Next Article in Journal
Effects of Soil Properties and Plant Diversity on Soil Microbial Community Composition and Diversity during Secondary Succession
Previous Article in Journal
Effect of Long-Term Nitrogen and Phosphorus Additions on Understory Plant Nutrients in a Primary Tropical Forest
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Forests
Volume 12
Issue 6
10.3390/f12060804
forests-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Development of Genomic SSR for the Subtropical Hardwood Tree Dalbergia hupeana and Assessment of Their Transferability to Other Related Species

by
Changhong Li
†,
Yongqi Zheng
†,
Yu Liu
,
Furong Lin
and
Ping Huang
*
State Key Laboratory of Tree Genetics and Breeding, Key Laboratory of Forest Silviculture and Tree Cultivation National Forestry and Grassland Administration, Research Institute of Forestry, Chinese Academy of Forestry, Beijing 100091, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally.
Forests 2021, 12(6), 804; https://0-doi-org.brum.beds.ac.uk/10.3390/f12060804
Submission received: 11 May 2021 / Revised: 6 June 2021 / Accepted: 10 June 2021 / Published: 18 June 2021
(This article belongs to the Section Genetics and Molecular Biology)
Browse Figures
Versions Notes

Abstract

:
Dalbergia hupeana Hance (D. hupeana) is a precious hardwood tree of the genus Dalbergia. It is one of the few species widely distributed within subtropical areas and is important for timber production and forest restoration. At present, there is little published genetic information on D. hupeana. Therefore, we performed a genome survey using next generation sequencing (NGS) and developed a set of novel genomic SSR (gSSR) markers from the assembled data, and assessed the transferability of these markers to other Dalbergia species in Asia. The results of the genome survey show the genome size of D. hupeana to be about 664 Mb and highly heterozygous. The assembly of sequencing data produced 2,431,997 contigs, and the initial assembly of the NGS data alone resulted in contig N50 of 393 kb with a total of 720 Mb. A total of 127,742 perfect SSR markers were found in the assembled contigs. A total of 37 highly polymorphic and easily genotyped gSSR markers were developed in D. hupeana, while the majority of gSSR markers could be successfully transferred to nine other Dalbergia species in Asia. The transferability rate of gSSR markers was highest in D. balansae, which is more closely related to D. hupeana. Seven gSSR markers were able to be amplified in all tested species. In addition, a preliminary assessment of the genetic diversity of three tree species in the Dalbergia genus suggested a high level of genetic diversity within populations distributed in the subtropical area in China. However, the determination of the global status of their genetic variation still requires further and more comprehensive assessment. Our findings will enable further studies on the genetic diversity, phylogenetics, germplasm characterization, and taxonomy of various Dalbergia species.

1. Introduction

The genus Dalbergia, a member of the Fabaceae family, contains over 250 species distributed across pan-tropical areas of the world [1]. Most species have important economic value because their hardwood is a precious timber in addition to the application of trunk root extracts in the medical field, e.g., as a source of flavonoids and terpenoids. For these reasons, the natural resources of the Dalbergia species have been decreasing in recent decades [2]. The genus Dalbergia was listed in CITES (Convention on International Trade in Endangered Species of Wild Fauna and Flora), and more than one-third of Dalbergia species are considered endangered or critically endangered and included on the red list of the IUCN (International Union for Conservation of Nature), suggesting these species are facing different threats [3,4]. In China, 29 species of the genus Dalbergia were recorded in Flora of China; 14 of these species are endemic, and one has been introduced [5]. A few studies have focused on the genetic diversity of some Dalbergia species [6,7,8,9,10,11]; however, many species have not been studied and the limited availability of molecular markers may be one of the primary reasons for this.
Dalbergia hupeana Hance (D. hupeana) is a large-sized tree species widely distributed in the subtropical areas of China and South Korea [12,13]. This species is a precious hardwood and a broad-leaved tree of economic and ecological value, with applications in timber production and landscape restoration. However, the natural resources of this species are decreasing, and its habitat is also becoming increasingly fragmented, according to a previous report [14]. Genomic knowledge on D. hupeana and an assessment of its genetic resources are lacking.
Molecular markers are a powerful tool for characterizing interspecific and intraspecific genetic variation [15,16,17,18,19]. Thus, cases where the genetic diversity of trees has not been assessed primarily result from a lack of effective molecular markers [20]. Therefore, the development of molecular markers is a key component of the fundamental work required for forest genetic resources (FGR) conservation and management. Simple sequence repeat (SSR) markers are powerful, effective, and economical for the assessment of co-dominant inheritance, with good reproducibility [21,22]. The development of next generation sequencing (NGS) techniques has resulted in a revolution in the field of de novo whole genome assembly and multi-omics of plants [23], and developing genomic or genic SSRs from NGS data is both feasible and affordable [24,25,26].
In the described study, we aimed to uncover genomic knowledge and develop effective SSR markers for D. hupeana by utilizing de novo sequencing to survey and characterize the D. hupeana genome. We then screened and verified a set of genomic SSR (gSSR) by PCR and capillary electrophoresis. Additionally, in order to potentially broaden the scope of application of these markers, their transferability and degree of polymorphism were examined in other related species in the Dalbergia genus and representative populations.

