Study of the Mechanism Underlying the Onset of Diabetic Xeroderma Focusing on an Aquaporin-3 in a Streptozotocin-Induced Diabetic Mouse Model
Abstract
:1. Introduction
2. Results
2.1. Dermal Water Content and Transepidermal Water Loss (TEWL)
2.2. Expression Levels of AQP3 in the Skin
2.3. Relationship between the Blood Glucose Level and Skin AQP3 Expression Level
2.4. Expression Levels of Bmal1, Clock, and D Site-Binding Protein (Dbp) in the Skin
2.5. Urinary 8-Hydroxydeoxyguanosine (8-OHdG) Level
3. Discussion
4. Materials and Methods
4.1. Animals and Treatments
4.2. Blood and Urine Analyses
4.3. HE Staining
4.4. Real-Time RT-PCR
4.5. Preparation of Samples for Western Blotting
4.6. Electrophoresis and Western Blotting
4.7. Immunohistochemistry
4.8. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
Abbreviations
8-OHdG | 8-hydroxydeoxyguanosine |
AQPs | Aquaporins |
Dbp | D site-binding protein |
DWC | Dermal water content |
GAPDH | Glyceraldehyde-3-phosphate dehydrogenase |
PPAR | Peroxisome proliferator-activated receptor |
SD | Standard deviation |
SOD | Superoxide dismutase |
STZ | Streptozotocin |
TEWL | Transepidermal water loss |
References
- Ogurtsova, K.; da Rocha Fernandes, J.D.; Huang, Y.; Linnenkamp, U.; Guariguata, L.; Cho, N.H.; Cavan, D.; Shaw, J.E.; Makaroff, L.E. IDF Diabetes Atlas: Global estimates for the prevalence of diabetes for 2015 and 2040. Diabetes Res. Clin. Pract. 2017, 128, 40–50. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Demirseren, D.D.; Emre, S.; Akoglu, G.; Arpaci, D.; Arman, A.; Metin, A.; Cakir, B. Relationship between skin diseases and extracutaneous complications of diabetes mellitus: Clinical analysis of 750 patients. Am. J. Clin. Dermatol. 2014, 15, 65–70. [Google Scholar] [CrossRef] [PubMed]
- De Macedo, G.M.; Nunes, S.; Barreto, T. Skin disorders in diabetes mellitus: An epidemiology and physiopathology review. Diabetol. Metab. Syndr. 2016, 8, 63. [Google Scholar] [CrossRef] [PubMed]
- Sakai, S.; Kikuchi, K.; Satoh, J.; Tagami, H.; Inoue, S. Functional properties of the stratum corneum in patients with diabetes mellitus: Similarities to senile xerosis. Br. J. Dermatol. 2005, 153, 319–323. [Google Scholar] [CrossRef] [PubMed]
- Nowotny, K.; Jung, T.; Hohn, A.; Weber, D.; Grune, T. Advanced glycation end products and oxidative stress in type 2 diabetes mellitus. Biomolecules 2015, 5, 194–222. [Google Scholar] [CrossRef] [PubMed]
- Hara, M.; Ma, T.; Verkman, A.S. Selectively reduced glycerol in skin of aquaporin-3-deficient mice may account for impaired skin hydration, elasticity, and barrier recovery. J. Biol. Chem. 2002, 277, 46616–46621. [Google Scholar] [CrossRef]
- Ikarashi, N.; Kon, R.; Kaneko, M.; Mizukami, N.; Kusunoki, Y.; Sugiyama, K. Relationship between Aging-Related Skin Dryness and Aquaporins. Int. J. Mol. Sci. 2017, 18, 1559. [Google Scholar] [CrossRef]
- Lee, Y.; Je, Y.J.; Lee, S.S.; Li, Z.J.; Choi, D.K.; Kwon, Y.B.; Sohn, K.C.; Im, M.; Seo, Y.J.; Lee, J.H. Changes in transepidermal water loss and skin hydration according to expression of aquaporin-3 in psoriasis. Ann. Dermatol. 2012, 24, 168–174. [Google Scholar] [CrossRef]
- Kim, N.H.; Lee, A.Y. Reduced aquaporin3 expression and survival of keratinocytes in the depigmented epidermis of vitiligo. J. Investig. Dermatol. 2010, 130, 2231–2239. [Google Scholar] [CrossRef]
- Lee, A.Y. Role of keratinocytes in the development of vitiligo. Ann. Dermatol. 2012, 24, 115–125. [Google Scholar] [CrossRef]
- Olsson, M.; Broberg, A.; Jernas, M.; Carlsson, L.; Rudemo, M.; Suurkula, M.; Svensson, P.A.; Benson, M. Increased expression of aquaporin 3 in atopic eczema. Allergy 2006, 61, 1132–1137. [Google Scholar] [CrossRef] [PubMed]
- Luo, J.; Liu, X.; Liu, J.; Jiang, M.; Luo, M.; Zhao, J. Activation of TGF-beta1 by AQP3-Mediated H2O2 Transport into Fibroblasts of a Bleomycin-Induced Mouse Model of Scleroderma. J. Investig. Dermatol. 2016, 136, 2372–2379. [Google Scholar] [CrossRef] [PubMed]
- Hara-Chikuma, M.; Verkman, A.S. Prevention of skin tumorigenesis and impairment of epidermal cell proliferation by targeted aquaporin-3 gene disruption. Mol. Cell. Biol. 2008, 28, 326–332. [Google Scholar] [CrossRef] [PubMed]
- Ma, T.; Song, Y.; Yang, B.; Gillespie, A.; Carlson, E.J.; Epstein, C.J.; Verkman, A.S. Nephrogenic diabetes insipidus in mice lacking aquaporin-3 water channels. Proc. Natl. Acad. Sci. USA 2000, 97, 4386–4391. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rodriguez, A.; Catalan, V.; Gomez-Ambrosi, J.; Garcia-Navarro, S.; Rotellar, F.; Valenti, V.; Silva, C.; Gil, M.J.; Salvador, J.; Burrell, M.A.; et al. Insulin- and leptin-mediated control of aquaglyceroporins in human adipocytes and hepatocytes is mediated via the PI3K/Akt/mTOR signaling cascade. J. Clin. Endocrinol. Metab. 2011, 96, E586–E597. [Google Scholar] [CrossRef] [PubMed]
- Rodriguez, A.; Gena, P.; Mendez-Gimenez, L.; Rosito, A.; Valenti, V.; Rotellar, F.; Sola, I.; Moncada, R.; Silva, C.; Svelto, M.; et al. Reduced hepatic aquaporin-9 and glycerol permeability are related to insulin resistance in non-alcoholic fatty liver disease. Int. J. Obes. 2014, 38, 1213–1220. [Google Scholar] [CrossRef] [PubMed]
- Song, J.; Knepper, M.A.; Verbalis, J.G.; Ecelbarger, C.A. Increased renal ENaC subunit and sodium transporter abundances in streptozotocin-induced type 1 diabetes. Am. J. Physiol. Ren. Physiol. 2003, 285, F1125–F1137. [Google Scholar] [CrossRef] [Green Version]
- Boury-Jamot, M.; Sougrat, R.; Tailhardat, M.; Le Varlet, B.; Bonte, F.; Dumas, M.; Verbavatz, J.M. Expression and function of aquaporins in human skin: Is aquaporin-3 just a glycerol transporter? Biochim. Biophys. Acta 2006, 1758, 1034–1042. [Google Scholar] [CrossRef] [Green Version]
- Cousins, L.; Yen, S.S.; Meis, P.; Halberg, F.; Brink, G. Circadian rhythm and diurnal excursion of plasma cortisol in diabetic pregnant women. Am. J. Obstet. Gynecol. 1986, 155, 1176–1181. [Google Scholar] [CrossRef]
- Hofmann, K.; Schonerstedt, U.; Muhlbauer, E.; Wedekind, D.; Peschke, E. Clock gene expression in the liver of streptozotocin-induced and spontaneous type 1 diabetic rats. Horm. Metab. Res. 2013, 45, 629–639. [Google Scholar] [CrossRef]
- Ishikawa-Kobayashi, E.; Ushijima, K.; Ando, H.; Maekawa, T.; Takuma, M.; Furukawa, Y.; Fujimura, A. Reduced histone H3K9 acetylation of clock genes and abnormal glucose metabolism in ob/ob mice. Chronobiol. Int. 2012, 29, 982–993. [Google Scholar] [CrossRef] [PubMed]
- Matsunaga, N.; Itcho, K.; Hamamura, K.; Ikeda, E.; Ikeyama, H.; Furuichi, Y.; Watanabe, M.; Koyanagi, S.; Ohdo, S. 24-hour rhythm of aquaporin-3 function in the epidermis is regulated by molecular clocks. J. Investig. Dermatol. 2014, 134, 1636–1644. [Google Scholar] [CrossRef] [PubMed]
- Shin, S.Y.; Lee, D.H.; Gil, H.N.; Kim, B.S.; Choe, J.S.; Kim, J.B.; Lee, Y.H.; Lim, Y. Agerarin, identified from Ageratum houstonianum, stimulates circadian CLOCK-mediated aquaporin-3 gene expression in HaCaT keratinocytes. Sci. Rep. 2017, 7, 11175. [Google Scholar] [CrossRef] [PubMed]
- Volpe, C.M.O.; Villar-Delfino, P.H.; Dos Anjos, P.M.F.; Nogueira-Machado, J.A. Cellular death, reactive oxygen species (ROS) and diabetic complications. Cell Death Dis. 2018, 9, 119. [Google Scholar] [CrossRef] [PubMed]
- Ranieri, D.; Avitabile, D.; Shiota, M.; Yokomizo, A.; Naito, S.; Bizzarri, M.; Torrisi, M.R. Nuclear redox imbalance affects circadian oscillation in HaCaT keratinocytes. Int. J. Biochem. Cell Biol. 2015, 65, 113–124. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Pati, P.; Xu, Y.; Chen, F.; Stepp, D.W.; Huo, Y.; Rudic, R.D.; Fulton, D.J. Endotoxin Disrupts Circadian Rhythms in Macrophages via Reactive Oxygen Species. PLoS ONE 2016, 11, e0155075. [Google Scholar] [CrossRef]
- Dandona, P.; Thusu, K.; Cook, S.; Snyder, B.; Makowski, J.; Armstrong, D.; Nicotera, T. Oxidative damage to DNA in diabetes mellitus. Lancet 1996, 347, 444–445. [Google Scholar] [CrossRef]
- Kitada, M.; Kume, S.; Imaizumi, N.; Koya, D. Resveratrol improves oxidative stress and protects against diabetic nephropathy through normalization of Mn-SOD dysfunction in AMPK/SIRT1-independent pathway. Diabetes 2011, 60, 634–643. [Google Scholar] [CrossRef]
- Lee, Y.E.; Kim, J.W.; Lee, E.M.; Ahn, Y.B.; Song, K.H.; Yoon, K.H.; Kim, H.W.; Park, C.W.; Li, G.; Liu, Z.; et al. Chronic resveratrol treatment protects pancreatic islets against oxidative stress in db/db mice. PLoS ONE 2012, 7, e50412. [Google Scholar] [CrossRef]
- Sato, S.; Kawamura, H.; Takemoto, M.; Maezawa, Y.; Fujimoto, M.; Shimoyama, T.; Koshizaka, M.; Tsurutani, Y.; Watanabe, A.; Ueda, S.; et al. Halofuginone prevents extracellular matrix deposition in diabetic nephropathy. Biochem. Biophys. Res. Commun. 2009, 379, 411–416. [Google Scholar] [CrossRef]
- Wang, X.; Li, D.; Fan, L.; Xiao, Q.; Zuo, H.; Li, Z. CAPE-pNO2 ameliorated diabetic nephropathy through regulating the Akt/NF-kappaB/ iNOS pathway in STZ-induced diabetic mice. Oncotarget 2017, 8, 114506–114525. [Google Scholar] [CrossRef] [PubMed]
- Sakai, S.; Endo, Y.; Ozawa, N.; Sugawara, T.; Kusaka, A.; Sayo, T.; Tagami, H.; Inoue, S. Characteristics of the epidermis and stratum corneum of hairless mice with experimentally induced diabetes mellitus. J. Investig. Dermatol. 2003, 120, 79–85. [Google Scholar] [CrossRef] [PubMed]
- Horie, I.; Maeda, M.; Yokoyama, S.; Hisatsune, A.; Katsuki, H.; Miyata, T.; Isohama, Y. Tumor necrosis factor-alpha decreases aquaporin-3 expression in DJM-1 keratinocytes. Biochem. Biophys. Res. Commun. 2009, 387, 564–568. [Google Scholar] [CrossRef] [PubMed]
- Ikarashi, N.; Baba, K.; Ushiki, T.; Kon, R.; Mimura, A.; Toda, T.; Ishii, M.; Ochiai, W.; Sugiyama, K. The laxative effect of bisacodyl is attributable to decreased aquaporin-3 expression in the colon induced by increased PGE2 secretion from macrophages. Am. J. Physiol. Gastrointest. liver Physiol. 2011, 301, G887–G895. [Google Scholar] [CrossRef] [PubMed]
- Okahira, M.; Kubota, M.; Iguchi, K.; Usui, S.; Hirano, K. Regulation of aquaporin 3 expression by magnesium ion. Eur. J. Pharmacol. 2008, 588, 26–32. [Google Scholar] [CrossRef] [PubMed]
- Bellemere, G.; Von Stetten, O.; Oddos, T. Retinoic acid increases aquaporin 3 expression in normal human skin. J. Investig. Dermatol. 2008, 128, 542–548. [Google Scholar] [CrossRef] [PubMed]
- Jiang, Y.J.; Kim, P.; Lu, Y.F.; Feingold, K.R. PPARgamma activators stimulate aquaporin 3 expression in keratinocytes/epidermis. Exp. Dermatol. 2011, 20, 595–599. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tong, X.; Zhang, D.; Arthurs, B.; Li, P.; Durudogan, L.; Gupta, N.; Yin, L. Palmitate Inhibits SIRT1-Dependent BMAL1/CLOCK Interaction and Disrupts Circadian Gene Oscillations in Hepatocytes. PLoS ONE 2015, 10, e0130047. [Google Scholar] [CrossRef] [PubMed]
- Martinotti, S.; Laforenza, U.; Patrone, M.; Moccia, F.; Ranzato, E. Honey-Mediated Wound Healing: H(2)O(2) Entry through AQP3 Determines Extracellular Ca(2+) Influx. Int. J. Mol. Sci. 2019, 20, 764. [Google Scholar] [CrossRef]
- Thiagarajah, J.R.; Chang, J.; Goettel, J.A.; Verkman, A.S.; Lencer, W.I. Aquaporin-3 mediates hydrogen peroxide-dependent responses to environmental stress in colonic epithelia. Proc. Natl. Acad. Sci. USA 2017, 114, 568–573. [Google Scholar] [CrossRef] [Green Version]
- Hara-Chikuma, M.; Satooka, H.; Watanabe, S.; Honda, T.; Miyachi, Y.; Watanabe, T.; Verkman, A.S. Aquaporin-3-mediated hydrogen peroxide transport is required for NF-kappaB signalling in keratinocytes and development of psoriasis. Nat. Commun. 2015, 6, 7454. [Google Scholar] [CrossRef] [PubMed]
- Hara-Chikuma, M.; Chikuma, S.; Sugiyama, Y.; Kabashima, K.; Verkman, A.S.; Inoue, S.; Miyachi, Y. Chemokine-dependent T cell migration requires aquaporin-3-mediated hydrogen peroxide uptake. J. Exp. Med. 2012, 209, 1743–1752. [Google Scholar] [CrossRef] [PubMed]
- Miller, E.W.; Dickinson, B.C.; Chang, C.J. Aquaporin-3 mediates hydrogen peroxide uptake to regulate downstream intracellular signaling. Proc. Natl. Acad. Sci. USA 2010, 107, 15681–15686. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dissemond, J.; Goos, M.; Wagner, S.N. The role of oxidative stress in the pathogenesis and therapy of chronic wounds. Hautarzt 2002, 53, 718–723. [Google Scholar] [CrossRef] [PubMed]
- Soneja, A.; Drews, M.; Malinski, T. Role of nitric oxide, nitroxidative and oxidative stress in wound healing. Pharmacol. Rep. 2005, 57, 108–119. [Google Scholar] [PubMed]
- Cao, C.; Sun, Y.; Healey, S.; Bi, Z.; Hu, G.; Wan, S.; Kouttab, N.; Chu, W.; Wan, Y. Correction: EGFR-mediated expression of aquaporin-3 is involved in human skin fibroblast migration. Biochem. J. 2017, 474, 2901–2902. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sebastian, R.; Chau, E.; Fillmore, P.; Matthews, J.; Price, L.A.; Sidhaye, V.; Milner, S.M. Epidermal aquaporin-3 is increased in the cutaneous burn wound. Burns 2015, 41, 843–847. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bjorklund, S.; Engblom, J.; Thuresson, K.; Sparr, E. Glycerol and urea can be used to increase skin permeability in reduced hydration conditions. Eur. J. Pharm. Sci. 2013, 50, 638–645. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fluhr, J.W.; Darlenski, R.; Surber, C. Glycerol and the skin: Holistic approach to its origin and functions. Br. J. Dermatol. 2008, 159, 23–34. [Google Scholar] [CrossRef] [PubMed]
- Hara, M.; Verkman, A.S. Glycerol replacement corrects defective skin hydration, elasticity, and barrier function in aquaporin-3-deficient mice. Proc. Natl. Acad. Sci. USA 2003, 100, 7360–7365. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Choudhary, V.; Olala, L.O.; Qin, H.; Helwa, I.; Pan, Z.Q.; Tsai, Y.Y.; Frohman, M.A.; Kaddour-Djebbar, I.; Bollag, W.B. Aquaporin-3 re-expression induces differentiation in a phospholipase D2-dependent manner in aquaporin-3-knockout mouse keratinocytes. J. Investig. Dermatol. 2015, 135, 499–507. [Google Scholar] [CrossRef] [PubMed]
- Kon, R.; Ikarashi, N.; Hayakawa, A.; Haga, Y.; Fueki, A.; Kusunoki, Y.; Tajima, M.; Ochiai, W.; Machida, Y.; Sugiyama, K. Morphine-Induced Constipation Develops With Increased Aquaporin-3 Expression in the Colon via Increased Serotonin Secretion. Toxicol. Sci. 2015, 145, 337–347. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Gene | Forward (5′ to 3′) | Reverse (5′ to 3′) |
---|---|---|
Aqp3 | CCTTGTGATGTTTGGCTGTGG | GGAAGCACATTGCGAAGGTC |
Bmal1 | TGCAATGTCCAGGAAGTTAGAT | GTTTGCTTCTGTGTATGGGTTG |
Clock | TCTATGCTTCCTGGTAACGC | GGTTTCCAGTCCTGTCGAATC |
Dbp | GAAGGAAAAGGAGCGCAAGG | TATTCCACGTCCCCGAAAGG |
18S rRNA | GTCTGTGATGCCCTTAGATG | AGCTTATGACCCGCACTTAC |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ikarashi, N.; Mizukami, N.; Kon, R.; Kaneko, M.; Uchino, R.; Fujisawa, I.; Fukuda, N.; Sakai, H.; Kamei, J. Study of the Mechanism Underlying the Onset of Diabetic Xeroderma Focusing on an Aquaporin-3 in a Streptozotocin-Induced Diabetic Mouse Model. Int. J. Mol. Sci. 2019, 20, 3782. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms20153782
Ikarashi N, Mizukami N, Kon R, Kaneko M, Uchino R, Fujisawa I, Fukuda N, Sakai H, Kamei J. Study of the Mechanism Underlying the Onset of Diabetic Xeroderma Focusing on an Aquaporin-3 in a Streptozotocin-Induced Diabetic Mouse Model. International Journal of Molecular Sciences. 2019; 20(15):3782. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms20153782
Chicago/Turabian StyleIkarashi, Nobutomo, Nanaho Mizukami, Risako Kon, Miho Kaneko, Ryogo Uchino, Izumi Fujisawa, Natsuko Fukuda, Hiroyasu Sakai, and Junzo Kamei. 2019. "Study of the Mechanism Underlying the Onset of Diabetic Xeroderma Focusing on an Aquaporin-3 in a Streptozotocin-Induced Diabetic Mouse Model" International Journal of Molecular Sciences 20, no. 15: 3782. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms20153782