Vector and Host C-Type Lectin Receptor (CLR)–Fc Fusion Proteins as a Cross-Species Comparative Approach to Screen for CLR–Rift Valley Fever Virus Interactions
Abstract
:1. Introduction
2. Results
2.1. Mosquito CLR–hFc Fusion Protein Expression
2.2. ELISA-Based Binding Studies
3. Discussion
4. Materials and Methods
4.1. Cell Culture
4.2. Virus Cell Culture and Purification
4.3. CLR–hFc Fusion Protein Production
4.4. Western Blot
4.5. ELISA-Based RVFV MP12–CLR Binding Studies
4.6. Statistical and Phylogenetic Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Sukhralia, S.; Verma, M.; Gopirajan, S.; Dhanaraj, P.S.; Lal, R.; Mehla, N.; Kant, C.R. From dengue to Zika: The wide spread of mosquito-borne arboviruses. Eur. J. Clin. Microbiol. Infect. Dis. 2019, 38, 3–14. [Google Scholar] [CrossRef] [PubMed]
- Girard, M.; Nelson, C.B.; Picot, V.; Gubler, D.J. Arboviruses: A global public health threat. Vaccine 2020, 38, 3989–3994. [Google Scholar] [CrossRef] [PubMed]
- Kuhn, J.H.; Adkins, S.; Alioto, D.; Alkhovsky, S.V.; Amarasinghe, G.K.; Anthony, S.J.; Avšič-Županc, T.; Ayllón, M.A.; Bahl, J.; Balkema-Buschmann, A.; et al. 2020 taxonomic update for phylum Negarnaviricota (Riboviria: Orthornavirae), including the large orders Bunyavirales and Mononegavirales. Arch. Virol. 2020, 165, 3023–3072. [Google Scholar] [CrossRef] [PubMed]
- Walter, C.T.; Barr, J.N. Recent advances in the molecular and cellular biology of bunyaviruses. J. Gen. Virol. 2011, 92, 2467–2484. [Google Scholar] [CrossRef]
- Wright, D.; Kortekaas, J.; Bowden, T.A.; Warimwe, G.M. Rift Valley fever: Biology and epidemiology. J. Gen. Virol. 2019, 100, 1187–1199. [Google Scholar] [CrossRef]
- Ikegami, T.; Makino, S. The Pathogenesis of Rift Valley Fever. Viruses 2011, 3, 493–519. [Google Scholar] [CrossRef] [Green Version]
- Yedloutschnig, R.J.; Dardiri, A.H.; Mebus, C.A.; Walker, J.S. Abortion in vaccinated sheep and cattle after challenge with Rift Valley fever virus. Vet. Rec. 1981, 109, 383–384. [Google Scholar] [CrossRef]
- Easterday, B.C. Rift valley fever. Adv. Vet. Sci. 1965, 10, 65–127. [Google Scholar]
- Bouloy, M. Molecular Biology of Rift Valley Fever Virus. Open Virol. J. 2010, 4, 8–14. [Google Scholar] [CrossRef]
- Giorgi, C.; Accardi, L.; Nicoletti, L.; Gro, M.C.; Takehara, K.; Hilditch, C.; Morikawa, S.; Bishop, D.H.L. Sequences and coding strategies of the S RNAs of Toscana and Rift Valley fever viruses compared to those of Punta Toro, Sicilian sandfly fever, and Uukuniemi viruses. Virology 1991, 180, 738–753. [Google Scholar] [CrossRef]
- Kakach, L.T.; Suzich, J.A.; Collett, M.S. Rift valley fever virus M segment: Phlebovirus expression strategy and protein glycosylation. Virology 1989, 170, 505–510. [Google Scholar] [CrossRef]
- Suzich, J.A.; Kakach, L.T.; Collett, M.S. Expression strategy of a phlebovirus: Biogenesis of proteins from the Rift Valley fever virus M segment. J. Virol. 1990, 64, 1549–1555. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Halldorsson, S.; Li, S.; Li, M.; Harlos, K.; Bowden, T.A.; Huiskonen, J.T. Shielding and activation of a viral membrane fusion protein. Nat. Commun. 2018, 9, 349. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Takeuchi, O.; Akira, S. Pattern recognition receptors and inflammation. Cell 2010, 140, 805–820. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mayer, S.; Raulf, M.-K.; Lepenies, B. C-type lectins: Their network and roles in pathogen recognition and immunity. Histochem. Cell Biol. 2017, 147, 223–237. [Google Scholar] [CrossRef]
- Sancho, D.; Reis e Sousa, C. Signaling by Myeloid C-Type Lectin Receptors in Immunity and Homeostasis. Annu. Rev. Immunol. 2012, 30, 491–529. [Google Scholar] [CrossRef] [Green Version]
- Monteiro, J.; Lepenies, B. Myeloid C-Type Lectin Receptors in Viral Recognition and Antiviral Immunity. Viruses 2017, 9, 59. [Google Scholar] [CrossRef]
- Bakker, A.B.; Baker, E.; Sutherland, G.R.; Phillips, J.H.; Lanier, L.L. Myeloid DAP12-associating lectin (MDL)-1 is a cell surface receptor involved in the activation of myeloid cells. Proc. Natl. Acad. Sci. USA 1999, 96, 9792–9796. [Google Scholar] [CrossRef] [Green Version]
- Chen, S.-T.; Lin, Y.-L.; Huang, M.-T.; Wu, M.-F.; Cheng, S.-C.; Lei, H.-Y.; Lee, C.-K.; Chiou, T.-W.; Wong, C.-H.; Hsieh, S.-L. CLEC5A is critical for dengue-virus-induced lethal disease. Nature 2008, 453, 672–676. [Google Scholar] [CrossRef]
- Wu, M.-F.; Chen, S.-T.; Yang, A.-H.; Lin, W.-W.; Lin, Y.-L.; Chen, N.-J.; Tsai, I.-S.; Li, L.; Hsieh, S.-L. CLEC5A is critical for dengue virus-induced inflammasome activation in human macrophages. Blood 2013, 121, 95–106. [Google Scholar] [CrossRef]
- Bashirova, A.A.; Geijtenbeek, T.B.H.; Van Duijnhoven, G.C.F.; Van Vliet, S.J.; Eilering, J.B.G.; Martin, M.P.; Wu, L.; Martin, T.D.; Viebig, N.; Knolle, P.A.; et al. A Dendritic Cell–Specific Intercellular Adhesion Molecule 3–Grabbing Nonintegrin (Dc-Sign)–Related Protein Is Highly Expressed on Human Liver Sinusoidal Endothelial Cells and Promotes HIV-1 Infection. J. Exp. Med. 2001, 193, 671–678. [Google Scholar] [CrossRef] [PubMed]
- Geijtenbeek, T.B.; Torensma, R.; van Vliet, S.J.; van Duijnhoven, G.C.; Adema, G.J.; van Kooyk, Y.; Figdor, C.G. Identification of DC-SIGN, a novel dendritic cell-specific ICAM-3 receptor that supports primary immune responses. Cell 2000, 100, 575–585. [Google Scholar] [CrossRef] [Green Version]
- Gillespie, L.; Roosendahl, P.; Ng, W.C.; Brooks, A.G.; Reading, P.C.; Londrigan, S.L. Endocytic function is critical for influenza A virus infection via DC-SIGN and L-SIGN. Sci. Rep. 2016, 6, 19428. [Google Scholar] [CrossRef] [PubMed]
- Lozach, P.-Y.; Kühbacher, A.; Meier, R.; Mancini, R.; Bitto, D.; Bouloy, M.; Helenius, A. DC-SIGN as a Receptor for Phleboviruses. Cell Host Microbe 2011, 10, 75–88. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lempp, F.A.; Soriaga, L.B.; Montiel-Ruiz, M.; Benigni, F.; Noack, J.; Park, Y.-J.; Bianchi, S.; Walls, A.C.; Bowen, J.E.; Zhou, J.; et al. Lectins enhance SARS-CoV-2 infection and influence neutralizing antibodies. Nature 2021, 598, 342–347. [Google Scholar] [CrossRef]
- Thépaut, M.; Luczkowiak, J.; Vivès, C.; Labiod, N.; Bally, I.; Lasala, F.; Grimoire, Y.; Fenel, D.; Sattin, S.; Thielens, N.; et al. DC/L-SIGN recognition of spike glycoprotein promotes SARS-CoV-2 trans-infection and can be inhibited by a glycomimetic antagonist. PLoS Pathog. 2021, 17, e1009576. [Google Scholar] [CrossRef]
- Waterhouse, R.M.; Kriventseva, E.V.; Meister, S.; Xi, Z.; Alvarez, K.S.; Bartholomay, L.C.; Barillas-Mury, C.; Bian, G.; Blandin, S.; Christensen, B.M.; et al. Evolutionary Dynamics of Immune-Related Genes and Pathways in Disease-Vector Mosquitoes. Science 2007, 316, 1738–1743. [Google Scholar] [CrossRef] [Green Version]
- Adelman, Z.; Myles, K. The C-Type Lectin Domain Gene Family in Aedes aegypti and Their Role in Arbovirus Infection. Viruses 2018, 10, 367. [Google Scholar] [CrossRef] [Green Version]
- Liu, K.; Qian, Y.; Jung, Y.-S.; Zhou, B.; Cao, R.; Shen, T.; Shao, D.; Wei, J.; Ma, Z.; Chen, P.; et al. mosGCTL-7, a C-Type Lectin Protein, Mediates Japanese Encephalitis Virus Infection in Mosquitoes. J. Virol. 2017, 91, e01348-16. [Google Scholar] [CrossRef] [Green Version]
- Cheng, G.; Cox, J.; Wang, P.; Krishnan, M.N.; Dai, J.; Qian, F.; Anderson, J.F.; Fikrig, E. A C-type lectin collaborates with a CD45 phosphatase homologue to facilitate West Nile virus infection of mosquitoes. Cell 2010, 142, 714–725. [Google Scholar] [CrossRef] [Green Version]
- Liu, Y.; Zhang, F.; Liu, J.; Xiao, X.; Zhang, S.; Qin, C.; Xiang, Y.; Wang, P.; Cheng, G. Transmission-Blocking Antibodies against Mosquito C-Type Lectins for Dengue Prevention. PLoS Pathog. 2014, 10, e1003931. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Licciardi, S.; Loire, E.; Cardinale, E.; Gislard, M.; Dubois, E.; Cêtre-Sossah, C. In vitro shared transcriptomic responses of Aedes aegypti to arboviral infections: Example of dengue and Rift Valley fever viruses. Parasites Vectors 2020, 13, 395. [Google Scholar] [CrossRef] [PubMed]
- Maglinao, M.; Eriksson, M.; Schlegel, M.K.; Zimmermann, S.; Johannssen, T.; Gotze, S.; Seeberger, P.H.; Lepenies, B. A platform to screen for C-type lectin receptor-binding carbohydrates and their potential for cell-specific targeting and immune modulation. J. Control. Release 2014, 175, 36–42. [Google Scholar] [CrossRef] [PubMed]
- Monteiro, J.T.; Schön, K.; Ebbecke, T.; Goethe, R.; Ruland, J.; Baumgärtner, W.; Becker, S.C.; Lepenies, B. The CARD9-Associated C-Type Lectin, Mincle, Recognizes La Crosse Virus (LACV) but Plays a Limited Role in Early Antiviral Responses against LACV. Viruses 2019, 11, 303. [Google Scholar] [CrossRef] [Green Version]
- Lindenwald, D.L.; Monteiro, J.T.; Rautenschlein, S.; Meens, J.; Jung, K.; Becker, S.C.; Lepenies, B. Ovine C-type lectin receptor hFc-fusion protein library—A novel platform to screen for host-pathogen interactions. Vet. Immunol. Immunopathol. 2020, 224, 110047. [Google Scholar] [CrossRef]
- Cummings, R.D.; McEver, R.P. C-Type Lectins. In Essentials of Glycobiology, 3rd ed.; Varki, A., Cummings, R.D., Esko, J.D., Freeze, H., Hart, G., Marth, J., Eds.; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, NY, USA, 2017. [Google Scholar]
- Zelensky, A.N.; Gready, J.E. The C-type lectin-like domain superfamily. FEBS J. 2005, 272, 6179–6217. [Google Scholar] [CrossRef]
- Drickamer, K.; Taylor, M.E. Recent insights into structures and functions of C-type lectins in the immune system. Curr. Opin. Struct. Biol. 2015, 34, 26–34. [Google Scholar] [CrossRef] [Green Version]
- Katoh, T.; Tiemeyer, M. The N’s and O’s of Drosophila glycoprotein glycobiology. Glycoconj. J. 2013, 30, 57–66. [Google Scholar] [CrossRef] [Green Version]
- Kornfeld, R.; Kornfeld, S. Assembly of asparagine-linked oligosaccharides. Annu. Rev. Biochem. 1985, 54, 631–664. [Google Scholar] [CrossRef]
- Saijo, S.; Ikeda, S.; Yamabe, K.; Kakuta, S.; Ishigame, H.; Akitsu, A.; Fujikado, N.; Kusaka, T.; Kubo, S.; Chung, S.-H.; et al. Dectin-2 recognition of alpha-mannans and induction of Th17 cell differentiation is essential for host defense against Candida albicans. Immunity 2010, 32, 681–691. [Google Scholar] [CrossRef] [Green Version]
- de Jong, M.A.; Vriend, L.E.; Theelen, B.; Taylor, M.E.; Fluitsma, D.; Boekhout, T.; Geijtenbeek, T.B. C-type lectin Langerin is a beta-glucan receptor on human Langerhans cells that recognizes opportunistic and pathogenic fungi. Mol. Immunol. 2010, 47, 1216–1225. [Google Scholar] [CrossRef] [PubMed]
- Brown, G.D.; Gordon, S. Immune recognition. A new receptor for beta-glucans. Nature 2001, 413, 36–37. [Google Scholar] [CrossRef] [PubMed]
- Saijo, S.; Iwakura, Y. Dectin-1 and Dectin-2 in innate immunity against fungi. Int. Immunol. 2011, 23, 467–472. [Google Scholar] [CrossRef] [PubMed]
- Léger, P.; Tetard, M.; Youness, B.; Cordes, N.; Rouxel, R.N.; Flamand, M.; Lozach, P.-Y. Differential Use of the C-Type Lectins L-SIGN and DC-SIGN for Phlebovirus Endocytosis. Traffic 2016, 17, 639–656. [Google Scholar] [CrossRef]
- Mayer, S.; Moeller, R.; Monteiro, J.T.; Ellrott, K.; Josenhans, C.; Lepenies, B. C-Type Lectin Receptor (CLR)-Fc Fusion Proteins As Tools to Screen for Novel CLR/Bacteria Interactions: An Exemplary Study on Preselected Campylobacter jejuni Isolates. Front. Immunol. 2018, 9, 213. [Google Scholar] [CrossRef] [Green Version]
- Neumann, K.; Castiñeiras-Vilariño, M.; Höckendorf, U.; Hannesschläger, N.; Lemeer, S.; Kupka, D.; Meyermann, S.; Lech, M.; Anders, H.-J.; Kuster, B.; et al. Clec12a Is an Inhibitory Receptor for Uric Acid Crystals that Regulates Inflammation in Response to Cell Death. Immunity 2014, 40, 389–399. [Google Scholar] [CrossRef] [Green Version]
- Li, K.; Neumann, K.; Duhan, V.; Namineni, S.; Hansen, A.L.; Wartewig, T.; Kurgyis, Z.; Holm, C.K.; Heikenwalder, M.; Lang, K.S.; et al. The uric acid crystal receptor Clec12A potentiates type I interferon responses. Proc. Natl. Acad. Sci. USA 2019, 116, 18544–18549. [Google Scholar] [CrossRef] [Green Version]
- Raulf, M.-K.; Johannssen, T.; Matthiesen, S.; Neumann, K.; Hachenberg, S.; Mayer-Lambertz, S.; Steinbeis, F.; Hegermann, J.; Seeberger, P.H.; Baumgärtner, W.; et al. The C-type Lectin Receptor CLEC12A Recognizes Plasmodial Hemozoin and Contributes to Cerebral Malaria Development. Cell Rep. 2019, 28, 30–38.e5. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kalia, N.; Singh, J.; Kaur, M. The role of dectin-1 in health and disease. Immunobiology 2021, 226, 152071. [Google Scholar] [CrossRef]
- Brown, G.D.; Herre, J.; Williams, D.L.; Willment, J.A.; Marshall, A.S.J.; Gordon, S. Dectin-1 Mediates the Biological Effects of β-Glucans. J. Exp. Med. 2003, 197, 1119–1124. [Google Scholar] [CrossRef] [Green Version]
- Sfikakis, P.P.; Verrou, K.M.; Ampatziadis-Michailidis, G.; Tsitsilonis, O.; Paraskevis, D.; Kastritis, E.; Lianidou, E.; Moutsatsou, P.; Terpos, E.; Trougakos, I.; et al. Blood Transcriptomes of Anti-SARS-CoV-2 Antibody-Positive Healthy Individuals Who Experienced Asymptomatic Versus Clinical Infection. Front. Immunol. 2021, 12, 746203. [Google Scholar] [CrossRef] [PubMed]
- Yamamoto, H.; Tomiyama, C.; Sato, K.; Kasamatsu, J.; Takano, K.; Umeki, A.; Nakahata, N.; Miyasaka, T.; Kanno, E.; Tanno, H.; et al. Dectin-2-mediated initiation of immune responses caused by influenza virus hemagglutinin. Biomed. Res. 2021, 42, 53–66. [Google Scholar] [CrossRef] [PubMed]
- Valladeau, J.; Ravel, O.; Dezutter-Dambuyant, C.; Moore, K.; Kleijmeer, M.; Liu, Y.; Duvert-Frances, V.; Vincent, C.; Schmitt, D.; Davoust, J.; et al. Langerin, a Novel C-Type Lectin Specific to Langerhans Cells, Is an Endocytic Receptor that Induces the Formation of Birbeck Granules. Immunity 2000, 12, 71–81. [Google Scholar] [CrossRef] [Green Version]
- de Witte, L.; Nabatov, A.; Pion, M.; Fluitsma, D.; de Jong, M.A.W.P.; de Gruijl, T.; Piguet, V.; van Kooyk, Y.; Geijtenbeek, T.B.H. Langerin is a natural barrier to HIV-1 transmission by Langerhans cells. N. Engl. J. Med. 2007, 13, 367–371. [Google Scholar] [CrossRef]
- Ng, W.C.; Londrigan, S.L.; Nasr, N.; Cunningham, A.L.; Turville, S.; Brooks, A.G.; Reading, P.C. The C-type Lectin Langerin Functions as a Receptor for Attachment and Infectious Entry of Influenza A Virus. J. Virol. 2016, 90, 206–221. [Google Scholar] [CrossRef] [Green Version]
- Stambach, N.S. Characterization of carbohydrate recognition by langerin, a C-type lectin of Langerhans cells. Glycobiology 2003, 13, 401–410. [Google Scholar] [CrossRef]
- Phoenix, I.; Nishiyama, S.; Lokugamage, N.; Hill, T.; Huante, M.; Slack, O.; Carpio, V.; Freiberg, A.; Ikegami, T. N-Glycans on the Rift Valley Fever Virus Envelope Glycoproteins Gn and Gc Redundantly Support Viral Infection via DC-SIGN. Viruses 2016, 8, 149. [Google Scholar] [CrossRef] [Green Version]
- Willment, J.A. Fc-conjugated C-type lectin receptors: Tools for understanding host–pathogen interactions. Mol. Microbiol. 2021. [Google Scholar] [CrossRef]
- Achilli, S.; Monteiro, J.T.; Serna, S.; Mayer-Lambertz, S.; Thépaut, M.; Le Roy, A.; Ebel, C.; Reichardt, N.C.; Lepenies, B.; Fieschi, F.; et al. TETRALEC, Artificial Tetrameric Lectins: A Tool to Screen Ligand and Pathogen Interactions. Int. J. Mol. Sci. 2020, 21, 5290. [Google Scholar] [CrossRef]
- Geissner, A.; Reinhardt, A.; Rademacher, C.; Johannssen, T.; Monteiro, J.; Lepenies, B.; Thépaut, M.; Fieschi, F.; Mrázková, J.; Wimmerova, M.; et al. Microbe-focused glycan array screening platform. Proc. Natl. Acad. Sci. USA 2019, 116, 1958–1967. [Google Scholar] [CrossRef] [Green Version]
- Liu, L.; Celma, C.C.; Roy, P. Rift Valley fever virus structural proteins: Expression, characterization and assembly of recombinant proteins. Virol. J. 2008, 5, 82. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- He, L.; Piper, A.; Meilleur, F.; Myles, D.A.A.; Hernandez, R.; Brown, D.T.; Heller, W.T. The Structure of Sindbis Virus Produced from Vertebrate and Invertebrate Hosts as Determined by Small-Angle Neutron Scattering. J. Virol. 2010, 84, 5270–5276. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schön, K.; Lepenies, B.; Goyette-Desjardins, G. Impact of Protein Glycosylation on the Design of Viral Vaccines. Adv. Biochem. Eng. Biotechnol. 2021, 175, 319–354. [Google Scholar] [CrossRef] [PubMed]
- Weingartl, H.M.; Zhang, S.; Marszal, P.; McGreevy, A.; Burton, L.; Wilson, W.C. Rift Valley Fever Virus Incorporates the 78 kDa Glycoprotein into Virions Matured in Mosquito C6/36 Cells. PLoS ONE 2014, 9, e87385. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Klimstra, W.B.; Nangle, E.M.; Smith, M.S.; Yurochko, A.D.; Ryman, K.D. DC-SIGN and L-SIGN Can Act as Attachment Receptors for Alphaviruses and Distinguish between Mosquito Cell- and Mammalian Cell-Derived Viruses. J. Virol. 2003, 77, 12022–12032. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nfon, C.K.; Marszal, P.; Zhang, S.; Weingartl, H.M. Innate Immune Response to Rift Valley Fever Virus in Goats. PLoS Negl. Trop. Dis. 2012, 6, e1623. [Google Scholar] [CrossRef] [Green Version]
- Hanske, J.; Schulze, J.; Aretz, J.; McBride, R.; Loll, B.; Schmidt, H.; Knirel, Y.; Rabsch, W.; Wahl, M.C.; Paulson, J.C.; et al. Bacterial Polysaccharide Specificity of the Pattern Recognition Receptor Langerin Is Highly Species-dependent. J. Biol. Chem. 2017, 292, 862–871. [Google Scholar] [CrossRef] [Green Version]
- Hattori, Y.; Morita, D.; Fujiwara, N.; Mori, D.; Nakamura, T.; Harashima, H.; Yamasaki, S.; Sugita, M. Glycerol Monomycolate Is a Novel Ligand for the Human, but Not Mouse Macrophage Inducible C-type Lectin, Mincle. J. Biol. Chem. 2014, 289, 15405–15412. [Google Scholar] [CrossRef] [Green Version]
- Rajaram, M.V.S.; Arnett, E.; Azad, A.K.; Guirado, E.; Ni, B.; Gerberick, A.D.; He, L.-Z.; Keler, T.; Thomas, L.J.; Lafuse, W.P.; et al. M. tuberculosis -Initiated Human Mannose Receptor Signaling Regulates Macrophage Recognition and Vesicle Trafficking by FcRγ-Chain, Grb2, and SHP-1. Cell Rep. 2017, 21, 126–140. [Google Scholar] [CrossRef] [Green Version]
- Guo, Y.; Feinberg, H.; Conroy, E.; Mitchell, D.A.; Alvarez, R.; Blixt, O.; Taylor, M.E.; Weis, W.I.; Drickamer, K. Structural basis for distinct ligand-binding and targeting properties of the receptors DC-SIGN and DC-SIGNR. Nat. Struct. Mol. Biol. 2004, 11, 591–598. [Google Scholar] [CrossRef]
- Zhao, P.; Xu, L.D.; Zhang, Y.; Cao, H.; Chen, R.; Wang, B.; Huang, Y.W. Expression of the human or porcine C-type lectins DC-SIGN/L-SIGN confers susceptibility to porcine epidemic diarrhea virus entry and infection in otherwise refractory cell lines. Microb. Pathog. 2021, 157, 104956. [Google Scholar] [CrossRef] [PubMed]
- Piñeyro, P.E.; Subramaniam, S.; Kenney, S.P.; Heffron, C.L.; Giménez-Lirola, L.G.; Meng, X.J. Modulation of Proinflammatory Cytokines in Monocyte-Derived Dendritic Cells by Porcine Reproductive and Respiratory Syndrome Virus Through Interaction with the Porcine Intercellular-Adhesion-Molecule-3-Grabbing Nonintegrin. Viral Immunol. 2016, 29, 546–556. [Google Scholar] [CrossRef] [PubMed]
- Kumar, A.; Srivastava, P.; Sirisena, P.; Dubey, S.; Kumar, R.; Shrinet, J.; Sunil, S. Mosquito Innate Immunity. Insects 2018, 9, 95. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cheng, G.; Liu, Y.; Wang, P.; Xiao, X. Mosquito Defense Strategies against Viral Infection. Trends Parasitol. 2016, 32, 177–186. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xia, X.; You, M.; Rao, X.J.; Yu, X.Q. Insect C-type lectins in innate immunity. Dev. Comp. Immunol. 2018, 83, 70–79. [Google Scholar] [CrossRef] [PubMed]
- Hoffmann, A.B.; Mazelier, M.; Leger, P.; Lozach, P.Y. Deciphering Virus Entry with Fluorescently Labeled Viral Particles. Methods Mol. Biol. 2018, 1836, 159–183. [Google Scholar] [CrossRef]
- Murphy, F.A.; Gibbs EP, J.; Horzinek, M.C.; Studdert, M. Veterinary Virology, 3rd ed.; Academic Press: Cambridge, MA, USA, 1999. [Google Scholar]
- Stothard, P. The Sequence Manipulation Suite: JavaScript Programs for Analyzing and Formatting Protein and DNA Sequences. BioTechniques 2000, 28, 1102–1104. [Google Scholar] [CrossRef] [Green Version]
- Krogh, A.; Larsson, B.; von Heijne, G.; Sonnhammer, E.L. Predicting transmembrane protein topology with a hidden Markov model: Application to complete genomes. J. Mol. Biol. 2001, 305, 567–580. [Google Scholar] [CrossRef] [Green Version]
- Sonnhammer, E.L.; von Heijne, G.; Krogh, A. A hidden Markov model for predicting transmembrane helices in protein sequences. Proc. Int. Conf. Intell. Syst. Mol. Biol. 1998, 6, 175–182. [Google Scholar]
CTLDcps | AaegL5.1 ID | Primer Sequences (5′-3′) | Amplicon Size | CLR–hFc Fusion Protein Size |
---|---|---|---|---|
aeCTLMA15 | AAEL000563 | fw: GATATCATCTCATGGAGATTCTACGCC rev: CCATGGTCTCGCATATGAAATACAGCG | 413 bp | 41.62 kDa |
aeCTLGA6 | AAEL009209 | fw: GAATTCCTGTACCTCGCCATCG rev: CCATGGTCTCACAAACCGGCACC | 407 bp | 41.43 kDa |
aeCTLMA14 | AAEL0114382 | fw: GAATTCGTGTCGATGTGAAGCGG rev: CCATGGTTTCACAAACGAATTTCAATC | 407 bp | 41.3 kDa |
aeCLSP2 | AAEL019633 | fw: GAATTCATGCTTACATCAGCC rev: CCATGGTTTCACAAATGTAGCG | 410 bp | 41.28 kDa |
aeCTL23 | AAEL022823 | fw: GAATTCGGCACCTAGCTTGGTC rev: CCATGGTTTCACAGATAAAATACTTCTTC | 428 bp | 41.82 kDa |
C-Type Lectin | Gene | Protein ID | C-Type Lectin | Gene | Protein ID |
---|---|---|---|---|---|
hDC-SIGN | CD209 | NP_066978.1 | mMincle | Clec4e | NP_064332.1 |
hL-SIGN | CLEC4M | NP_055072.3 | mSignr1 | Cd209b | NP 081248.4 |
mClec12b | Clec12b | NP_001191152.1 | mSignr3 | Cd209d | NP 570974.1 |
mDcar | Clec4b1 | NP_001177239.1 | oDcir | Clec4A | XP_042103517.1 |
mDcl1 | Clec2i | NP_001276635.1 | oDectin-1 | Clec7A | XP_042103479.1 |
mDectin-1 | Clec7a | NP_064392.2 | oDectin-2 | Clec6A | XP_004006949.1 |
mDectin-2 | Clec6a | NP_064385.1 | oDngr-1 | Clec9A | XP_004006925.4 |
mDngr-1 | Clec9a | NP_001192292.1 | oLangerin | Clec4K, CD207 | XP_004006101.3 |
mLangerin | Clec4k, CD207 | NP_659192.2 | oMcl | Clec4D | XP_042103518.1 |
mMdl-1 | Clec5a | NP_001033693.1 | oMicl | Clec12A | XP_004006929.1 |
mMgl-1 | Clec10a | NP_001191181.1 | oMincle | Clec4E | XP_042103520.1 |
mMicl | Clec12a | NP_808354.1 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Schön, K.; Lindenwald, D.L.; Monteiro, J.T.; Glanz, J.; Jung, K.; Becker, S.C.; Lepenies, B. Vector and Host C-Type Lectin Receptor (CLR)–Fc Fusion Proteins as a Cross-Species Comparative Approach to Screen for CLR–Rift Valley Fever Virus Interactions. Int. J. Mol. Sci. 2022, 23, 3243. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms23063243
Schön K, Lindenwald DL, Monteiro JT, Glanz J, Jung K, Becker SC, Lepenies B. Vector and Host C-Type Lectin Receptor (CLR)–Fc Fusion Proteins as a Cross-Species Comparative Approach to Screen for CLR–Rift Valley Fever Virus Interactions. International Journal of Molecular Sciences. 2022; 23(6):3243. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms23063243
Chicago/Turabian StyleSchön, Kathleen, Dimitri L. Lindenwald, João T. Monteiro, Julien Glanz, Klaus Jung, Stefanie C. Becker, and Bernd Lepenies. 2022. "Vector and Host C-Type Lectin Receptor (CLR)–Fc Fusion Proteins as a Cross-Species Comparative Approach to Screen for CLR–Rift Valley Fever Virus Interactions" International Journal of Molecular Sciences 23, no. 6: 3243. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms23063243