Differential Expression of Inflammatory Markers in Hypoglycemia Unawareness Associated with Type 1 Diabetes: A Case Report
Abstract
:1. Introduction
2. Case Description
2.1. Hypoglycemia Unawareness (HU) Patient
2.2. Current and Future Therapeutic Interventions
2.3. Blood Samples Collection and Inflammatory Biomarkers Assessment
2.4. Gene Expression of Inflammatory Markers in T1DM and HU
3. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Page, K.; Arora, J.; Qiu, M.; Relwani, R.; Constable, R.T.; Sherwin, R.S. Small decrements in systemic glucose provoke increases in hypothalamic blood flow prior to the release of counterregulatory hormones. Diabetes 2008, 58, 448–452. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wrighten, S.A.; Piroli, G.G.; Grillo, C.A.; Reagan, L.P. A look inside the diabetic brain: Contributors to diabetes-induced brain aging. Biochim. Biophys. Acta (BBA) Mol. Basis Dis. 2009, 1792, 444–453. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cryer, P.E. Hypoglycemia-associated autonomic failure in diabetes. Am. J. Physiol. Metab. 2001, 281, E1115–E1121. [Google Scholar] [CrossRef] [PubMed]
- Kamenov, Z.; Traykov, L. Diabetic autonomic neuropathy. In Advances in Experimental Medicine and Biology; Springer: Berlin/Heidelberg, Germany, 2012; pp. 176–193. [Google Scholar] [CrossRef]
- Zhou, C.; Teegala, S.B.; Khan, B.A.; Gonzalez, C.; Routh, V.H. Hypoglycemia: Role of hypothalamic glucose-inhibited (GI) neurons in detection and correction. Front. Physiol. 2018, 9. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cryer, P.E. The prevention and correction of hypoglycemia. Compr. Physiol. 2011, 1057–1092. [Google Scholar] [CrossRef]
- Szadkowska, A.; Czyżewska, K.; Pietrzak, I.; Mianowska, B.; Jarosz-Chobot, P.; Myśliwiec, M. Hypoglycaemia unawareness in patients with type 1 diabetes. Pediatr. Endocrinol. Diabetes Metab. 2018, 2018, 126–134. [Google Scholar] [CrossRef] [PubMed]
- Hwang, J.J.; Parikh, L.; Lacadie, C.; Seo, D.; Lam, W.; Hamza, M.; Schmidt, C.; Dai, F.; Sejling, A.-S.; Belfort-DeAguiar, R.; et al. Hypoglycemia unawareness in type 1 diabetes suppresses brain responses to hypoglycemia. J. Clin. Investig. 2018, 128, 1485–1495. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Geddes, J.; Schopman, J.E.; Zammitt, N.N.; Frier, B.M. Prevalence of impaired awareness of hypoglycaemia in adults with Type 1 diabetes. Diabet. Med. 2008, 25, 501–504. [Google Scholar] [CrossRef] [PubMed]
- Cryer, P.E. Mechanisms of hypoglycemia-associated autonomic failure and its component syndromes in diabetes. Diabetes 2005, 54, 3592–3601. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Piarulli, F.; Sartore, G.; Sechi, A.; Basso, D.; Fogar, P.; Greco, E.; Ragazzi, E.; Lapolla, A. Low glucose concentrations induce a similar inflammatory response in monocytes from type 2 diabetic patients and healthy subjects. Oxidative Med. Cell. Longev. 2017, 2017, 1–6. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Giorda, C.; HYPOS-1 Study Group of AMD; Ozzello, A.; Gentile, S.; Aglialoro, A.; Chiambretti, A.; Baccetti, F.; Gentile, F.M.; Lucisano, G.; Nicolucci, A.; et al. Incidence and risk factors for severe and symptomatic hypoglycemia in type 1 diabetes. Results of the HYPOS-1 study. Acta Diabetol. 2015, 52, 845–853. [Google Scholar] [CrossRef] [PubMed]
- Nematollahi, L.R.; Kitabchi, A.E.; Stentz, F.B.; Wan, J.Y.; Larijani, B.A.; Tehrani, M.M.; Gozashti, M.H.; Omidfar, K.; Taheri, E. Proinflammatory cytokines in response to insulin-induced hypoglycemic stress in healthy subjects. Metabolism 2009, 58, 443–448. [Google Scholar] [CrossRef]
- Kieć-Wilk, B.; Matejko, B.; Razny, U.; Stankiewicz, M.; Skupien, J.; Klupa, T.; Malecki, M.T. Hypoglycemic episodes are associated with inflammatory status in patients with type 1 diabetes mellitus. Atherosclerosis 2016, 251, 334–338. [Google Scholar] [CrossRef] [PubMed]
- Ezcurra, A.L.D.L.; Chertoff, M.; Ferrari, C.; Graciarena, M.; Pitossi, F. Chronic expression of low levels of tumor necrosis factor-α in the substantia nigra elicits progressive neurodegeneration, delayed motor symptoms and microglia/macrophage activation. Neurobiol. Dis. 2010, 37, 630–640. [Google Scholar] [CrossRef] [PubMed]
- Joy, N.G.; Hedrington, M.S.; Briscoe, V.J.; Tate, D.B.; Ertl, A.C.; Davis, S.N. Effects of acute hypoglycemia on inflammatory and pro-atherothrombotic biomarkers in individuals with type 1 diabetes and healthy individuals. Diabetes Care 2010, 33, 1529–1535. [Google Scholar] [CrossRef] [Green Version]
- Jiang, E.; Chapp, A.D.; Fan, Y.; Larson, R.A.; Hahka, T.; Huber, M.J.; Yan, J.; Chen, Q.-H.; Shan, Z. Expression of proinflammatory cytokines is upregulated in the hypothalamic paraventricular nucleus of dahl salt-sensitive hypertensive rats. Front. Physiol. 2018, 9, 104. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Taylor, S.; Mehina, E.; White, E.; Reeson, P.; Yongblah, K.; Doyle, K.P.; Brown, C.E. Suppressing interferon-γ stimulates microglial responses and repair of microbleeds in the diabetic brain. J. Neurosci. 2018, 38, 8707–8722. [Google Scholar] [CrossRef] [PubMed]
- Cozachenco, D.; Selles, M.C.; Ribeiro, F.C. Interferon-γ as a potential link between diabetes mellitus and dementia. J. Neurosci. 2019, 39, 4632–4635. [Google Scholar] [CrossRef] [PubMed]
Gene | Forward Primer (5′–3′) | Reverse Primer (5′–3′) | Accession No. |
---|---|---|---|
TNF-α | CTCTTCTGCCTGCTGCACTTTG | ATGGGCTACAGGCTTGTCACTC | NM_000594 |
IL-1β | CCACAGACCTTCCAGGAGAATG | GTGCAGTTCAGTGATCGTACAGG | NM_000576 |
IL-6 | AGACAGCCACTCACCTCTTCAG | TTCTGCCAGTGCCTCTTTGCTG | NM_000600 |
IFN-γ | GAGTGTGGAGACCATCAAGGAAG | TGCTTTGCGTTGGACATTCAAGTC | NM_000619 |
GAPDH | GAAATCCCATCACCATCTTCCAGG | GAGCCCCAGCCTTCTCCATG | NM_002046 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Al Zoubi, Y.; Mussa, B.M.; Srivastava, A.; Mohammed, A.K.; Abdelgadir, E.; Bashier, A.; Awadi, F.A.; Abusnana, S. Differential Expression of Inflammatory Markers in Hypoglycemia Unawareness Associated with Type 1 Diabetes: A Case Report. Brain Sci. 2021, 11, 17. https://0-doi-org.brum.beds.ac.uk/10.3390/brainsci11010017
Al Zoubi Y, Mussa BM, Srivastava A, Mohammed AK, Abdelgadir E, Bashier A, Awadi FA, Abusnana S. Differential Expression of Inflammatory Markers in Hypoglycemia Unawareness Associated with Type 1 Diabetes: A Case Report. Brain Sciences. 2021; 11(1):17. https://0-doi-org.brum.beds.ac.uk/10.3390/brainsci11010017
Chicago/Turabian StyleAl Zoubi, Yousef, Bashair M. Mussa, Ankita Srivastava, Abdul Khader Mohammed, Elamin Abdelgadir, Alaaeldin Bashier, Fatheya Al Awadi, and Salah Abusnana. 2021. "Differential Expression of Inflammatory Markers in Hypoglycemia Unawareness Associated with Type 1 Diabetes: A Case Report" Brain Sciences 11, no. 1: 17. https://0-doi-org.brum.beds.ac.uk/10.3390/brainsci11010017