). In total, 10 PgNHXs were typical transmembrane transporters. PgNHX04 contained 12 transmembrane helices. PgNHX01 and PgNHX09 contained 11 transmembrane helices. The other seven proteins had ten transmembrane helices (Figure S2). The prediction of subcellular localization showed that most of these PgNHX proteins might located in the vacuoles, while PgNHX03 could be found in the vacuoles and on the cell membranes, and PgNHX10 was only located on the cell membranes.

3.2. Phylogenetic Analysis

NHX proteins with full-length sequences from pomegranate and the other seven species were used to construct a phylogenetic tree to analyze the phylogenetic relationship of PgNHX genes (Figure 1). According to the phylogenetic tree, all the NHX proteins were divided into three obvious clades: clades I, II and III, with strong support (Bootstrap = 100%). Clade I was the largest clade, including 38 NHXs (7 PgNHXs). Clade II was the smallest clade including 7 NHXs (PgNHX07). Clade III had 8 NHXs, including PgNHX03 and PgNHX10.

3.3. Motif Identification and Gene Structure of PgNHXs

A combined figure, including a phylogenetic tree, multiple sequence alignment, conserved motifs, and sequence logo showed characteristics of the NHX gene family (Figure 2). The conservative motif distribution of PgNHX proteins were consistent with the phylogenetic tree. Hence, PgNHXs in the same clade presented similar conserved motif compositions. Here, motifs 1–10 were mainly presented in clade I. However, motif 3 were absent from clades II and III, and motif 4 was lost in clade II. Interestingly, the amiloride-binding site (FFI/LY/FLLPPI), a typical feature of NHX protein, was presented in motif 1. We could see that the site was presented in most NHX proteins, but absent from clade III. There were differences in the amiloride-binding site concerning the composition. For instance, most of the proteins were FFIYLLPPI in clade I, while FFLFLLPPI in clade II. Residue IY or LF at this position could be known to be related to its sensitivity to amiloride [15]. Differentiation of sensitivity to amiloride indicated for NHX in different tissues is most likely involved in the structure of the protein, such as an accessory regulatory co-factor [50]. Those results might reveal that evolutionary patterns exist in this amiloride-binding site.
Members from the same clade had similar gene structures, including the exon/intron number, intron phase, and exon length (Figure 3). The results of the gene structure showed that PgNHX09, PgNHX07, PgNHX03, and PgNHX10 contained 13, 22, 21, and 23 exons, respectively, while other 6 PgNHX genes all had 14 exons. Overall, there was a unique and relatively conservative intron-exon arrangement.

3.4. Protein Tertiary Structure and Protein Interaction Network Analysis

All the NHX proteins in pomegranate were modeled by I-TASSER to understand their functional mechanism. Based on the ideal structural templates and crystal structures from PDB, tertiary structures of PgNHX protein were obtained (Figure 4). The confidence of constructed models evaluated by C-score, showed that its value generally ranged from −5 to 2, and that the more reliable model had a higher value. In this study, the ten predicted NHX protein models in pomegranate with a high credibility, C-score varied from −1.92 (PgNHX09) to −0.11 (PgNHX10) (Table 3). Most proteins shared the same PDB hit 4cz8A, indicating that their tertiary structures were similar.
To further explore the potential function, signal transduction and metabolic pathways of the PgNHX members, the protein-protein interaction network was constructed with the online tool String (Figure 5). All of them were on the protein-protein interaction network, and they shared the same putatively interactive proteins, including AVP1 (AT1G15690.1), HKT1 (AT4G10310.1), SOS2 (AT5G35410.1) and SOS3 (AT5G24270.2). AVP1 was involved in the regulation of apoplastic pH and auxin transport. HKT1 could play a significant role in Na+ recirculation to roots from shoots. SOS2 and SOS3 were involved in the regulatory pathway of salt stress by controlling intracellular Na+ and Ca2+ homeostasis, and directly interacted with SOS1 (PgNHX03and PgNHX10), NHX1 (PgNHX01 and PgNHX08), and NHX2 (PgNHX02, PgNHX04, PgNHX05 and PgNHX06). Additionally, the interaction between SOS1 and RCD1 (AT1G32230.1), might respond to high salt or oxidative stress. All PgNHX proteins worked together to response to salt stress.

3.5. Cis-Acting Elements Located in Promoters of PgNHXs

We submitted upstream 1500 bp sequences in the promoter region to PlantCARE to obtain cis-acting elements. The results showed that 20 cis-elements involved in abiotic stress were found, including LTR, O2-site, ABRE, G-Box, CAAT-box, TGA-element, GARE-motif, CGTCA-motif, GATA-motif, MBS, MRE, Sp1, P-box, TATC-box, Box 4, TCA-element, TCCC-motif, TGACG-motif, and AuxRR-core (Figure 6 and Table S1).
Most of the members contained ABA-responsive element ABRE, except PgNHX04. Half of the PgNHX genes contained the low-temperature stress response element LTR. PgNHX genes all contained two or more elements related to light responsiveness, including ACE, MRE, Sp1, Box 4, G-Box, GATA-motif, and TCCC-motif. 60% of the PgNHX genes contained elements of the GARE-motif, P-box and TATC-box and were involved in gibberellin response. All of the members of PgNHX genes contained MeJA responsive elements, CGTCA-motif and TGACG-motif. Only PgNHX02 and PgNHX05 contained the drought-inducibility element MBS. Only PgNHX01 and PgNHX06 contained the salicylic acid responsive element TCA. A total of 20% and 40% of PgNHX genes contained the auxin response element AuxRR-core and TGA-element. Above all, PgNHX genes might be related to the process of photosynthetic, hormone and adversity stress, and regulation of growth and development.

3.6. qRT-PCR Analysis of PgNHXs under Salt Stress

The results of the qRT-PCR analysis of PgNHX genes indicated that the expression patterns were tissue-specific under different NaCl treatments (Figure 7 and Table S2). Interestingly, the relative expression levels of all PgNHX genes in leaves were up-regulated, while most of PgNHXs were down-regulated or not changed in roots. At a low salinity level (100 mM NaCl), the relative expression levels in leaves were up-regulated, compared with the control (0 mM NaCl). The up-regulated expression of PgNHX10 was almost 9-fold higher than that found in control plants. However, most of the PgNHX genes were the down-regulation in roots compared with control, especially PgNHX01. Under moderate salt stress (200 mM NaCl), the relative expression levels were increased continuously in leaves, except PgNHX02 and PgNHX08. Meanwhile, PgNHX02 and PgNHX09 were up-regulated in roots compared with control. When subjected to severe salt stress (300 mM NaCl), the relative expression level still increased in leaves, and the expression level of PgNHX04 in roots was higher than other treatments.

4. Discussion

The NHX genes, coding for the Na+/H+ antiporter, belong to the CPA1 family. The Na+/H+ antiporter plays critical roles in the steady state of K+ and pH, leaf development and responses to salt stress [13,14,51]. In the present study, we identified 10 NHX genes in pomegranate. PgNHX proteins all contained Na+/H+ exchanger domains, which were relatively conservative in the evolution.
According to the phylogenetic tree, all genes were divided into three clades. Among them, PgNHX01, PgNHX02, PgNHX04, PgNHX05, PgNHX06, PgNHX08, PgNHX09 and AtNHX01, AtNHX02, AtNHX03, AtNHX04 of the Arabidopsis were on the same branch of cladeI. PgNHX07, AtNHX05 and AtNHX06 were on the same branch of clade II. PgNHX03, PgNHX10, AtNHX07 and AtNHX08 were on the same branch of clade III. Members of the same branch in the evolutionary tree might have similar biological functions. The evolutionary relationship was highly consistent with the subcellular location classification of G.max, Brachypodium distachyon (L.) Beauv., Populus trichocarpa Torr. & Gray ex Brayshaw and Beta vulgaris L. [17,52,53] As mentioned above, the NHX members of Arabidopsis were divided into three clades, according to its subcellular location: vacuolar membrane, endosomal and plasma membrane [15]. However, subcellular locations of PgNHX proteins were not consistent with Arabidopsis. Most of the PgNHX proteins were located in the vacuoles, while there were fewer on the cell membranes. Accordingly, this might indicate that the NaCl resistant mechanism of pomegranate was chiefly through the regionalization of Na+ into vacuoles.
In pomegranate, clade I had fewer exons (13–14) than other two clades (21–23). The results were in line with the NHX proteins in sugar beet, soybean, and poplar [6,17,52]. Our result showed clearly that their gene structures were highly conserved. Additionally, the same clade had similar motif compositions, indicating that the gene structures of the NHX gene family were relatively conserved during evolution. The binding site of amiloride (FFI/LY/FLLPPI) is one of the typical characteristics of NHX proteins. NHX is highly sensitive to amiloride, and could be completely inhibited due to the high affinity of its specific amino acid residue to amiloride. Na+ and amiloride could have the same functional binding site, according to amiloride, which was a competitive inhibitor of NHX mediating Na+ transport [54,55]. In this study, the binding site of amiloride was found in most members, but missing in three members, including PgNHX03, PgNHX09 and PgNHX10. Similar amiloride-binding sites were observed in V.vinifera, A.thaliana, P.trichocarpa and S.bicolor [11,18,52]. This finding implied that the motif (FFI/LY/FLLPPI) on the transmembrane region of PgNHX is sensitive to the Na+ of the substrate.
There were many cis-acting elements involved in hormone or abiotic stress response in the promoter region of the PgNHX genes. For example, most of the PgNHX genes had elements related to abscisic acid (ABA) regulation, low temperature, light, gibberellins, etc. These results might indicate that PgNHX genes participated in the growth and development of pomegranate through different hormone regulation pathways, abiotic stress response, and other physiological processes.
The protein-protein interaction network showed that the PgNHXs played a crucial role in salt-stress resistance. In the present study, we found that all PgNHX proteins shared the same putatively interactive protein AVP1, HKT1, SOS2 and SOS3. All of these putatively interacted proteins play essential roles in response to abiotic stress. Overexpression of the AVP1 can increase the plant’s tolerance to salt in Arabidopsis [56]. Romero-Aranda et al. [57] pointed out that HKT1 can improve salt tolerance by extracting Na+ from the xylem of different tissues and organs. SOS2 can encode a protein kinase to alleviate salt stress in Arabidopsis [58]. SOS3 is a Ca2+ sensor, which can escort SOS2 and SOS1 to promote Na+ efflux from the cells [18]. As shown in the summarized diagram, salt tolerance regulation is a multi-way regulation network (Figure 8). It is highly consistent with previous findings [58,59]. The increases in the transcription level of H+-ATPase, result in improving tolerance to salinity [60]. Moreover, we can also regulate the amount of K+ by AKT1 to reduce salt damage [59]. It is well know that many plants tend to adapt to high salinity environments by maintaining a high K+/Na+ ratio. Notably, AKT1 plays important roles in K+ uptake, maintenance and restoration of K+ homeostasis under salt stress. The overexpression of AKT1 in transgenic Arabidopsis also indicates that AKT1 could enhance the salt resistance [61,62]. As explained above, the response processes of plant growth, development, biotic and abiotic stresses are closely related. Thus, they may have similar regulatory functions, and simultaneously induce expression during stress.
The results of qRT-PCR suggested that the relative expression levels of PgNHXs had tissue-specific expressional patterns in pomegranate under salt stress, and the expression levels in leaves were higher than roots. Such results might be due to the stimulation of PgNHXs with the increasing of NaCl concentration, Na+ in leaf transfers from cytoplasm to vacuole, which were timely and effective, resulting in reducing ion toxicity [63]. Most genes showed adverse regulatory effects in roots, except PgNHX06. Under low and moderate salt stress, as the Na+ accumulated, the relative expression levels in leaves of pomegranate increased as well. Thus, Na+ could be up-taken or sequestrated in the vacuoles of leaves. At a high salinity level, some PgNHX genes still had higher expression levels. However, at the same time, PgNHX01 could not compartmentalize excessive Na+ in leaves so that expression level was drastically reduced in leaves. The results of tissue-specific expressional patterns of NHX were similar to Quintero et al. [64] and Wu et al. [65], and Na+ accumulation resulted in up-regulation in leaves rather than roots. Thus, the PgNHX genes might perform the different functions in pomegranate roots and leaves. PgNHXs might alleviate the harmful effects of Na+ via sequestrating the excessive Na+ into vacuoles of leaves and reducing the Na+ accumulation in roots.

5. Conclusions

In the present study, 10 PgNHX genes were identified, and the same clade had similar motif compositions and gene structures. The tissue-specific expressional patterns were displayed in PgNHX genes, with relatively low expression levels in roots and high expression levels in leaves under different concentrations of NaCl stress. The PgNHX genes were related to the uptake and transport of Na+ in pomegranate. Overall, our results could provide a reference for further research on the stress response of PgNHX and the functional verification of PgNHX.

Supplementary Materials

The following are available online at https://0-www-mdpi-com.brum.beds.ac.uk/2073-4395/11/2/264/s1, Table S1: Cis-elements of 10 PgNHXs, Table S2: The relative expression levels of 10 PgNHXs, File S1: All protein sequences for tree, Figure S1: Signal peptide prediction of 10 PgNHX proteins, Figure S2: Transmembrane helices of 10 PgNHX proteins.

Author Contributions

Conceptualization, J.D. and Z.Y.; methodology, Y.W. and D.G.; software, Y.W.; formal analysis, J.D.; investigation, J.D. and C.L.; writing—original draft preparation, J.D.; writing—review and editing, J.D., C.L., Y.W., Y.Z., D.G. and Z.Y.; supervision, C.L., Y.W., Y.Z. and Z.Y.; funding acquisition, Z.Y. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded jointly by the Tibet Autonomous Region Natural Science Foundation [XZ201019ZRG-153], the Initiative Project for Talents of Nanjing Forestry University [GXL2014070, GXL2018032], the Priority Academic Program Development of Jiangsu High Education Institutions [PAPD], and the Natural Science Foundation of Jiangsu Province [BK20180768].

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Zhu, J.K. Plant salt tolerance. Trends Plant Sci. 2001, 6, 66–71. [Google Scholar] [CrossRef]
  2. Kovda, V.A. Loss of productive land due to salinization. Ambio 1983, 12, 91–93. [Google Scholar] [CrossRef]
  3. Xiong, L.M.; Zhu, J.K. Molecular and genetic aspects of plant responses to osmotic stress. Plant Cell Environ. 2002, 25, 131–139. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  4. Tester, M.; Davenport, R. Na+ tolerance and Na+ transport in higher plants. Ann. Bot. 2003, 91, 503–527. [Google Scholar] [CrossRef] [PubMed]
  5. Abdul Qados, A.M.S. Effect of salt stress on plant growth and metabolism of bean plant Vicia faba L. J. Saudi Soc. Agric. Sci. 2011, 10, 7–15. [Google Scholar] [CrossRef] [Green Version]
  6. Chen, H.T.; Chen, X.; Wu, B.-Y.; Yuan, X.X.; Zhang, H.M.; Cui, X.Y.; Liu, X.Q. Whole-genome identification and expression analysis of K+ efflux antiporter (KEA) and Na+/H+ antiporter (NHX) families under abiotic stress in soybean. J. Integr. Agric. 2015, 14, 1171–1183. [Google Scholar] [CrossRef]
  7. Fukuda, A.; Nakamura, A.; Hara, N.; Toki, S.; Tanaka, Y. Molecular and functional analyses of rice NHX-type Na+/H+ antiporter genes. Planta 2010, 233, 175–188. [Google Scholar] [CrossRef]
  8. Farooq, M.; Hussain, M.; Wakeel, A.; Siddique, K.H.M. Salt stress in maize: Effects, resistance mechanisms, and management. A review. Agron. Sustain. Dev. 2015, 35, 461–481. [Google Scholar] [CrossRef] [Green Version]
  9. Rubio, F.; Gassmann, W.; Schroeder, J.I. Sodium-driven potassium uptake by the plant potassium transporter HKT1 and mutations conferring salt tolerance. Science 1995, 270, 1660–1663. [Google Scholar] [CrossRef]
  10. Apse, M.P.; Aharon, G.S.; Snedden, W.A.; Blumwald, E. Salt tolerance conferred by overexpression of a vacuolar Na+/H+ antiport in Arabidopsis. Science 1999, 285, 1256–1258. [Google Scholar] [CrossRef]
  11. Ayadi, M.; Ben Ayed, R.; Mzid, R.; Aifa, S.; Hanana, M. Computational approach for structural feature determination of grapevine NHX antiporters. BioMed Res. Int. 2019, 2019, 1–13. [Google Scholar] [CrossRef] [PubMed]
  12. Dibrov, P.; Fliegel, L. Comparative molecular analysis of Na+/H+ exchangers: A unified model for Na+/H+ antiport? FEBS Lett. 1998, 424, 1–5. [Google Scholar] [CrossRef] [Green Version]
  13. Qiu, Q.S. Plant and yeast NHX antiporters: Roles in membrane trafficking. J. Integr. Plant Biol. 2012, 54, 66–72. [Google Scholar] [CrossRef] [PubMed]
  14. Bassil, E.; Zhang, S.Q.; Gong, H.J.; Tajima, H.; Blumwald, E. Cation specificity of vacuolar NHX-type cation/H+ antiporters. Plant Physiol. 2019, 179, 616–629. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  15. Brett, C.L.; Donowitz, M.; Rao, R. Evolutionary origins of eukaryotic sodium/proton exchangers. Am. J. Physiol. Cell Physiol. 2005, 288, C223–C239. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  16. Ayadi, M.; Martins, V.; Ben Ayed, R.; Jbir, R.; Feki, M.; Mzid, R.; Géros, H.; Aifa, S.; Hanana, M. Genome wide identification, molecular characterization, and gene expression analyses of grapevine NHX antiporters suggest their involvement in growth, ripening, seed dormancy, and stress response. Biochem. Genet. 2020, 58, 102–128. [Google Scholar] [CrossRef] [PubMed]
  17. Wu, G.Q.; Wang, J.L.; Li, S.J. Genome-wide Identification of Na+ /H+ antiporter (NHX) genes in sugar beet (Beta vulgaris L.) and their regulated expression under salt stress. Genes 2019, 10, 401. [Google Scholar] [CrossRef] [Green Version]
  18. Kumari, H.; Kumar, S.; Ramesh, K.; Palakolanu, S.R.; Marka, N.; Prakash, A.; Shah, T.; Henderson, A.; Srivastava, R.; Rajasheker, G.; et al. Genome-wide identification and analysis of arabidopsis sodium proton antiporter (NHX) and human sodium proton exchanger (NHE) homologs in Sorghum bicolor. Genes 2018, 9, 236. [Google Scholar] [CrossRef] [Green Version]
  19. Akram, U.; Song, Y.; Liang, C.; Abid, M.; Askari, M.; Myat, A.; Abbas, M.; Malik, W.; Ali, Z.; Guo, S.; et al. Genome-wide characterization and expression analysis of NHX gene family under salinity stress in Gossypium barbadense and Its comparison with Gossypium hirsutum. Genes 2020, 11, 803. [Google Scholar] [CrossRef]
  20. Qiu, Q.S.; Guo, Y.; Dietrich, M.A.; Schumaker, K.S.; Zhu, J.K. Regulation of SOS1, a plasma membrane Na+/H+ exchanger in Arabidopsis thaliana, by SOS2 and SOS3. Proc. Natl. Acad. Sci. USA 2002, 99, 8436–8441. [Google Scholar] [CrossRef] [Green Version]
  21. Quintero, F.J.; Ohta, M.; Shi, H.Z.; Zhu, J.K.; Pardo, J.M. Reconstitution in yeast of the Arabidopsis SOS signaling pathway for Na+homeostasis. Proc. Natl. Acad. Sci. USA 2002, 99, 9061–9066. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  22. Wang, M.; Zheng, Q.S.; Shen, Q.R.; Guo, S.W. The critical role of potassium in plant stress response. Int. J. Mol. Sci. 2013, 14, 7370–7390. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  23. Meng, K.B.; Wu, Y.X. Footprints of divergent evolution in two Na+/H+ type antiporter gene families (NHX and SOS1) in the genus Populus. Tree Physiol. 2018, 38, 813–824. [Google Scholar] [CrossRef] [PubMed]
  24. Yuan, Z.H.; Yin, Y.L.; Qu, J.L.; Zhu, L.Q.; Li, Y. Population genetic diversity in chinese pomegranate (Punica granatum L.) cultivars revealed by fluorescent-AFLP markers. J. Genet. Genom. 2017, 34, 1061–1071. [Google Scholar] [CrossRef]
  25. Fahmy, H.; Hegazi, N.; El-Shamy, S.; Farag, M.A. Pomegranate juice as a functional food: A comprehensive review of its polyphenols, therapeutic merits, and recent patents. Food Funct. 2020, 11, 1–27. [Google Scholar] [CrossRef]
  26. Tozzi, F.; Legua, P.; Martínez-Nicolás, J.J.; Núez-Gómez, D.; Melgarejo, P. Morphological and nutraceutical characterization of six pomegranate cultivars of global commercial interest. Sci. Hortic. 2020, 272, 1–9. [Google Scholar] [CrossRef]
  27. Liu, C.Y.; Zhao, X.Q.; Yan, J.X.; Yuan, Z.H.; Gu, M.M. Effects of salt stress on growth, photosynthesis, and mineral nutrients of 18 pomegranate (Punica granatum) cultivars. Agronomy 2019, 10, 27. [Google Scholar] [CrossRef] [Green Version]
  28. Liu, C.Y.; Zhao, Y.J.; Zhao, X.Q.; Wang, J.P.; Gu, M.M.; Yuan, Z.H. Transcriptomic profiling of pomegranate provides insights into salt tolerance. Agronomy 2020, 10, 44. [Google Scholar] [CrossRef] [Green Version]
  29. Bhantana, P.; Lazarovitch, N. Evapotranspiration, crop coefficient and growth of two young pomegranate (Punica granatum L.) varieties under salt stress. Agric.Water Manag. 2010, 97, 715–722. [Google Scholar] [CrossRef]
  30. Cui, J.Q.; Hua, Y.P.; Zhou, T.; Liu, Y.; Huang, J.Y.; Yue, C.P. Global landscapes of the Na+/H+ antiporter (NHX) family members uncover their potential roles in regulating the rapeseed resistance to salt stress. Int. J. Mol. Sci. 2020, 21, 3429. [Google Scholar] [CrossRef]
  31. Li, W.H.; Du, J.; Feng, H.M.; Wu, Q.; Xu, G.H.; Shabala, S.; Yu, L. Function of NHX-type transporters in improving rice tolerance to aluminum stress and soil acidity. Planta 2020, 251, 71. [Google Scholar] [CrossRef] [PubMed]
  32. Long, L.; Zhao, J.R.; Guo, D.D.; Ma, X.N.; Gao, W. Identification of NHXs in Gossypium species and the positive role of GhNHX1 in salt tolerance. BMC Plant Biol. 2020, 20, 147. [Google Scholar] [CrossRef] [PubMed]
  33. Qin, G.H.; Xu, C.Y.; Ming, R.; Tang, H.B.; Guyot, R.; Kramer, E.M.; Hu, Y.D.; Yi, X.K. The pomegranate (Punica granatum L.) genome and the genomics of punicalagin biosynthesis. Plant J. 2017, 91, 1108–1128. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  34. Lamesch, P.; Berardini, T.Z.; Li, D.H.; Swarbreck, D.; Wilks, C.; Sasidharan, R. The Arabidopsis Information Resource (TAIR): Improved gene annotation and new tools. Nucleic Acids Res. 2012, 40, D1201–D1210. [Google Scholar] [CrossRef]
  35. Zhang, T.; Liu, C.; Huang, X.; Zhang, H.; Yuan, Z. Land-plant phylogenomic and pomegranate transcriptomic analyses reveal an evolutionary scenario of CYP75 genes subsequent to whole genome duplications. J. Plant Biol. 2019, 62, 48–60. [Google Scholar] [CrossRef]
  36. Marchler-Bauer, A.; Lu, S.; Anderson, J.B.; Chitsaz, F.; Derbyshire, M.K.; DeWeese-Scott, C.; Fong, J.H. CDD: A conserved domain database for the functional annotation of proteins. Nucleic Acids Res. 2011, 39, 225–229. [Google Scholar] [CrossRef] [Green Version]
  37. Schultz, J.; Milpetz, F.; Bork, P.; Ponting, C.P. SMART, a simple modular architecture research tool: Identification of signaling domains. Proc. Natl. Acad. Sci. USA 1998, 95, 5857–5864. [Google Scholar] [CrossRef] [Green Version]
  38. Gasteiger, E.; Hoogland, C.; Gattiker, A.; Duvaud, S.E.; Wilkins, M.R.; Appel, R.D.; Bairoch, A. Protein Identification and Analysis Tools on the ExPASy Server; Humana Press: Totowa, NJ, USA, 2005. [Google Scholar] [CrossRef]
  39. Petersen, T.N.; Brunak, S.; Heijne, G.V.; Nielsen, H. SignalP 4.0: Discriminating signal peptides from transmembrane regions. Nat. Methods 2011, 8, 785–786. [Google Scholar] [CrossRef]
  40. Chou, K.C.; Shen, H.B. Plant-mPLoc: A top-down strategy to augment the power for predicting plant protein subcellular localization. PLoS ONE 2010, 5, e11335. [Google Scholar] [CrossRef] [Green Version]
  41. Michele, C.; James, C.; Stephen, M.S.; Geoffrey, J.B. The Jalview Java alignment editor. Bioinformatics 2004, 20, 426–427. [Google Scholar] [CrossRef] [Green Version]
  42. Tamura, K.; Peterson, D.; Peterson, N.; Stecher, G.; Nei, M.; Kumar, S. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 2011, 28, 2731–2739. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  43. Subramanian, B.; Gao, S.H.; Lercher, M.J.; Hu, S.N.; Chen, W.H. Evolview v3: A webserver for visualization, annotation, and management of phylogenetic trees. Nucleic Acids Res. 2019, 47, W270–W275. [Google Scholar] [CrossRef] [PubMed]
  44. Bailey, T.L.; Boden, M.; Buske, F.A.; Frith, M.; Grant, C.E.; Clementi, L.; Ren, J.Y.; Li, W.W.; Noble, W.S. MEME SUITE: Tools for motif discovery and searching. Nucleic Acids Res. 2009, 37, W202–W208. [Google Scholar] [CrossRef] [PubMed]
  45. Chen, C.J.; Xia, R.; Chen, H.; He, Y.H. TBtools, a Toolkit for Biologists integrating various HTS-data handling tools with a user-friendly interface. BioRxiv 2018, 289660. [Google Scholar] [CrossRef]
  46. Yang, J.; Zhang, Y. I-TASSER Server: New development for protein structure and function predictions. Nucleic Acids Res. 2015, 43, W174–W181. [Google Scholar] [CrossRef] [Green Version]
  47. Szklarczyk, D.; Gable, A.L.; Lyon, D.; Junge, A.; Wyder, S.; Huerta-Cepas, J.; Simonovic, M.; Doncheva, N.T.; Morris, J.H.; Bork, P. STRING v11: Protein-protein association networks with increased coverage, supporting functional discovery in genome-wide experimental datasets. Nucleic Acids Res. 2018, 47, D607–D613. [Google Scholar] [CrossRef] [Green Version]
  48. Lescot, M.; Déhais, P.; Thijs, G.; Marchal, K.; Moreau, Y.; Van de Peer, Y.; Rouzé, P.; Rombauts, S. PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences. Nucleic Acids Res. 2002, 30, 325–327. [Google Scholar] [CrossRef]
  49. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using realtime quantitative PCR and the 2-ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  50. Yun, C.H.C.; Little, P.J.; Nath, S.K.; Levine, S.A.; Pouyssegur, J. Leu143 in the putative fourth membrane spanning domain is critical for amiloride inhibition of an epithelial Na+/H+ exchanger isoform (NHE-2). Biochem. Biophys. Res. Commun. 1993, 193, 532–539. [Google Scholar] [CrossRef]
  51. Li, N.N.; Wang, X.; Ma, B.J.; Du, C.; Zheng, L.L.; Wang, Y.C. Expression of a Na(+)/H(+) antiporter RtNHX1 from a recretohalophyte Reaumuria trigyna improved salt tolerance of transgenic Arabidopsis thaliana. J. Plant Physiol. 2017, 218, 109–120. [Google Scholar] [CrossRef]
  52. Tian, F.X.; Chang, E.; Li, Y.; Sun, P.; Hu, J.J.; Zhang, J. Expression and integrated network analyses revealed functional divergence of NHX-type Na+/H+ exchanger genes in poplar. Sci. Rep. 2017, 7, 2607. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  53. Bassil, E.; Coku, A.; Blumwald, E. Cellular ion homeostasis: Emerging roles of intracellular NHX Na+/H+ antiporters in plant growth and development. J. Exp. Bot. 2012, 63, 5727–5740. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  54. Counillon, L.; Franchi, A.; Pouyssegur, J. A point mutation of the Na+/H+ exchanger gene (NHE1) and amplification of the mutated allele confer amiloride resistance upon chronic acidosis. Proc. Natl. Acad. Sci. USA 1993, 90, 4508–4512. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  55. Harris, C.; Fliegel, L. Amiloride and the Na(+)/H(+) exchanger protein: Mechanism and significance of inhibition of the Na(+)/H(+) exchanger (review). Int. J. Mol. Med. 1999, 3, 315–336. [Google Scholar] [CrossRef] [PubMed]
  56. Gaxiola, R.A.; Li, J.L.; Undurraga, S.; Dang, L.M.; Fink, G.R. Drought- and salt-tolerant plants result from overexpression of the AVP1 H+-pump. Proc. Natl. Acad. Sci. USA 2001, 98, 11444–11449. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  57. Romero-Aranda, M.R.; Fernández, P.G.; López-Tienda, J.R.; López-Diaz, M.R.; Espinosa, J.; Granum, E.; Traverso, J.Á.; Pineda, B.; Garcia-Sogo, B.; Moreno, V.; et al. Na+ transporter HKT1;2 reduces flower Na+ content and considerably mitigates the decline in tomato fruit yields under saline conditions. Plant Physiol. Biochem. 2020, 154, 341–352. [Google Scholar] [CrossRef]
  58. Wilkins, K.A.; Matthus, E.; Swarbreck, S.M.; Davies, J.M. Calcium-mediated abiotic stress signaling in roots. Front.Plant Sci. 2016, 7, 1296. [Google Scholar] [CrossRef] [Green Version]
  59. Manik, S.M.N.; Shi, S.J.; Mao, J.J.; Dong, L.H.; Su, Y.L.; Wang, Q.; Liu, H. The calcium sensor CBL-CIPK is involved in plant's response to abiotic stresses. Int. J. Genom. 2015, 2015, 1–10. [Google Scholar] [CrossRef] [Green Version]
  60. Bao, A.K.; Wang, S.M.; Wu, G.Q.; Xi, J.J.; Wang, C.M. Overexpression of the Arabidopsis H+-PPase enhanced resistance to salt and drought stress in transgenic alfalfa (Medicago sativa L.). Plant Sci. 2008, 176, 232–240. [Google Scholar] [CrossRef]
  61. Chen, J.; Wang, W.H.; Wu, F.H.; He, E.M.; Zheng, H.L. Hydrogen sulfide enhances salt tolerance through nitric oxide-mediated maintenance of ion homeostasis in barley seedling roots. Sci. Rep. 2015, 5, 12516. [Google Scholar] [CrossRef] [Green Version]
  62. Chen, Z.; Zhao, X.; Hu, Z.; Leng, P. Nitric oxide modulating ion balance in Hylotelephium erythrostictum roots subjected to NaCl stress based on the analysis of transcriptome, fluorescence, and ion fluxes. Sci. Rep. 2019, 9, 18137. [Google Scholar] [CrossRef] [PubMed]
  63. Apse, M.P.; Sottosanto, J.B.; Blumwald, E. Vacuolar cation/H+ exchange, ion homeostasis, and leaf development are altered in a T-DNA insertional mutant of AtNHX1, the Arabidopsis vacuolar Na+/H+ antiporter. Plant J. 2003, 36, 229–239. [Google Scholar] [CrossRef] [PubMed]
  64. Quintero, F.J.; Blatt, M.R.; Pardo, J.M. Functional conservation between yeast and plant endosomal Na(+)/H(+) antiporters. FEBS Lett. 2000, 471, 224–228. [Google Scholar] [CrossRef]
  65. Wu, C.A.; Yang, G.D.; Meng, Q.W.; Zheng, C.C. The cotton GhNHX1 gene encoding a novel putative tonoplast Na+/H+ antiporter plays an important role in salt stress. Plant Cell Physiol. 2004, 45, 600–607. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Agronomy 11 00264 g001 550
Figure 1. The phylogenetic tree of the NHX gene family, and sequences from Arabidopsis thaliana (L.) Heynh. (At), Citrus sinensis (L.) Osbeck (Cs), Eucalyptus grandis Hill ex Maiden (Eg), Oryza sativa L. (Os), Populus euphratica Oliv. (Pe), Punica granatum L. (Pg), Vitis vinifera L. (Vv) and Zea mays L. (Zm). Various branch colors indicate different clades. The species are presented by various font colors. The values of bootstrap are presented by three coloured pots.
Figure 1. The phylogenetic tree of the NHX gene family, and sequences from Arabidopsis thaliana (L.) Heynh. (At), Citrus sinensis (L.) Osbeck (Cs), Eucalyptus grandis Hill ex Maiden (Eg), Oryza sativa L. (Os), Populus euphratica Oliv. (Pe), Punica granatum L. (Pg), Vitis vinifera L. (Vv) and Zea mays L. (Zm). Various branch colors indicate different clades. The species are presented by various font colors. The values of bootstrap are presented by three coloured pots.
Agronomy 11 00264 g001
Agronomy 11 00264 g002 550
Figure 2. Phylogenetic tree, alignments and conserved motifs of the NHX gene family. (A) The phylogenetic tree of 53 NHX proteins as shown in Figure 1. (B) Multiple sequence alignment of the amiloride-binding site. (C) Conserved motifs in the PgNHX proteins. Different colored boxes represented different conserved motifs. (D) Sequence logo of motifs 1, 3 and 4.
Figure 2. Phylogenetic tree, alignments and conserved motifs of the NHX gene family. (A) The phylogenetic tree of 53 NHX proteins as shown in Figure 1. (B) Multiple sequence alignment of the amiloride-binding site. (C) Conserved motifs in the PgNHX proteins. Different colored boxes represented different conserved motifs. (D) Sequence logo of motifs 1, 3 and 4.
Agronomy 11 00264 g002
Agronomy 11 00264 g003 550
Figure 3. Phylogenetic tree, and gene structures of the PgNHX genes. (A) The phylogenetic tree of 10 PgNHX proteins. (B) Gene structures of the PgNHX genes. Blue boxes represent exons. Yellow boxes represent UTR.
Figure 3. Phylogenetic tree, and gene structures of the PgNHX genes. (A) The phylogenetic tree of 10 PgNHX proteins. (B) Gene structures of the PgNHX genes. Blue boxes represent exons. Yellow boxes represent UTR.
Agronomy 11 00264 g003
Agronomy 11 00264 g004 550
Figure 4. Tertiary structure of PgNHX proteins. The models of proteins were obtained by the online server I-TASSER. The α-helix, β-strand, and random coil are marked by red, yellow and blue, respectively. The parameters of the best PDB structure for PgNHXs are listed in Table 3.
Figure 4. Tertiary structure of PgNHX proteins. The models of proteins were obtained by the online server I-TASSER. The α-helix, β-strand, and random coil are marked by red, yellow and blue, respectively. The parameters of the best PDB structure for PgNHXs are listed in Table 3.
Agronomy 11 00264 g004
Agronomy 11 00264 g005 550
Figure 5. Protein-protein interaction network of PgNHX protein was analyzed by the Tool String. Network nodes represent proteins. Colored nodes represent query proteins and first shell of interactors. Empty nodes indicate proteins of unknown 3D structure. Filled nodes indicate that some 3D structure is known or predicted.
Figure 5. Protein-protein interaction network of PgNHX protein was analyzed by the Tool String. Network nodes represent proteins. Colored nodes represent query proteins and first shell of interactors. Empty nodes indicate proteins of unknown 3D structure. Filled nodes indicate that some 3D structure is known or predicted.
Agronomy 11 00264 g005
Agronomy 11 00264 g006 550
Figure 6. Cis-acting elements analysis of PgNHX genes. Note: ABRE was involved in the abscisic acid responsiveness; LTR involved in low-temperature responsiveness; ACE, MRE, Sp1, Box 4, G-Box, GATA-motif, and TCCC-motif were involved in light responsiveness; O2-site was involved in zein metabolism regulation; CAAT-box was involved in promoter and enhancer regions; TGA-element and AuxRR-core were involved in auxin-responsiveness; GARE-motif, P-box and TATC-box involved in gibberellin-responsiveness; CGTCA-motif and TGACG-motif were involved in the MeJA-responsiveness; MBS was involved in drought-inducibility; TCA was involved in salicylic acid responsiveness.
Figure 6. Cis-acting elements analysis of PgNHX genes. Note: ABRE was involved in the abscisic acid responsiveness; LTR involved in low-temperature responsiveness; ACE, MRE, Sp1, Box 4, G-Box, GATA-motif, and TCCC-motif were involved in light responsiveness; O2-site was involved in zein metabolism regulation; CAAT-box was involved in promoter and enhancer regions; TGA-element and AuxRR-core were involved in auxin-responsiveness; GARE-motif, P-box and TATC-box involved in gibberellin-responsiveness; CGTCA-motif and TGACG-motif were involved in the MeJA-responsiveness; MBS was involved in drought-inducibility; TCA was involved in salicylic acid responsiveness.
Agronomy 11 00264 g006
Agronomy 11 00264 g007 550
Figure 7. The relative expression levels of the PgNHX genes in leaves and roots under different NaCl treatments. T1, T2, T3, T4 represented the different treatments of 0, 100, 200, 300 mM NaCl in leaves, respectively. T5, T6, T7, T8 represented the different treatments of 0, 100, 200, 300 mM NaCl in roots, respectively.
Figure 7. The relative expression levels of the PgNHX genes in leaves and roots under different NaCl treatments. T1, T2, T3, T4 represented the different treatments of 0, 100, 200, 300 mM NaCl in leaves, respectively. T5, T6, T7, T8 represented the different treatments of 0, 100, 200, 300 mM NaCl in roots, respectively.
Agronomy 11 00264 g007
Agronomy 11 00264 g008 550
Figure 8. Cell signaling pathways that regulate activities of ion transporters to maintain K+/Na+ homoeostasis under salt stress.
Figure 8. Cell signaling pathways that regulate activities of ion transporters to maintain K+/Na+ homoeostasis under salt stress.
Agronomy 11 00264 g008
Table
Table 1. The sequences of primers used for qRT-PCR.
Table 1. The sequences of primers used for qRT-PCR.
No.Gene NameGene IDForward Primer Sequence (5′-3′)Reverse Primer Sequence (5′-3′)
1PgNHX01CDL15_Pgr020251AGTTGCTCGGAACCTTTCTCCAGCATCATGAGAGCGACTT
2PgNHX02CDL15_Pgr020284TGGGACATACTCATCTGCGACCATGCTGGTCCTATGCTTT
3PgNHX03CDL15_Pgr013571TGTGATTGAACCTCCAGCAGCTGTCCTTGCAATCGTCTCA
4PgNHX04CDL15_Pgr008437AGCTCGTCAGTGATAGTCCATGATCTGTTGCTTCCAGTCG
5PgNHX05CDL15_Pgr018608CTGATTATGGTGGGAAGGGCTCCTGACCTCGTGAACTGAT
6PgNHX06CDL15_Pgr016272CTTCCATCGTGACTGGACTGGAGAGCCGTGATTGATTCGT
7PgNHX07CDL15_Pgr004028GTTAGGCCTGCACATCGTAAACTATAGCTGTGGTAGCCGT
8PgNHX08CDL15_Pgr019015TACTTTCGGCAACGGATTCAGGCATCATTCACGACTCCTT
9PgNHX09CDL15_Pgr012091TGTGCTCGATGCTCCATGTTAGTCACGGCTTGCGTTCATA
10PgNHX10CDL15_Pgr021015CACAGGCACTCTGTTTGTCTCCAATATTCGCCTCTTCGCT
11PgACTINCDL15_Pgr015157AGTCCTCTTCCAGCCATCTCACTGAGCACAATGTTTCCA
Table
Table 2. The identification and sequence analysis of the Na+/H+ antiporter (NHX) gene family in pomegranate.
Table 2. The identification and sequence analysis of the Na+/H+ antiporter (NHX) gene family in pomegranate.
Gene NameProtein IDCDS
(bp)		Length
(aa)		MW
(kDa)		pIInstability
Index		GRAVYTMHsSubcellular Localization
PgNHX01OWM62957.1164454760.48.6736.230.57411Vacuole
PgNHX02OWM62990.1165955261.07.7434.040.54510Vacuole
PgNHX03OWM66354.12826941103.85.5935.770.42510Cell membrane; Vacuole
PgNHX04OWM74126.1163254360.69.2145.440.47912Vacuole
PgNHX05OWM78039.1161753859.59.3235.220.57110Vacuole
PgNHX06OWM78548.1162654160.48.1739.490.47610Vacuole
PgNHX07OWM83599.1164754860.05.4543.640.40110Vacuole
PgNHX08OWM85391.1165355060.38.3236.530.54610Vacuole
PgNHX09OWM85841.1141947252.66.9435.400.57711Vacuole
PgNHX10OWM90710.135821193132.36.5839.110.10310Cell membrane
Table
Table 3. Structural dependent modeling parameters for the PgNHX proteins.
Table 3. Structural dependent modeling parameters for the PgNHX proteins.
ProteinC-ScoreTM-ScoreRMSD (Å)Best Identified Structure Analogs in PDB
PDB HitTM-ScoreaRMSDaIDENaCov
PgNHX01−1.690.51 ± 0.1511.5 ± 4.54cz8A0.7071.060.2090.717
PgNHX02−1.210.56 ± 0.1510.4 ± 4.64cz8A0.7011.080.2270.710
PgNHX03−0.660.63 ± 0.1410.3 ± 4.66xteA0.9250.960.0890.932
PgNHX04−1.500.53 ± 0.1511.0 ± 4.64cz8A0.7021.500.2100.720
PgNHX05−1.670.51 ± 0.1511.5 ± 4.54cz8A0.6971.930.2040.729
PgNHX06−1.800.50 ± 0.1511.8 ± 4.54cz8A0.7021.510.2230.723
PgNHX07−1.480.53 ± 0.1511.0 ± 4.66z3yB0.6901.310.4020.704
PgNHX08−0.810.61 ± 0.149.4 ± 4.64cz8A0.7021.170.2120.713
PgNHX09−1.920.48 ± 0.1511.8 ± 4.56z3yB0.7421.380.3010.761
PgNHX10−0.110.70 ± 0.129.6 ± 4.66r9tA0.9860.870.1050.991
Note: C-score ranged from −5 to 2, which signifies the confidence of each model. A higher value suggests a model with a higher confidence and vice-versa. TM-score and RMSD are evaluated derived from the C-score value and the protein length following the correlation observed between these qualities. The TM-scorea represents a measure of global structural similarity between query and template protein. RMSDa represents the RMSD between residues that are structurally aligned by TM-align. IDENa represents identity of the percentage sequence in the structurally aligned region. Cov is coverage, representing the coverage of the alignment by TM-align, and its value is equal to the number of structurally aligned residues divided by length of the query protein.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Dong, J.; Liu, C.; Wang, Y.; Zhao, Y.; Ge, D.; Yuan, Z. Genome-Wide Identification of the NHX Gene Family in Punica granatum L. and Their Expressional Patterns under Salt Stress. Agronomy 2021, 11, 264. https://0-doi-org.brum.beds.ac.uk/10.3390/agronomy11020264

AMA Style

Dong J, Liu C, Wang Y, Zhao Y, Ge D, Yuan Z. Genome-Wide Identification of the NHX Gene Family in Punica granatum L. and Their Expressional Patterns under Salt Stress. Agronomy. 2021; 11(2):264. https://0-doi-org.brum.beds.ac.uk/10.3390/agronomy11020264

Chicago/Turabian Style

Dong, Jianmei, Cuiyu Liu, Yuying Wang, Yujie Zhao, Dapeng Ge, and Zhaohe Yuan. 2021. "Genome-Wide Identification of the NHX Gene Family in Punica granatum L. and Their Expressional Patterns under Salt Stress" Agronomy 11, no. 2: 264. https://0-doi-org.brum.beds.ac.uk/10.3390/agronomy11020264

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop