Sample-Pooling Strategy for SARS-CoV-2 Detection among Students and Staff of the University of Sannio
Abstract
:1. Introduction
2. Materials and Methods
2.1. Informed Consent
2.2. Swab Collection and Preparation
2.3. SARS-CoV-2 RT-qPCR
3. Results
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
SARS-CoV-2 | Severe Acute Respiratory Syndrome Coronavirus 2 |
WHO | World Health Organization |
RT-qPCR | Reverse Transcription-Quantitative Polymerase Chain Reaction |
IVD | For In Vitro Diagnostic use |
IHD | In-House developed |
COVID-19 | Coronavirus Disease of 2019 |
RP | RNAseP gene |
RdRP | RNA-dependent RNA Polymerase gene |
RdRP/Hel | RNA-dependent RNA Polymerase/Helicase gene |
N | Nucleocapsid Protein gene |
E | Envelope gene |
BSL-2 | Biosafety Level 2 |
CDC | Center for Disease Control and Prevention |
References
- Wang, C.; Horby, P.W.; Hayden, F.G.; Gao, G.F. A novel coronavirus outbreak of global health concern. Lancet 2020, 395, 470–473. [Google Scholar] [CrossRef] [Green Version]
- Huang, C.; Wang, Y.; Li, X.; Ren, L.; Zhao, J.; Hu, Y.; Zhang, L.; Fan, G.; Xu, J.; Gu, X.; et al. Clinical features of patients infected with 2019 novel coronavirus in Wuhan, China. Lancet 2020, 395, 497–506. [Google Scholar] [CrossRef] [Green Version]
- Chan, J.F.; Yuan, S.; Kok, K.H.; To, K.K.; Chu, H.; Yang, J.; Xing, F.; Liu, J.; Yip, C.C.; Poon, R.W.; et al. A familial cluster of pneumonia associated with the 2019 novel coronavirus indicating person-to-person transmission: A study of a family cluster. Lancet 2020, 395, 514–523. [Google Scholar] [CrossRef] [Green Version]
- Naik, R.R.; Shakya, A.K. Therapeutic Strategies in the Management of COVID-19. Front. Mol. Biosci. 2021, 7, 636738. [Google Scholar] [CrossRef]
- Seyed Hosseini, E.; Riahi Kashani, N.; Nikzad, H.; Azadbakht, J.; Hassani Bafrani, H.; Haddad Kashani, H. The novel coronavirus Disease-2019 (COVID-19): Mechanism of action, detection and recent therapeutic strategies. Virology 2020, 551, 1–9. [Google Scholar] [CrossRef]
- Tang, Y.W.; Schmitz, J.E.; Persing, D.H.; Stratton, C.W. Laboratory Diagnosis of COVID-19: Current Issues and Challenges. J. Clin. Microbiol. 2020, 58, e00512-20. [Google Scholar] [CrossRef] [Green Version]
- Vandenberg, O.; Martiny, D.; Rochas, O.; van Belkum, A.; Kozlakidis, Z. Considerations for diagnostic COVID-19 tests. Nat. Rev. Microbiol. 2021, 19, 171–183. [Google Scholar] [CrossRef] [PubMed]
- Corman, V.M.; Landt, O.; Kaiser, M.; Molenkamp, R.; Meijer, A.; Chu, D.K.; Bleicker, T.; Brünink, S.; Schneider, J.; Schmidt, M.L.; et al. Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR. Eurosurveillance 2020, 25, 2000045. [Google Scholar] [CrossRef] [Green Version]
- Zhou, Y.; Pei, F.; Ji, M.; Wang, L.; Zhao, H.; Li, H.; Yang, W.; Wang, Q.; Zhao, Q.; Wang, Y. Sensitivity evaluation of 2019 novel coronavirus (SARS-CoV-2) RT-PCR detection kits and strategy to reduce false negative. PLoS ONE 2020, 15, e0241469. [Google Scholar] [CrossRef]
- Yu, F.; Yan, L.; Wang, N.; Yang, S.; Wang, L.; Tang, Y.; Gao, G.; Wang, S.; Ma, C.; Xie, R.; et al. Quantitative Detection and Viral Load Analysis of SARS-CoV-2 in Infected Patients. Clin. Infect. Dis. 2020, 71, 793–798. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Suo, T.; Liu, X.; Feng, J.; Guo, M.; Hu, W.; Guo, D.; Ullah, H.; Yang, Y.; Zhang, Q.; Wang, X.; et al. ddPCR: A more accurate tool for SARS-CoV-2 detection in low viral load specimens. Emerg. Microbes Infect. 2020, 9, 1259–1268. [Google Scholar] [CrossRef] [PubMed]
- Huber, M.; Schreiber, P.W.; Scheier, T.; Audigé, A.; Buonomano, R.; Rudiger, A.; Braun, D.L.; Eich, G.; Keller, D.I.; Hasse, B.; et al. High Efficacy of Saliva in Detecting SARS-CoV-2 by RT-PCR in Adults and Children. Microorganisms 2021, 9, 642. [Google Scholar] [CrossRef]
- Millioni, R.; Mortarino, C. Test Groups, Not Individuals: A Review of the Pooling Approaches for SARS-CoV-2 Diagnosis. Diagnostics 2021, 11, 68. [Google Scholar] [CrossRef] [PubMed]
- Mulu, A.; Alemayehu, D.H.; Alemu, F.; Tefera, D.A.; Wolde, S.; Aseffa, G.; Seyoum, T.; Habtamu, M.; Abdissa, A.; Bayih, A.G.; et al. Evaluation of sample pooling for screening of SARS CoV-2. PLoS ONE 2021, 16, e0247767. [Google Scholar] [CrossRef]
- Sawicki, R.; Korona-Glowniak, I.; Boguszewska, A.; Stec, A.; Polz-Dacewicz, M. Sample pooling as a strategy for community monitoring for SARS-CoV-2. Sci. Rep. 2021, 11, 3122. [Google Scholar] [CrossRef]
- Brault, V.; Mallein, B.; Rupprecht, J.F. Group testing as a strategy for COVID-19 epidemiological monitoring and community surveillance. PLoS Comput. Biol. 2021, 17, e1008726. [Google Scholar] [CrossRef] [PubMed]
- Chan, J.F.; Yip, C.C.; To, K.K.; Tang, T.H.; Wong, S.C.; Leung, K.H.; Fung, A.Y.; Ng, A.C.; Zou, Z.; Tsoi, H.W.; et al. Improved Molecular Diagnosis of COVID-19 by the Novel, Highly Sensitive and Specific COVID-19-RdRp/Hel Real-Time Reverse Transcription-PCR Assay Validated In Vitro and with Clinical Specimens. J. Clin. Microbiol. 2020, 58, e00310-20. [Google Scholar] [CrossRef] [Green Version]
- Jung, Y.; Park, G.S.; Moon, J.H.; Ku, K.; Beak, S.H.; Lee, C.S.; Kim, S.; Park, E.C.; Park, D.; Lee, J.H.; et al. Comparative Analysis of Primer-Probe Sets for RT-qPCR of COVID-19 Causative Virus (SARS-CoV-2). ACS Infect. Dis. 2020, 6, 2513–2523. [Google Scholar] [CrossRef]
- Genoud, V.; Stortz, M.; Waisman, A.; Berardino, B.G.; Verneri, P.; Dansey, V.; Salvatori, M.; Remes Lenicov, F.; Levi, V. Extraction-free protocol combining proteinase K and heat inactivation for detection of SARS-CoV-2 by RT-qPCR. PLoS ONE 2021, 16, e0247792. [Google Scholar] [CrossRef]
- Vogels, C.B.F.; Watkins, A.E.; Harden, C.A.; Brackney, D.E.; Shafer, J.; Wang, J.; Caraballo, C.; Kalinich, C.C.; Ott, I.M.; Fauver, J.R.; et al. SalivaDirect: A simplified and flexible platform to enhance SARS-CoV-2 testing capacity. Med 2021, 2, 263–280.e6. [Google Scholar] [CrossRef]
- Lohse, S.; Pfuhl, T.; Berkó-Göttel, B.; Rissland, J.; Geißler, T.; Gärtner, B.; Becker, S.L.; Schneitler, S.; Smola, S. Pooling of samples for testing for SARS-CoV-2 in asymptomatic people. Lancet Infect. Dis. 2020, 20, 1231–1232. [Google Scholar] [CrossRef]
- Fereidouni, S.R.; Harder, T.C.; Gaidet, N.; Ziller, M.; Hoffmann, B.; Hammoumi, S.; Globig, A.; Starick, E. Saving resources: Avian influenza surveillance using pooled swab samples and reduced reaction volumes in real-time RT-PCR. J. Virol. Methods 2012, 186, 119–125. [Google Scholar] [CrossRef]
- Quinn, T.C.; Brookmeyer, R.; Kline, R.; Shepherd, M.; Paranjape, R.; Mehendale, S.; Gadkari, D.A.; Bollinger, R. Feasibility of pooling sera for HIV-1 viral RNA to diagnose acute primary HIV-1 infection and estimate HIV incidence. Aids 2000, 14, 2751–2757. [Google Scholar] [CrossRef]
- Polvere, I.; Parrella, A.; Casamassa, G.; D’Andrea, S.; Tizzano, A.; Cardinale, G.; Voccola, S.; Porcaro, P.; Stilo, R.; Vito, P.; et al. Seroprevalence of Anti-SARS-CoV-2 IgG and IgM among Adults over 65 Years Old in the South of Italy. Diagnostics 2021, 11, 483. [Google Scholar] [CrossRef]
- Polvere, I.; Voccola, S.; Cardinale, G.; Fumi, M.; Aquila, F.; Parrella, A.; Madera, J.R.; Stilo, R.; Vito, P.; Zotti, T. A peptide-based assay discriminates individual antibody response to SARS-CoV-2. Genes Dis. 2021. [Google Scholar] [CrossRef]
- Huang, Q.; Liu, Z.; Liao, Y.; Chen, X.; Zhang, Y.; Li, Q. Multiplex fluorescence melting curve analysis for mutation detection with dual-labeled, self-quenched probes. PLoS ONE 2011, 6, e19206. [Google Scholar] [CrossRef] [PubMed]
- Koo, J.R.; Cook, A.R.; Park, M.; Sun, Y.; Sun, H.; Lim, J.T.; Tam, C.; Dickens, B.L. Interventions to mitigate early spread of SARS-CoV-2 in Singapore: A modelling study. Lancet Infect. Dis. 2020, 20, 678–688. [Google Scholar] [CrossRef] [Green Version]
- Rauch, J.N.; Valois, E.; Ponce-Rojas, J.C.; Aralis, Z.; Lach, R.S.; Zappa, F.; Audouard, M.; Solley, S.C.; Vaidya, C.; Costello, M.; et al. Comparison of Severe Acute Respiratory Syndrome Coronavirus 2 Screening Using Reverse Transcriptase-Quantitative Polymerase Chain Reaction or CRISPR-Based Assays in Asymptomatic College Students. JAMA Netw. Open 2021, 4, e2037129. [Google Scholar] [CrossRef] [PubMed]
Primer/Probe Name | Sequence (5′→3′) |
---|---|
2019-nCoV_N1-P | [FAM/VIC]ACCCCGCATTACGTTTGGTGGACC[BHQ1] |
2019-nCoV_N1-F | GACCCCAAAATCAGCGAAA |
2019-nCoV_N1-R | TCTGGTTACTGCCAGTTGAATCTG |
hRP-Probe | [HEX]TTCTGACCTGAAGGCTCTGCGCG[BHQ1] |
hRP-F | AGATTTGGACCTGCGAGCG |
hRP-R | GAGCGGCTGTCTCCACAAGT |
RdRP_SARSr-P2 | [CY5]CAGGTGGAACCTCATCAGGAGATGC[BBQ650] |
RdRP_SARSr-F2 | GTGARATGGTCATGTGTGGCGG |
RdRP_SARSr-R1 | CARATGTTAAASACACTATTAGCATA |
Samples | CT Values | Positivity to SARS-CoV-2 | ||||||
---|---|---|---|---|---|---|---|---|
N IVD | N IHD | N IHD POOL | RdRP/HEL IVD | RdRP IHD | RdRP IHD POOL | E IVD | ||
UNI_2409_276 | 25.93 | 25.87 | 27.96 | 26.61 | 38.37 | 34.35 | N/A | Confirmed |
UNI_2809_015 | 30.06 | 24.39 | 20.06 | 27.95 | 32.70 | 30.45 | 30.94 | Confirmed |
UNI_2809_147 | N/A | 33.76 | 28.77 | N/A | 30.15 | 34.82 | N/A | Not confirmed |
UNI_2809_178 | 24.89 | 19.36 | 19.67 | 26.59 | 24.21 | 23.02 | N/A | Confirmed |
UNI_3009_230 | 25.33 | 24.05 | 22.74 | 28.17 | 30.33 | 44.44 | 17.13 | Confirmed |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Polvere, I.; Silvestri, E.; Sabatino, L.; Giacco, A.; Iervolino, S.; Peluso, T.; Guida, R.; Zerillo, L.; Varricchio, R.; D’Andrea, S.; et al. Sample-Pooling Strategy for SARS-CoV-2 Detection among Students and Staff of the University of Sannio. Diagnostics 2021, 11, 1166. https://0-doi-org.brum.beds.ac.uk/10.3390/diagnostics11071166
Polvere I, Silvestri E, Sabatino L, Giacco A, Iervolino S, Peluso T, Guida R, Zerillo L, Varricchio R, D’Andrea S, et al. Sample-Pooling Strategy for SARS-CoV-2 Detection among Students and Staff of the University of Sannio. Diagnostics. 2021; 11(7):1166. https://0-doi-org.brum.beds.ac.uk/10.3390/diagnostics11071166
Chicago/Turabian StylePolvere, Immacolata, Elena Silvestri, Lina Sabatino, Antonia Giacco, Stefania Iervolino, Teresa Peluso, Rosa Guida, Lucrezia Zerillo, Romualdo Varricchio, Silvia D’Andrea, and et al. 2021. "Sample-Pooling Strategy for SARS-CoV-2 Detection among Students and Staff of the University of Sannio" Diagnostics 11, no. 7: 1166. https://0-doi-org.brum.beds.ac.uk/10.3390/diagnostics11071166