Connexin43 in Germ Cells Seems to Be Dispensable for Murine Spermatogenesis
Abstract
:1. Introduction
2. Results
2.1. Determination of the Genotype
2.1.1. PCR Genotyping
- Cre positive and both alleles of the Gja1 gene flanked by lox/P sites (“homoflox”) mice were considered as homozygous KO mice
- Cre negative mice were considered as WT mice.
2.1.2. Cx43-del PCR
2.2. Body and Testis Weight
2.3. Histology and Immunohistochemistry
2.3.1. Hematoxylin-Eosin (HE) Staining and Tubular Diameter
2.3.2. Cx43 Localization
2.3.3. Sox9-Staining and GC and SC Numbers
2.4. Semi-Quantitative Western Blot Analysis
2.5. qRT-PCR
2.6. Mating Experiments
3. Discussion
4. Materials and Methods
4.1. Animals
4.2. PCR Genotyping
4.3. Confirmation of the KO via Cx43-Del PCR
4.4. Tissue Sampling and Treatment
4.5. Body and Testis Weights
4.6. Testicular Histology
4.7. Immunohistochemistry and Immunofluorescence
4.8. Semi-Quantitative WB Analysis
4.9. qRT-PCR
4.10. Mating Experiments
4.11. Statistical Analyses
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kidder, G.M.; Cyr, D.G. Roles of connexins in testis development and spermatogenesis. Semin. Cell Dev. Biol. 2016, 50, 22–30. [Google Scholar] [CrossRef] [PubMed]
- Pointis, G.; Gilleron, J.; Carette, D.; Segretain, D. Physiological and physiopathological aspects of connexins and communicating gap junctions in spermatogenesis. Philos. Trans. R. Soc. B Biol. Sci. 2010, 365, 1607–1620. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- 3Bruzzone, R.; White, T.W.; Paul, D.L. Review Connections with connexins: The molecular basis of direct intercellular sig-naling. Eur. J. Biochem. 1996, 238, 1–27. [Google Scholar] [CrossRef] [PubMed]
- Kumar, N.M.; Gilula, N.B. The Gap Junction Communication Channel. Cell 1996, 84, 381–388. [Google Scholar] [CrossRef] [Green Version]
- Dbouk, H.A.; Mroue, R.M.; El-Sabban, M.E.; Talhouk, R.S. Connexins: A myriad of functions extending beyond assembly of gap junction channels. Cell Commun. Signal. 2009, 7, 4. [Google Scholar] [CrossRef] [Green Version]
- Kotini, M.; Mayor, R. Connexins in migration during development and cancer. Dev. Biol. 2015, 401, 143–151. [Google Scholar] [CrossRef] [Green Version]
- Elias, L.A.B.; Wang, D.D.; Kriegstein, A.R. Gap junction adhesion is necessary for radial migration in the neocortex. Nat. Cell Biol. 2007, 448, 901–907. [Google Scholar] [CrossRef]
- Matsuuchi, L.; Naus, C.C. Gap junction proteins on the move: Connexins, the cytoskeleton and migration. Biochim. Biophys. Acta 2013, 1828, 94–108. [Google Scholar] [CrossRef] [Green Version]
- Willecke, K.; Eiberger, J.; Degen, J.; Eckardt, D.; Romualdi, A.; Güldenagel, M.; Deutsch, U.; Söhl, G. Structural and Functional Diversity of Connexin Genes in the Mouse and Human Genome. Biol. Chem. 2002, 383, 725–737. [Google Scholar] [CrossRef]
- Risley, M.S. Connexin gene expression in seminiferous tubules of the Sprague-Dawley rat. Biol. Reprod. 2000, 62, 748–754. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pelletier, R.M.; Pelletier, R.M. The distribution of connexin 43 is associated with the germ cell differentiation and with the modulation of the Sertoli cell junctional barrier in continual (guinea pig) and seasonal breeders’ (mink) testes. J. Androl. 1995, 16, 400–409. [Google Scholar] [PubMed]
- Pelletier, R.-M.; Byers, S.W. The blood-testis barrier and sertoli cell junctions: Structural considerations. Microsc. Res. Tech. 1992, 20, 3–33. [Google Scholar] [CrossRef] [PubMed]
- Batias, C.; Siffroi, J.-P.; Fénichel, P.; Pointis, G.; Segretain, D. Connexin43 Gene Expression and Regulation in the Rodent Seminiferous Epithelium. J. Histochem. Cytochem. 2000, 48, 793–805. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bravo-Moreno, J.F.; Díaz-Sánchez, V.; Montoya-Flores, J.G.; Lamoyi, E.; Saéz, J.C.; Pérez-Armendariz, E.M. Expression of Connexin43 in mouse Leydig, Sertoli, and germinal cells at different stages of postnatal development. Anat. Rec. 2001, 264, 13–24. [Google Scholar] [CrossRef] [PubMed]
- Pérez-Armendariz, E.M.; Lamoyi, E.; Mason, J.I.; Cisneros-Armas, D.; Luu-The, V.; Moreno, J.F.B. Developmental regulation of connexin 43 expression in fetal mouse testicular cells. Anat. Rec. 2001, 264, 237–246. [Google Scholar] [CrossRef]
- Decrouy, X.; Gasc, J.; Pointis, G.; Segretain, D. Functional characterization of Cx43 based gap junctions during spermatogenesis. J. Cell. Physiol. 2004, 200, 146–154. [Google Scholar] [CrossRef]
- Gilleron, J.; Carette, D.; Durand, P.; Pointis, G.; Segretain, D. Connexin 43 a potential regulator of cell proliferation and apoptosis within the seminiferous epithelium. Int. J. Biochem. Cell Biol. 2009, 41, 1381–1390. [Google Scholar] [CrossRef]
- Noelke, J.; Wistuba, J.; Damm, O.S.; Fietz, D.; Gerber, J.; Gaehle, M.; Brehm, R. A Sertoli cell-specific connexin43 knockout leads to altered interstitial connexin expression and increased Leydig cell numbers. Cell Tissue Res. 2015, 361, 633–644. [Google Scholar] [CrossRef]
- Kibschull, M.; Gellhaus, A.; Carette, D.; Segretain, D.; Pointis, G.; Gilleron, J. Physiological roles of connexins and pannexins in reproductive organs. Cell. Mol. Life Sci. 2015, 72, 2879–2898. [Google Scholar] [CrossRef]
- Enders, G.C. Sertoli-Sertoli and Sertoli-Germ Cell Communications. In The Sertoli Cell; Russell, L.D., Griswold, M.D., Eds.; Cache River Press: Clearwater, FL, USA, 1993; pp. 447–460. [Google Scholar]
- Risley, M.; Tan, I.; Roy, C.; Saez, J. Cell-, age- and stage-dependent distribution of connexin43 gap junctions in testes. J. Cell Sci. 1992, 103, 81–96. [Google Scholar] [CrossRef] [PubMed]
- Risley, M.S.; Tan, I.P.; Farrell, J. Gap junctions with varied permeability properties establish cell-type specific communication pathways in the rat seminiferous epithelium. Biol. Reprod. 2002, 67, 945–952. [Google Scholar] [CrossRef] [Green Version]
- Godet, M.; Sabido, O.; Gilleron, J.; Durand, P. Meiotic progression of rat spermatocytes requires mitogen-activated protein kinases of Sertoli cells and close contacts between the germ cells and the Sertoli cells. Dev. Biol. 2008, 315, 173–188. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mittelbrunn, M.; Sánchez-Madrid, F. Intercellular communication: Diverse structures for exchange of genetic information. Nat. Rev. Mol. Cell Biol. 2012, 13, 328–335. [Google Scholar] [CrossRef] [PubMed]
- Dym, M.; Fawcett, D.W. Further Observations on the Numbers of Spermatogonia, Spermatocytes, and Spermatids Connected by Intercellular Bridges in the Mammalian Testis. Biol. Reprod. 1971, 4, 195–215. [Google Scholar] [CrossRef] [Green Version]
- Reaume, A.; De Sousa, P.; Kulkarni, S.; Langille, B.; Zhu, D.; Davies, T.; Juneja, S.; Kidder, G.; Rossant, J. Cardiac malformation in neonatal mice lacking connexin43. Science 1995, 267, 1831–1834. [Google Scholar] [CrossRef] [PubMed]
- Juneja, S.C.; Barr, K.J.; Enders, G.C.; Kidder, G.M. Defects in the Germ Line and Gonads of Mice Lacking Connexin431. Biol. Reprod. 1999, 60, 1263–1270. [Google Scholar] [CrossRef] [PubMed]
- Francis, R.; Lo, C.W. Primordial germ cell deficiency in the connexin 43 knockout mouse arises from apoptosis associated with abnormal p53 activation. Development 2006, 133, 3451–3460. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Roscoe, W.A.; Barr, K.J.; Mhawi, A.A.; Pomerantz, D.K.; Kidder, G.M. Failure of Spermatogenesis in Mice Lacking Connexin431. Biol. Reprod. 2001, 65, 829–838. [Google Scholar] [CrossRef]
- Nagy, A. Cre recombinase: The universal reagent for genome tailoring. Genesis 2000, 26, 99–109. [Google Scholar] [CrossRef]
- Brehm, R.; Zeiler, M.; Rüttinger, C.; Herde, K.; Kibschull, M.; Winterhager, E.; Willecke, K.; Guillou, F.; Lécureuil, C.; Steger, K.; et al. A Sertoli Cell-Specific Knockout of Connexin43 Prevents Initiation of Spermatogenesis. Am. J. Pathol. 2007, 171, 19–31. [Google Scholar] [CrossRef] [Green Version]
- Sridharan, S.; Simon, L.; Meling, D.D.; Cyr, D.G.; Gutstein, D.E.; Fishman, G.; Guillou, F.; Cooke, P.S. Proliferation of Adult Sertoli Cells Following Conditional Knockout of the Gap Junctional Protein GJA1 (Connexin 43) in Mice1. Biol. Reprod. 2007, 76, 804–812. [Google Scholar] [CrossRef] [Green Version]
- Weider, K.; Bergmann, M.; Giese, S.; Guillou, F.; Failing, K.; Brehm, R. Altered differentiation and clustering of Sertoli cells in transgenic mice showing a Sertoli cell specific knockout of the connexin 43 gene. Differentiation 2011, 82, 38–49. [Google Scholar] [CrossRef] [PubMed]
- Carette, D.; Weider, K.; Gilleron, J.; Giese, S.; Dompierre, J.; Bergmann, M.; Brehm, R.; Denizot, J.-P.; Segretain, D.; Pointis, G. Major involvement of connexin 43 in seminiferous epithelial junction dynamics and male fertility. Dev. Biol. 2010, 346, 54–67. [Google Scholar] [CrossRef] [PubMed]
- Gerber, J.; Weider, K.; Hambruch, N.; Brehm, R. Loss of connexin43 (Cx43) in Sertoli cells leads to spatio-temporal alterations in occludin expression. Histol. Histopathol. 2014, 29, 935–948. [Google Scholar]
- Gerber, J.; Heinrich, J.; Brehm, R. Blood–testis barrier and Sertoli cell function: Lessons from SCCx43KO mice. Reproduction 2016, 151, R15–R27. [Google Scholar] [CrossRef] [Green Version]
- Giese, S.; Hossain, H.; Markmann, M.; Chakraborty, T.; Tchatalbachev, S.; Guillou, F.; Bergmann, M.; Failing, K.; Weider, K.; Brehm, R. Sertoli-cell-specific knockout of connexin 43 leads to multiple alterations in testicular gene expression in prepubertal mice. Dis. Model. Mech. 2012, 5, 895–913. [Google Scholar] [CrossRef] [Green Version]
- Günther, S.; Fietz, D.; Weider, K.; Bergmann, M.; Brehm, R. Effects of a murine germ cell-specific knockout of Connexin 43 on Connexin expression in testis and fertility. Transgenic Res. 2012, 22, 631–641. [Google Scholar] [CrossRef]
- Lomeli, H.; Ramos-Mejia, V.; Gertsenstein, M.; Lobe, C.G.; Nagy, A. Targeted insertion of Cre recombinase into the TNAP gene: Excision in primordial germ cells. Genesis 2000, 26, 116–117. [Google Scholar] [CrossRef]
- Batias, C.; Defamie, N.; Lablack, A.; Thepot, D.; Fenichl, P.; Segretain, D.; Pointis, G. Modified expression of testicular gap-junction connexin 43 during normal spermatogenic cycle and in altered spermatogenesis. Cell Tissue Res. 1999, 298, 113–121. [Google Scholar] [CrossRef] [PubMed]
- Sadate-Ngatchou, P.I.; Payne, C.J.; Dearth, A.T.; Braun, R.E. Cre recombinase activity specific to postnatal, premeiotic male germ cells in transgenic mice. Genesis 2008, 46, 738–742. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Smith, L. Good planning and serendipity: Exploiting the Cre/Lox system in the testis. Reproduction 2011, 141, 151–161. [Google Scholar] [CrossRef] [Green Version]
- O’Gorman, S.; Dagenais, N.A.; Qian, M.; Marchuk, Y. Protamine-Cre recombinase transgenes efficiently recombine target sequences in the male germ line of mice, but not in embryonic stem cells. Proc. Natl. Acad. Sci. USA 1997, 94, 14602–14607. [Google Scholar] [CrossRef] [Green Version]
- Hilbold, E.; Distl, O.; Hoedemaker, M.; Wilkening, S.; Behr, R.; Rajkovic, A.; Langeheine, M.; Rode, K.; Jung, K.; Metzger, J.; et al. Loss of Cx43 in Murine Sertoli Cells Leads to Altered Prepubertal Sertoli Cell Maturation and Impairment of the Mitosis-Meiosis Switch. Cells 2020, 9, 676. [Google Scholar] [CrossRef] [Green Version]
- Hollenbach, J.; Jung, K.; Noelke, J.; Gasse, H.; Pfarrer, C.; Koy, M.; Brehm, R. Loss of connexin43 in murine Sertoli cells and its effect on blood-testis barrier formation and dynamics. PLoS ONE 2018, 13, e0198100. [Google Scholar] [CrossRef]
- Rode, K.; Weider, K.; Damm, O.S.; Wistuba, J.; Langeheine, M.; Brehm, R. Loss of connexin 43 in Sertoli cells provokes postnatal spermatogonial arrest, reduced germ cell numbers and impaired spermatogenesis. Reprod. Biol. 2018, 18, 456–466. [Google Scholar] [CrossRef]
- Weider, K.; Bergmann, M.; Brehm, R. Connexin 43: Its regulatory role in testicular junction dynamics and spermatogenesis. Histol. Histopathol. 2011, 26, 1343–1352. [Google Scholar]
- Pelletier, R.-M.; Akpovi, C.D.; Chen, L.; Day, R.; Vitale, M.L. CX43 expression, phosphorylation, and distribution in the normal and autoimmune orchitic testis with a look at gap junctions joining germ cell to germ cell. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2011, 300, R121–R139. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pointis, G.; Fiorini, C.; Defamie, N.; Segretain, D. Gap junctional communication in the male reproductive system. Biochim. Biophys. Acta 2005, 1719, 102–116. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Koval, M.; Molina, S.A.; Burt, J.M. Mix and match: Investigating heteromeric and heterotypic gap junction channels in model systems and native tissues. FEBS Lett. 2014, 588, 1193–1204. [Google Scholar] [CrossRef] [Green Version]
- Carette, D.; Gilleron, J.; Decrouy, X.; Fiorini, C.; Diry, M.; Segretain, D.; Pointis, G. Connexin 33 Impairs Gap Junction Functionality by Accelerating Connexin 43 Gap Junction Plaque Endocytosis. Traffic 2009, 10, 1272–1285. [Google Scholar] [CrossRef] [PubMed]
- Rackauskas, M.; Kreuzberg, M.M.; Pranevicius, M.; Willecke, K.; Verselis, V.K.; Bukauskas, F.F. Gating Properties of Heterotypic Gap Junction Channels Formed of Connexins 40, 43, and 45. Biophys. J. 2007, 92, 1952–1965. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kameritsch, P.; Pogoda, K.; Pohl, U. Channel-independent influence of connexin 43 on cell migration. Biochim. Biophys. Acta 2012, 1818, 1993–2001. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Plotkin, L.I.; Bellido, T. Beyond gap junctions: Connexin43 and bone cell signaling. Bone 2013, 52, 157–166. [Google Scholar] [CrossRef] [Green Version]
- Stout, C.; Goodenough, D.A.; Paul, D.L. Connexins: Functions without junctions. Curr. Opin. Cell Biol. 2004, 16, 507–512. [Google Scholar] [CrossRef]
- Francis, R.; Xu, X.; Park, H.; Wei, C.-J.; Chang, S.; Chatterjee, B.; Lo, C. Connexin43 Modulates Cell Polarity and Directional Cell Migration by Regulating Microtubule Dynamics. PLoS ONE 2011, 6, e26379. [Google Scholar] [CrossRef] [Green Version]
- Brink, P.R.; Valiunas, V.; Gordon, C.; Rosen, M.R.; Cohen, I.S. Can gap junctions deliver? Biochim. Biophys. Acta 2012, 1818, 2076–2081. [Google Scholar] [CrossRef] [Green Version]
- Kanaporis, G.; Brink, P.R.; Valiunas, V. Gap junction permeability: Selectivity for anionic and cationic probes. Am. J. Physiol. Physiol. 2011, 300, C600–C609. [Google Scholar] [CrossRef] [Green Version]
- Valiunas, V.; Polosina, Y.Y.; Miller, H.; Potapova, I.A.; Valiuniene, L.; Doronin, S.; Mathias, R.T.; Robinson, R.B.; Rosen, M.R.; Cohen, I.S.; et al. Connexin-specific cell-to-cell transfer of short interfering RNA by gap junctions. J. Physiol. 2005, 568, 459–468. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wolvetang, E.J.; Pera, M.F.; Zuckerman, K.S. Gap junction mediated transport of shRNA between human embryonic stem cells. Biochem. Biophys. Res. Commun. 2007, 363, 610–615. [Google Scholar] [CrossRef]
- Su, L.; Kopera-Sobota, I.A.; Bilinska, B.; Cheng, C.Y.; Mruk, D.D. Germ cells contribute to the function of the Sertoli cell barrier An in vitro study. Spermatogenesis 2013, 3, e26460. [Google Scholar] [CrossRef] [Green Version]
- Gearard, N.; Jegou, B. In-vitro influence of germ cells on Sertoli cel l-secreted proteins: A two-dimensional gel electrophoresis analysis. Int. J. Androl. 1993, 16, 285–291. [Google Scholar] [CrossRef] [PubMed]
- Mruk, D.D.; Cheng, C.Y. Sertoli-Sertoli and Sertoli-Germ Cell Interactions and Their Significance in Germ Cell Movement in the Seminiferous Epithelium during Spermatogenesis. Endocr. Rev. 2004, 25, 747–806. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cheng, C.Y.; Mruk, D.D. Cell Junction Dynamics in the Testis: Sertoli-Germ Cell Interactions and Male Contraceptive Development. Physiol. Rev. 2002, 82, 825–874. [Google Scholar] [CrossRef] [Green Version]
- Hermo, L.; Pelletier, R.-M.; Cyr, D.G.; Smith, C.E.; Pelletier, R. Surfing the wave, cycle, life history, and genes/proteins expressed by testicular germ cells. Part 5: Intercellular junctions and contacts between germs cells and Sertoli cells and their regulatory interactions, testicular cholesterol, and genes/proteins associated with more than one germ cell generation. Microsc. Res. Tech. 2009, 73, 409–494. [Google Scholar] [CrossRef]
- O’Shaughnessy, P.J.; Hu, L.; Baker, P.J. Effect of germ cell depletion on levels of specific mRNA transcripts in mouse Sertoli cells and Leydig cells. Reproduction 2008, 135, 839–850. [Google Scholar] [CrossRef] [Green Version]
- Griswold, M.D. Interactions Between Germ Cells and Sertoli Cells in the Testis. Biol. Reprod. 1995, 52, 211–216. [Google Scholar] [CrossRef]
- Smendziuk, C.M.; Messenberg, A.; Vogl, A.W.; Tanentzapf, G. Bi-directional gap junction-mediated Soma-Germline communication is essential for spermatogenesis. Development 2015, 142, 2598–2609. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tazuke, S.I.; Schulz, C.; Gilboa, L.; Fogarty, M.; Mahowald, A.P.; Guichet, A.; Ephrussi, A.; Wood, C.G.; Lehmann, R.; Fuller, M.T. A germline-specific gap junction protein required for survival of differentiating early germ cells. Development 2002, 129, 2529–2539. [Google Scholar] [CrossRef]
- Barrionuevo, F.; Bagheri-Fam, S.; Klattig, J.; Kist, R.; Taketo, M.M.; Englert, C.; Scherer, G. Homozygous Inactivation of Sox9 Causes Complete XY Sex Reversal in Mice1. Biol. Reprod. 2006, 74, 195–201. [Google Scholar] [CrossRef] [PubMed]
- Schenke, M.; Schjeide, B.-M.; Püschel, G.P.; Seeger, B. Analysis of Motor Neurons Differentiated from Human Induced Pluripotent Stem Cells for the Use in Cell-Based Botulinum Neurotoxin Activity Assays. Toxins 2020, 12, 276. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
Name | Forward Primer (5′-3′) | Reverse Primer (5′-3′) | Size of Amplicon | Objective | Reference |
---|---|---|---|---|---|
Cx43-flox | TCATGCCCGGCACAAGTGAGAC | TCACCCCAAGCTGACTCAACCG | 1100 bp (flox) 988 bp (WT) | Genotyping | [31] |
Stra-8 Cre | TCTGATGAAGTCAGGAAGAACC | GAGATGTCCTTCACTCTGATTC | 470 bp | Genotyping | |
Prm1-Cre | AGGCAAATTTTGGTGTACGG | GTTCCCTCAGCAGCATTCTC | 405 bp | Genotyping | |
Cx43-del | GGCATACAGACCCTTGGACTCC | TGCGGGCCTCTTCGCTATTACG | 670 bp | Cx43-del PCR | [31] |
Gja1 (Cx43) | ACAGCGGTTGAGTCAGCTTG | GAGAGATGGGGAAGGACTTGT | 106 bp | qRT-PCR | [37] |
Gjc1 (Cx45) NM_001001496.2 | CAGTTCTGGTGAACAGGGCA | ACAATCAGCACAGTGAGCCA | 125 bp | qRT-PCR | |
Gja6 (Cx33) NM_001159382.1 | GCCAAGCTGCAAGAGTAGGA | CAAGTGAGTGCACACCTGAG | 138 bp | qRT-PCR | |
Actb NM_007393.5 | CGCAGCCACTGTCGAGTC | GTCATCCATGGCGAACTGGT | 96 bp | qRT-PCR | |
Hsp90ab1 NM_008302.3 | GCTCCTTCGCTATCACACCT | TTGCTCTTTGCTCTCACCAGT | 121 bp | qRT-PCR | |
Sox9 | CGGAGGAAGTCGGTGAAGA | GTCGGTTTTGGGAGTGGTG | 810 bp (gDNA) 201 bp (cDNA) | DNAse digest test | [70] |
Antibody | Host | Application | Dilution | Company | Catalogue No. |
---|---|---|---|---|---|
Anti-Sox9 | Rabbit | IHC | 1:800 | Merck Millipore | AB5535 |
Cx43 | Rabbit | IHC IF | 1:500 | Cell Signaling | 3512 |
WB | 1:1000 | ||||
α-Tubulin | Rabbit | WB | 1:1000 | Cell Signaling | 2125 |
2nd Anti-Rabbit | Goat | WB | 1:5000 | Santa Cruz | SC-2004 |
EnVision+ Single Reagent (HRP Rabbit) | Goat | IHC | ready-to-use | Agilent Dako | K400311-2 |
2nd Alexa 546 | IF | 1:1000 | Invitrogen | A11010 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Rode, K.; Langeheine, M.; Seeger, B.; Brehm, R. Connexin43 in Germ Cells Seems to Be Dispensable for Murine Spermatogenesis. Int. J. Mol. Sci. 2021, 22, 7924. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms22157924
Rode K, Langeheine M, Seeger B, Brehm R. Connexin43 in Germ Cells Seems to Be Dispensable for Murine Spermatogenesis. International Journal of Molecular Sciences. 2021; 22(15):7924. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms22157924
Chicago/Turabian StyleRode, Kristina, Marion Langeheine, Bettina Seeger, and Ralph Brehm. 2021. "Connexin43 in Germ Cells Seems to Be Dispensable for Murine Spermatogenesis" International Journal of Molecular Sciences 22, no. 15: 7924. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms22157924