2. Materials and Methods

2.1. Plant Materials

A diploid seedling of D. hupeana, which was collected in Anhui province, was used to perform de novo sequencing. The information of other plant materials in the Dalbergia genus is shown in Table 1. Their fresh leaves were collected, dried, and stored in silica gel at 4 °C. The voucher specimens of Dalbergia species were preserved in the Research Institute of Forestry, Chinese Academy of Forestry. Photographs of the studied species of D. hupeana and its leaves and fruits are shown in Figure 1. Total genomic DNA was extracted from leaf tissue using a DNA extraction kit (NuClean Plant Genomic DNA Kit, CWBIO) according to the manufacturer’s protocol. The concentration of total genomic DNA was examined using a microplate spectrophotometer (Molecular Device, Sunnyvale, CA, USA). The quality of total genomic DNA was verified by electrophoresis on 0.8% agarose gels.

2.2. De Novo Genome Sequencing

Three genomic paired-end libraries with 350 bp insertions were constructed using the Illumina HiSeq platform (Illumina, San Diego, CA, USA) and a diploid seedling of D. hupeana, following the guidance of the standard procedure at Biomarker Technologies Co., Ltd. (Beijing, China). Clean reads were obtained after the filtering and correction of the sequence data, and were relatively accurate for estimating the genome size, heterozygosity rate, and percentage of repetitive content.

2.3. Genome Survey and Assembly

Genome size was estimated using the total length of sequence reads divided by the sequencing depth. The sequencing depth of D. hupeana was calculated based on the k-mer (k = 21) analysis using a Lander–Waterman algorithm, and we estimated the genome size, heterozygosity rate, and percentage of repetitive content using the k-mer method [27]. The genome assembly based on the NGS refined reads (k-mer = 55) was performed using SOAPdenovo with default parameters [28].

2.4. Identification and Verification of gSSR Markers

The sequence-repeat search mode in MISA software (Saxony-Anhalt, Germany. http://pgrc.ipk-gatersleben.de/misa/misa.html, accessed on 12 February 2021) was used to mine candidate SSR markers from all contigs of the draft D. hupeana genome. The following search parameters were set for discovering SSR markers: di-, tri-, tetra-, penta-, and hexa-nucleotide motifs with a minimum of 6, 5, 5, 5, and 5 repeats, respectively. Then, primer pairs that flanked the SSRs were designed using Premier v5.0 (Palo Alto, CA, USA) with the parameters of a 100–300 bp final product length, 18–22 bp primer size, 40–60% GC content, and 55–62 °C annealing temperature, with an optimum annealing temperature of 60 °C. A total of 200 randomly selected candidate gSSR loci were used for preliminary screening, and the corresponding primers were synthesized by Majorbio Biotech (Beijing, China). A total of 8 individuals of D. hupeana from different locations were selected to test the gSSR markers for polymorphism. PCR amplifications were performed in 20 µL reaction volumes as follows: 10 µL of 2 × Taq MasterMix (Aid Lab, Beijing, China), approximately 50 ng of DNA, 5 pmol of reverse primer and 5 pmol of forward primer with the 5′ end labeled with fluorescent dyes (FAM, HEX, ROX, or TAMRA; Ruibiotech, Beijing, China), and sterile double-distilled water added to 20 µL. PCR reactions were performed with a touchdown profile with an initial denaturation at 94 °C for 5 min; 10 cycles of 94 °C for 30 s, 65 °C for 30 s, and 72 °C for 30 s, with a 1 °C decrease in the annealing temperature of each cycle; 35 cycles of 94 °C for 30 s, 55 °C for 30 s, and 72 °C for 30 s; and a final extension at 72 °C for 10 min. The PCR products were detected by an ABI 3730XL capillary electrophoresis analyzer with a GeneScan-500LIZ size standard. Fragments were genotyped for their presence/absence at each locus, and the allele sizes were scored using GeneMaker v2.2.0 (SoftGenetics LIC, State College, PA, USA) and manually checked twice to reduce genotyping errors.

2.5. Transferability to Other Dalbergia Species

Cross-species amplification was tested in another nine Dalbergia species (Table 1) using the polymorphic gSSR markers. The total genomic DNA was extracted from two individuals for each species. PCR amplification was performed, and the methods were conducted as described under the section “Identification and Verification of gSSR markers”.

2.6. Assessment of Genetic Diversity in Different Species

Five populations in the Dalbergia genus (three representing D. hupeana, and one each for D. balansae and D. polyadelpha) were used to test the effectiveness of the developed gSSR markers in the assessment of genetic diversity. The following genetic diversity parameters were calculated using GenALEx v6.502 (Canberra, Australia) [29,30]: the number of observed alleles (Na), the number of effective alleles (Ne), observed heterozygosity (Ho), expected heterozygosity (He), Shannon’s information index (I), and unbiased expected heterozygosity (uHe). The polymorphism information content (PIC) of gSSR markers was calculated using CERVUS v3.0.4 (London, UK) [31].

3. Results

3.1. Genome Survey

Three libraries of paired-end sequences with 350 bp short inserts of individual of D. hupeana were constructed. A total of 120.24 Gb of clean data were obtained, which correspond to an approximately 180-fold coverage of the estimated genome size. The Q20 and Q30 were 97.11% and 92.16%, respectively. All clean data were used for assembly and k-mer analysis; the results show the number of k-mers was 100,590,170,915 and the peak of the depth distribution was 151 for the 21-mer frequency distribution (Figure 2a). The genome size of D. hupeana was estimated as 664 Mbp, the heterozygosity rate was calculated to be 1.00%, the repeat rate was estimated as 42.84%, and an average of 34.93% GC content was determined (Figure 2b). Based on the k-mer curve distribution, a k-mer size = 55 was chosen for assembly with the default parameters in SOAPdenovo, and a total of 2,431,997 raw contigs were produced to assemble a final draft genome of 720 Mb with contig N50 size of 393 kb.

3.2. Development and Verification of gSSR Markers

After filtering, a total of 127,742 perfect SSR markers were found in the assembled contigs. The most abundant motifs were di-nucleotide repeats (88,999), accounting for 69.67%, followed by tri-nucleotide repeats (34,536), accounting for 27.03%. Finally, tetra-nucleotide and penta-nucleotide repeats accounted for 2.41% and 0.61%, respectively. Then, 200 pairs of primers were randomly selected to test the success rate of amplification, and eight individuals of D. hupeana from different sites were randomly chosen for the detection of polymorphisms. As a result, most of the primers yielded clear amplification, with nearly a 57% success rate. However, 37 pairs of primers were successful in revealing abundant polymorphisms, showing clear allelic bands; the characteristics of these gSSRs are shown in Table 2. These gSSR markers were further utilized for population genetic analysis of three wild populations of D. hupeana, and their transferability to other Dalbergia species was tested.

3.3. Transferability of Developed gSSR Markers to Other Dalbergia Species

A total of 37 polymorphic gSSR markers were developed and verified in D. hupeana. All of these gSSR markers were then tested for amplification in nine Dalbergia species for the assessment of cross-species transferability. Among the 37 tested primer pairs, seven gSSR markers (Dhup14, Dhup61, Dhup114, Dhup120, Dhup139, Dhup141, Dhup164) were able to be amplified in all nine tested species, and two gSSR markers failed to yield positive amplicon in any of the other tested Dalbergia species (Table S1). The rates of successful amplification in other Dalbergia species were recorded as between 40.54% and 70.27%. A higher number of gSSR marker sets were successfully amplified in D. balansae (26), D. oliveri (23), D. polyadelpha (21), and D. cochinchinensis (20), with the lowest in D. yunnanensis (15) (Figure 3, Table S1).

3.4. Diversity of gSSR Markers in Dalbergia Populations

In D. hupeana, the number of alleles (Na) ranged from 2 (Dhup129, DJX) to 18 (Dhup106, XX); the effective number of alleles (Ne) varied from 1.342 (Dhup129, DJX) to 10.651 (Dhup133, JY). The Shannon’s information index (I) varied from 0.423 (Dhup129, DJY) to 2.573 (Dhup133, JY). The observed heterozygosity (Ho) varied from 0.033 (Dhup142, DJY) to 0.967 (Dhup78, JY); the expected heterozygosity (He) varied from 0.255 (Dhup129, DJY) to 0.906 (Dhup133, JY). The value of the polymorphism information content (PIC) varied from the minimum of 0.222 (Dhup129, DJY) to the maximum of 0.899 (Dhup133, JY). The average value of PIC among the three populations varied from 0.618 (JY) to 0.711 (XX), and the proportions of gSSR with moderate (0.25 < PIC < 0.5) or high polymorphism (PIC > 0.5) was 81.08% (DJY), 78.38% (JY), and 86.49% (XX), respectively. These findings indicate that the majority of developed gSSR markers showed high polymorphism in D. hupeana populations (Table S2).
A total of 26 of the newly developed gSSR markers were effectively amplified, and all of these gSSR markers were polymorphic in the D. balansae population (n = 27). The number of alleles (Na) varied from 3 (Dhup164) to 15 (Dhup108 and Dhup104), with an average of 7.038. The mean value of PIC was 0.604, ranging from 0.278 (Dhup14) to 0.904 (Dhup108); 18 gSSR markers were shown to be highly informative (Table S3). The observed heterozygosity (Ho) ranged from 0.074 to 0.885, and the expected heterozygosity (He) ranged from 0.294 to 0.911, with a mean of 0.467 and 0.635, respectively (Table S3).
A total of 22 of the newly developed gSSR markers proved to be effectively amplified in the D. polyadelpha population (n = 27). A total of 21 gSSR markers were polymorphic, except Dhup120. The number of alleles (Na) varied from 2 (Dhup78, Dhup144, Dhup181 and Dhup183) to 14 (Dhup122) with an average of 5.091 per locus. The mean value PIC was 0.471, ranging from 0.071 (Dhup70) to 0.879 (Dhup122). A total of 11 gSSR markers were shown to be highly informative in D. polyadelpha. The observed heterozygosity (Ho) ranged from 0.037 to 0.889, and the expected heterozygosity varied from 0.072 to 0.889, with a mean of 0.399 and 0.512, respectively (Table S3).

4. Discussion

The Dalbergia species are good sources of precious timber; a few tree species have been identified as rosewood, and genetic research has been performed on them. The genetic diversity of endangered species and their phylogenetic relationships have been unveiled through studies using molecular markers and DNA sequences [6,7,8,9,10,11]. However, many species in the Dalbergia genus have not been investigated, especially subtropical species, which are good sources of hardwood and also face threats from climate change and human activity [32,33,34,35]. The development of effective and powerful molecular markers will be conducive to facilitating research on these species. SSR markers are one of the most powerful DNA markers for genetic research because of the co-dominant inheritance of SSRs and their amenability to genotyping. The development of NGS techniques has made it easier to acquire more genetic information and develop SSR markers. In this current study, the genomic information of D. hupeana was obtained using NGS. The results indicate that the D. hupeana genome has high heterozygosity with a medium number of repetitions of medium size. Combined with Hi-C technology, the most up-to-date third-generation sequencing (Circular Consensus Sequencing, CCS) has the potential to assemble a high-quality and chromosome-level reference genome [36,37]. Using the acquired sequence information, genomic SSRs were mined, characterized, and evaluated in D. hupeana. Dinucleotide repeats were observed to be the most abundant type of repeat motif in the genome. Trinucleotide repeats are also one of the most abundant repetition motifs in genes for tree or fruit species because they are less likely to lead to frameshifts in the coding sequence [38]. The PIC value is a considerable parameter showing the power of a molecular marker. It is generally acknowledged that molecular markers with PIC > 0.5 are defined as highly polymorphic [39]. Most of the developed gSSR markers show high polymorphism in D. hupeana according to the PIC value of each locus. This indicates that these gSSR markers have good potential to detect genetic variation, being useful for further population genetic analyses of this species.
Previous reports indicate that SSR markers are transferable among closely related species in plants [40,41]. In the Dalbergia genus, several SSR markers from D. nigra and D. monticola were transferrable to other Dalbergia species in South America [42]. It is generally known that the amplification conditions affect the efficacy and fidelity of PCR [43]. In this study, the majority of high polymorphic gSSR markers could be successfully transferred from D. hupeana to other Dalbergia species in Asia. Only two gSSR markers in D. hupeana could not be amplified in the other nine species, and seven gSSR makers could be amplified in all tested species. The transferability rates ranged from 40% (D. yunnanensis) to 70% (D. balansae). The transfer success rate seems to be related to consanguinity in accordance with the inferred phylogenetic relationships in the Dalbergia genus [34,44,45,46]. These results indicate high conservation of the primer binding sites in the genome of the 10 selected Dalbergia taxa assayed in the present study, and these gSSR markers may have great potential in phylogenetic and evolutionary studies of Dalbergia populations. Finally, we selected natural populations from three Dalbergia species to assess their genetic diversity using the developed gSSRs. The results show that, compared to D. hupeana, the average number of alleles (Na) in D. balansae was similar, while that of D. polyadelpha was lower. A higher expected heterozygosity (He) may indicate abundant genetic diversity within populations of D. hupeana and D. balansae; these values were similar to those of D. oliveri (mean He = 0.73) [47]. However, Ho was lower than He, suggesting these populations may have experienced isolation, genetic drift, or inbreeding, though further population genetic studies would be needed before making any conclusions.

5. Conclusions

We performed a genome survey in D. hupeana to gain knowledge on the structure of its genome. The k-mer analysis suggested that the genome of D. hupeana is medium sized and highly heterozygous. The assembled data were also utilized to screen and develop a set of novel gSSR markers, which showed high polymorphism and ease of genotyping. The majority of gSSR markers could be successfully transferred to other Dalbergia species and their populations in Asia. These findings will enable further studies on genetic diversity, phylogenetics, germplasm characterization, and taxonomy of various species of the genus Dalbergia.

Supplementary Materials

The following are available online at https://0-www-mdpi-com.brum.beds.ac.uk/article/10.3390/f12060804/s1, Table S1. Cross-species transferability of developed gSSR markers in different Dalbergia species, Table S2. Parameters of genetic diversity for D. hupeana populations at loci level, Table S3. Parameters of genetic diversity for D. balansae and D. polyadelpha populations at loci level. Another Supplementary Materials includes all the electropherograms and DNA matrix in this study.

Author Contributions

Conceptualization, Y.Z. and P.H.; methodology, C.L., Y.L. and P.H.; formal analysis, C.L.; investigation, C.L. and Y.L.; resources, F.L.; writing—original draft preparation, C.L. and P.H.; writing—review and editing, Y.Z. and P.H.; supervision, Y.Z.; funding acquisition, Y.Z. and P.H. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China (No.31761143002; No.3207141079) and Special Funds for the Laboratory of Forest Silviculture and Tree Cultivation, National Forestry and Grassland Administration (No. ZDRIF201713).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Acknowledgments

We thank the National Forestry and Grassland Genetic Resources Center (Beijing, China) for support related to the plant material.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Klitgaard, B.; Lavin, M. Tribe Dalbergieae sens. Lat. In Legumes of the World; Royal Botanic Gardens: Kew, UK, 2005; pp. 307–335. [Google Scholar]
  2. Winfield, K.; Grayson, C.; Scott, M. Cites cop17 information document 48—Global status of Dalbergia and Pterocarpus rosewood producing species in trade. In Proceedings of the Convention on International Trade in Endangered Species 17th Conference of Parties–Johannesburg, Johannesburg, South Africa, 24 September–5 October 2016; pp. 1–246. [Google Scholar]
  3. CITES. Appendices I, II and III. 2017. Available online: https://cites.org/eng/app/appendices.php (accessed on 14 February 2021).
  4. IUCN. The IUCN Red List of Threatened Species. Version 2021-1. 2021. Available online: Https://www.Iucnredlist.Org (accessed on 1 January 2021).
  5. Chen, D.; Zhang, D.; Larsen, K. Tribe dalbergieae. Flora China 2010, 10, 121–130. [Google Scholar]
  6. Ribeiro, R.A.; Rezende, M.F.; Resende, L.C.; LEMOS-FILHO, J.P.; Kalapothakis, E.; Lovato, M.B. Development of polymorphic microsatellite markers for Dalbergia nigra (papilionoideae), an endangered tree from the Brazilian Atlantic forest. Mol. Ecol. Resour. 2009, 9, 203–206. [Google Scholar] [CrossRef]
  7. Resende, L.C.; Ribeiro, R.A.; Lovato, M.B. Diversity and genetic connectivity among populations of a threatened tree (Dalbergia nigra) in a recently fragmented landscape of the Brazilian Atlantic forest. Genetica 2011, 139, 1159–1168. [Google Scholar] [CrossRef]
  8. Leite, F.A.B.; Brandão, R.L.; de Oliveira Buzatti, R.S.; de Lemos-Filho, J.P.; Lovato, M.B. Fine-scale genetic structure of the threatened rosewood Dalbergia nigra from the Atlantic forest: Comparing saplings versus adults and small fragment versus continuous forest. Tree Genet. Genomes 2014, 10, 307–316. [Google Scholar] [CrossRef]
  9. Moritsuka, E.; Chhang, P.; Tagane, S.; Toyama, H.; Sokh, H.; Yahara, T.; Tachida, H. Genetic variation and population structure of a threatened timber tree Dalbergia cochinchinensis in Cambodia. Tree Genet. Genomes 2017, 13, 1–11. [Google Scholar] [CrossRef]
  10. Phong, D.T.; Hien, V.; Thanh, T.; Tang, D.V. Comparison of rapd and ISSR markers for assessment of genetic diversity among endangered rare Dalbergia oliveri (fabaceae) genotypes in Vietnam. Genet. Mol. Res. GMR 2011, 10, 2382–2393. [Google Scholar] [CrossRef]
  11. Liu, F.; Hong, Z.; Xu, D.; Jia, H.; Zhang, N.; Liu, X.; Yang, Z.; Lu, M. Genetic diversity of the endangered Dalbergia odorifera revealed by SSR markers. Forests 2019, 10, 225. [Google Scholar] [CrossRef] [Green Version]
  12. Choi, I.S.; Jin, D.P.; An, S.J.; Choi, B.H. A new distribution of Dalbergia hupeana hance (fabaceae) in Korea and its taxonomic characteristics. Korean J. Plant Taxon. 2015, 45, 22–28. [Google Scholar] [CrossRef]
  13. Li, S.J. Dalbergia in Asia; Science Press: Beijing, China, 2017; pp. 1–371. [Google Scholar]
  14. Kong, h. Value utilization and breeding technology of native sandalwood species of Dalbergia hupeana in eastern Anhui. Consum. Guide 2015, 10, 314. [Google Scholar]
  15. Tang, R.H.; Zhuang, W.J.; Gao, G.Q.; Liang-Qiong, H.E.; Han, Z.Q.; Shan, S.H.; Jiang, J.; Yang-Rui, L.I. Phylogenetic relationships in genus arachis based on SSR and AFLP markers. Agric. Sci. China 2008, 7, 405–414. [Google Scholar] [CrossRef]
  16. Li, N.; Yao, Y.Y.; Chen, Y.L.; Liang, X.M.; Yang, D.J. Evaluation of genetic diversity and population structure of genus tripterygium based on SSR markers. Acta Pharm. Sin. 2017, 52, 153–161. [Google Scholar]
  17. Yousaf, Z.; Hu, W.; Zhang, Y.; Zeng, S.; Wang, Y. Exploration of genetic diversity among medicinally important genus epimedium species based on genomic and EST-SSR marker. Nat. Prod. Res. Former. Nat. Prod. Lett. 2015, 29, 1020–1025. [Google Scholar]
  18. Wu, X.L.; He, C.Y.; Chen, S.Y.; Zhuang, B.C.; Wang, X.C. Phylogenetic analysis of interspecies in genus glycine through SSR markers. Acta Genet. Sin. 2001, 28, 359–366. [Google Scholar]
  19. Schroeder, H.; Fladung, M. Ssr and snp markers for the identification of clones, hybrids and species within the genus populus. Silvae Genet. 2010, 59, 257–263. [Google Scholar] [CrossRef] [Green Version]
  20. Sun, R.; Lin, F.; Huang, P.; Zheng, Y. Moderate genetic diversity and genetic differentiation in the relict tree Liquidambar formosana hance revealed by genic simple sequence repeat markers. Front. Plant Sci. 2016, 7, 1411. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  21. Maguire, T.L.; Saenger, R.P. Comparative analysis of genetic diversity in the mangrove species Avicennia marina (Forsk.) vierh. (Avicenniaceae) detected by AFLPs and SSRs. TAG Theor. Appl. Genet. 2002, 104, 388–398. [Google Scholar] [CrossRef]
  22. Powell, W.; Machray, G.C.; Provan, J. Polymorphism revealed by simple sequence repeats. Trends Plant Sci. 1996, 1, 215–222. [Google Scholar] [CrossRef]
  23. Davey, J.W.; Hohenlohe, P.A.; Etter, P.D.; Boone, J.Q.; Catchen, J.M.; Blaxter, M.L. Genome-wide genetic marker discovery and genotyping using next-generation sequencing. Nat. Rev. Genet. 2011, 12, 499–510. [Google Scholar] [CrossRef]
  24. Motalebipour, E.Z.; Kafkas, S.; Khodaeiaminjan, M.; Coban, N.; Gözel, H. Genome survey of pistachio (Pistacia vera L.) by next generation sequencing: Development of novel SSR markers and genetic diversity in pistacia species. BMC Genom. 2016, 17, 3359-X. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  25. Wang, R.; Fan, J.; Chang, P.; Zhu, L.; Zhao, M.; Li, L. Genome survey sequencing of acer truncatum bunge to identify genomic information, simple sequence repeat (SSR) markers and complete chloroplast genome. Forests 2019, 10, 87. [Google Scholar] [CrossRef] [Green Version]
  26. Salgado, L.R.; Koop, D.M.; Pinheiro, D.G.; Rivallan, R.; Le Guen, V.; Nicolás, M.F.; de Almeida, L.G.P.; Rocha, V.R.; Magalhães, M.; Garcia, D.; et al. De novo transcriptome analysis of Hevea brasiliensis tissues by rna-seq and screening for molecular markers. BMC Genom. 2014, 15, 236. [Google Scholar] [CrossRef] [Green Version]
  27. Vurture, G.W.; Sedlazeck, F.J.; Nattestad, M.; Underwood, C.J.; Fang, H.; Gurtowski, J.; Schatz, M.C. Genomescope: Fast reference-free genome profiling from short reads. Bioinformatics 2017, 33, 2202–2204. [Google Scholar] [CrossRef] [Green Version]
  28. Li, R.; Li, Y.; Kristiansen, K.; Wang, J. Soap: Short oligonucleotide alignment program. Bioinformatics 2008, 24, 713–714. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  29. Peakall, R.; Smouse, P.E. Genalex 6: Genetic analysis in excel. Population genetic software for teaching and research. Mol. Ecol. Notes 2010, 6, 288–295. [Google Scholar] [CrossRef]
  30. Peakall, R.; Smouse, P.E. Genalex 6.5: Genetic analysis in excel. Population genetic software for teaching and research—An update. Bioinformatics 2012, 28, 2537–2539. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  31. Kalinowski, S.T.; Taper, M.L.; Marshall, T.C. Revising how the computer program cervus accommodates genotyping error increases success in paternity assignment. Mol. Ecology 2007, 16, 1099–1106. [Google Scholar] [CrossRef]
  32. Hughes, L. Biological consequences of global warming: Is the signal already apparent? Trends Ecol. Evol. 2000, 15, 56–61. [Google Scholar] [CrossRef]
  33. Smith, J.B.; Schneider, S.H.; Oppenheimer, M.; Yohe, G.W.; Hare, W.; Mastrandrea, M.D.; Patwardhan, A.; Burton, I.; Corfee-Morlot, J.; Magadza, C.H.D.; et al. Assessing dangerous climate change through an update of the intergovernmental panel on climate change (IPCC) “reasons for concern”. Proc. Natl. Acad. Sci. USA 2009, 106, 4133–4137. [Google Scholar] [CrossRef] [Green Version]
  34. Vatanparast, M.; Klitgård, B.B.; Adema, F.A.C.B.; Pennington, R.T.; Yahara, T.; Kajita, T. First molecular phylogeny of the pantropical genus Dalbergia: Implications for infrageneric circumscription and biogeography. S. Afr. J. Bot. 2013, 89, 143–149. [Google Scholar] [CrossRef] [Green Version]
  35. Hassold, S.; Lowry, P.P., II; Bauert, M.R.; Razafintsalama, A.; Ramamonjisoa, L.; Widmer, A. DNA barcoding of malagasy rosewoods: Towards a molecular identification of cites-listed Dalbergia species. PLoS ONE 2016, 11, e0157881. [Google Scholar] [CrossRef] [Green Version]
  36. Wenger, A.M.; Peluso, P.; Rowell, W.J.; Chang, P.C.; Hunkapiller, M.W. Accurate circular consensus long-read sequencing improves variant detection and assembly of a human genome. Nat. Biotechnol. 2019, 37, 1155–1162. [Google Scholar] [CrossRef]
  37. Nurk, S.; Walenz, B.P.; Rhie, A.; Vollger, M.R.; Koren, S. Hicanu: Accurate assembly of segmental duplications, satellites, and allelic variants from high-fidelity long reads. Genome Res. 2020, 30, 1291–1305. [Google Scholar] [CrossRef]
  38. Song, X.; Li, N.; Guo, Y.; Bai, Y.; Wu, T.; Yu, T.; Feng, S.; Zhang, Y.; Wang, Z.; Liu, Z.; et al. Comprehensive identification and characterization of simple sequence repeats based on the whole-genome sequences of 14 forest and fruit trees. For. Res. 2021, 1, 7. [Google Scholar]
  39. Botstein, D.; White, R.L.; Skolnick, M.; Davis, R.W. Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Am. J. Hum. Genet. 1980, 32, 314. [Google Scholar] [PubMed]
  40. Bazzo, B.R.; Carvalho, L.; Carazzolle, M.F.; Pereira, G.; Colombo, C.A. Development of novel EST-SSR markers in the macaúba palm (Acrocomia aculeata) using transcriptome sequencing and cross-species transferability in arecaceae species. BMC Plant Biol. 2018, 18, 276. [Google Scholar] [CrossRef]
  41. Wang, C.; Yan, H.; Ji, L.; Zhou, S.; Liu, T.; Zhang, X.; Huang, L. Genome survey sequencing of purple elephant grass (Pennisetum purpureum schum ‘zise’) and identification of its SSR markers. Mol. Breed. 2018, 38, 94. [Google Scholar] [CrossRef]
  42. Buzatti, R.S.D.O.; Chicata, F.S.L.; Lovato, M.B. Transferability of microsatellite markers across six Dalbergia (fabaceae) species and their characterization for Dalbergia miscolobium. Biochem. Syst. Ecol. 2016, 69, 161–165. [Google Scholar] [CrossRef]
  43. Varshney, R.K.; Graner, A.; Sorrells, M.E. Genic microsatellite markers in plants: Features and applications. Trends Biotechnol. 2005, 23, 48–55. [Google Scholar] [CrossRef]
  44. Cui, F. Molecular Phylogenetics of Dalbergia L. F. (Leguminosae); University of Chinese Academy of Science: Beijing, China, 2014. [Google Scholar]
  45. Lavin, M.; Pennington, R.T.; Klitgaard, B.B.; Sprent, J.I.; Lima, H.D.; Gasson, P.E. The Dalbergioid legumes (fabaceae): Delimitation of a pantropical monophyletic clade. Am. J. Bot. 2001, 88, 503. [Google Scholar] [CrossRef]
  46. Ribeiro, R.A.; Lavin, M.; Lemos-Filho, J.P.; Filho, C.V.M.A.; Santos, F.b.C.R.D.; Lovato, M.B. The genus Machaerium (leguminosae) is more closely related to Aeschynomene sect. Ochopodium than to Dalbergia: Inferences from combined sequence data. Syst. Bot. 2007, 32, 762–771. [Google Scholar] [CrossRef]
  47. Hartvig, I.; So, T.; Changtragoon, S.; Tran, H.T.; Bouamanivong, S.; Theilade, I.; Kjaer, E.D.; Nielsen, L.R. Population genetic structure of the endemic rosewoods Dalbergia cochinchinensis and D. oliveri at a regional scale reflects the indochinese landscape and life-history traits. Ecol. Evol. 2018, 8, 530–545. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Forests 12 00804 g001 550
Figure 1. Photographs of the studied species D. hupeana depicting its (a) habitat in China and (b) leaves and fruits.
Figure 1. Photographs of the studied species D. hupeana depicting its (a) habitat in China and (b) leaves and fruits.
Forests 12 00804 g001
Forests 12 00804 g002 550
Figure 2. Diagram showing k-mer distribution, GC content, and average sequencing depth: (a) 21 k-mers for estimating the genome size of D. hupeana. (b) For scatter plots, the X-axis represents GC content and the Y-axis represents the average depth. For the histograms, the X-axis represents the GC content and the Y-axis represents the frequency distribution of sequencing depth.
Figure 2. Diagram showing k-mer distribution, GC content, and average sequencing depth: (a) 21 k-mers for estimating the genome size of D. hupeana. (b) For scatter plots, the X-axis represents GC content and the Y-axis represents the average depth. For the histograms, the X-axis represents the GC content and the Y-axis represents the frequency distribution of sequencing depth.
Forests 12 00804 g002
Forests 12 00804 g003 550
Figure 3. Cross-species transferability of gSSR markers developed in D. hupeana.
Figure 3. Cross-species transferability of gSSR markers developed in D. hupeana.
Forests 12 00804 g003
Table
Table 1. Information of plant materials of the Dalbergia genus collected in this study.
Table 1. Information of plant materials of the Dalbergia genus collected in this study.
NameBiotypeLocationNo. Individuals
D. balansaetreeYingjiang, Yunnan, China29
D. cultratatreePuer, Yunnan, China2
D. hupeanatreeJiangyou, Sichuan, China (JY)30
D. hupeanatreeXixiang, Shanxi, China (XX)30
D. hupeanatreeDujiangyan, Sichuan, China (DJY)30
D. mimosoidesvineTongren, Guizhou, China2
D. odoriferatreeJiulongling, Fujian, China2
D. polyadelphatreeLongling, Yunnan, China29
D. sissootreeYunnan, China2
D. yunnanensisshrubPanzhihua, Sichuan, China2
D. cochinchinensistreeJiulongling, Fujian, China2
D. oliveritreeJianfengling, Hainan, China2
Table
Table 2. Characteristics of 37 gSSR markers designed for D. hupeana in this study.
Table 2. Characteristics of 37 gSSR markers designed for D. hupeana in this study.
NameRepeat MotifForward Primer Sequence (5′–3′)Reverse Primer Sequence (5′–3′)Tm(°C)Size Range (bp)Fluorescence Dye
Dhup14(TCT)5TCACAAAGGTATGCATTTCCCTATACGCTTGGCATTTGCAG59207~219FAM
Dhup61(GGA)11GGTCGAAGTGGGAATCGAAGATTCTCCCTCCCTTGCTCAT60102~120FAM
Dhup64(TTA)9AGTTAGGTGCACCACAGCCTTCTATGCCGATGTTTCCCTC59158~188FAM
Dhup70(TTA)14AAGCAACGGAACAATATGAAAAATTATTATCACCCACCGCACA59203~248FAM
Dhup78(ATT)10AGTATCCATCCCTGGGTTCCGTGGGTGGCGTACTGTTTTT59257~284FAM
Dhup89(TA)20TACCGTTGGATGTGATGGTGATGCTTCCTGCACCCTAGAA59143~177FAM
Dhup90(AAT)12TCCGATATGCAAACATGAGCAATCACGTGGCTTTGATTCC59222~255FAM
Dhup104(AG)14TGGACCACCCATGATAGTGAGGAACAATAGAAACAAAACACGG59108~154FAM
Dhup106(AT)14CATTTGGCATATAACATGTCGGGCAACAGTGTAACTGATGTTGCT59115~165FAM
Dhup108(TC)14CCCCCTTAAAACTTGCTTCACTGATGAGTGGGAAAACGGT59117~153FAM
Dhup114(GGC)8TATTTTTGCGATCGTTGCTGGCTCGCGGTCATGTAGACTT59116~143FAM
Dhup115(AAG)10TGAAAATGGAGAATGGGGAGGATACACACGGGAAAATCGG59115~142FAM
Dhup116(AAT)8ATTTCATTCTCTCGCGCTGTCAAATTTGTGAGCACATGATGA59127~157FAM
Dhup118(AAG)7TTGATCCAAGGGCGAGTAACGTGGGCTCTTGTTGTTGTGA59128~149FAM
Dhup120(AAT)8TGAATTTTCTCGGCAAGAGCTTCCTTCTTTCTCACGGACC60124~154FAM
Dhup122(AAT)8GAATGAGCTGATGGTGAAGGAACATTAATACCTTATTCCTCAATTCTG58133~154FAM
Dhup123(AAG)7TGAGTGAGAGAAAGATAGATCAACGCCAACGAAACCTGTTTCACA59135~168FAM
Dhup125(AAG)7TGTCTCGTTTCTCTCTCTCATCCTTTGTGCGCTACCAACAGAG60133~157FAM
Dhup129(TA)14TGTGGTCGATGAAGACTTGGGCCAGCTATGTGTGAAGTGC59174~188HEX
Dhup130(GA)13AAGCACGAATTAAATTTCTTGGAAGAGAGTGTTGGTGGTTGGG59228~276HEX
Dhup132(AT)14TTGGGTGCATTGTGATTTGTACCATCTGGGCAGTGATAGC59195~233HEX
Dhup133(AT)14CAATACTAATGCAACAAAATTCAAACCCGCAATGAGAATAGGAAA58199~243HEX
Dhup139(AAT)8CCCCGGCACTCTCTATATCAACTGCGTATCCTTTGCTGCT60181~199HEX
Dhup141(TTG)8CCACCGTGAAAGTAGACCAAGCCTTCCCTTGAGGACCCTAC59187~205HEX
Dhup142(CAA)10TTTGAGGCCAACCTTCAAATACGAGTGGAGTGAAGTGCAA59200~221HEX
Dhup144(AAT)8AACAAATTCAAACCAAACCGATCCAAAGTAGGGCTTGAAAAA59184~217HEX
Dhup153(AG)14ACTTGTGTCACGTTCGTCCACTGCTTCCTCTGCTTCTGCT60251~293ROX
Dhup159(TA)14TTTCAGATGCTAGAGTGTGTGTGCGTGTGCCTAAATTCTTAACCG58206~250ROX
Dhup163(TTG)8ACGAAACCCTAGCCCTTGTTCAACGAACCTCTTGAAAGGC59228~255ROX
Dhup164(AAG)7AATTGCACAACAATCCAGCACGGATTATCTCCGAAAACGA60233~254ROX
Dhup167(AAT)8AAAGGCTGAGAGGAAAAGGCTCTAAATTAAAGGATTTTTCAGTTGAT57232~250ROX
Dhup171(GAG)8GTTGCCGGTACCTTCATCATGTCACGATCAAAGTCGGGTT59228~249ROX
Dhup181(AT)14CCACCAGCAAATAGCTCACAGGATTCCGAACTTGGAAGAA59271~293TAMRA
Dhup183(AT)14GCAGACATGGTGGTTTCAGACGATATTATCACATTTTAAAGACTTGG58272~324TAMRA
Dhup185(AT)14GTGCCAAGTACAACTGCGAATCACACTTAGCCACCCTTATGA59258~308TAMRA
Dhup191(AAT)8GTGATGGTCACGTCATTTGCTTTCTCACCGCCGTTAACTT59279~303TAMRA
Dhup194(AAT)8AACGATTGATCTCTTGGTCATGTTGTCGGTGTCTATCAATTCCC59247~292TAMRA
Note: Tm, annealing temperature.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Li, C.; Zheng, Y.; Liu, Y.; Lin, F.; Huang, P. Development of Genomic SSR for the Subtropical Hardwood Tree Dalbergia hupeana and Assessment of Their Transferability to Other Related Species. Forests 2021, 12, 804. https://0-doi-org.brum.beds.ac.uk/10.3390/f12060804

AMA Style

Li C, Zheng Y, Liu Y, Lin F, Huang P. Development of Genomic SSR for the Subtropical Hardwood Tree Dalbergia hupeana and Assessment of Their Transferability to Other Related Species. Forests. 2021; 12(6):804. https://0-doi-org.brum.beds.ac.uk/10.3390/f12060804

Chicago/Turabian Style

Li, Changhong, Yongqi Zheng, Yu Liu, Furong Lin, and Ping Huang. 2021. "Development of Genomic SSR for the Subtropical Hardwood Tree Dalbergia hupeana and Assessment of Their Transferability to Other Related Species" Forests 12, no. 6: 804. https://0-doi-org.brum.beds.ac.uk/10.3390/f12060804

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop