miR-221-5p and miR-186-5p Are the Critical Bladder Cancer Derived Exosomal miRNAs in Natural Killer Cell Dysfunction
Abstract
:1. Introduction
2. Results
2.1. Exosome Identified
2.2. NK Cell Identified
2.3. NK Cell Can Take Up Exosome Efficiently
2.4. The Effect of T24 Exosome on NK Cells
2.5. The Effects of Exosomal miRNAs on NK Cells
3. Discussion
4. Materials and Methods
4.1. Ethics Statement
4.2. Cell Lines
4.3. NK Cells Expansion
4.4. Exosomes Isolation and Identification
4.5. Exosomes Uptake Assay
4.6. NK Cell Viability and Cytotoxicity
4.7. NK Cell Apoptosis and Receptor Expression
4.8. Exosomal miRNA Profile of T24 Cell
4.9. Target Gene Prediction
4.10. Luciferase Reporter Assay
4.11. NK Cell Transfection via Overexpression Target miRNAs in SV-HUC-1 Exosome
4.12. The Verification of Target Genes in NK Cell
4.13. Data Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Sung, H.; Ferlay, J.; Siegel, R.L.; Laversanne, M.; Soerjomataram, I.; Jemal, A.; Bray, F. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J. Clin. 2021, 71, 209–249. [Google Scholar] [CrossRef]
- Woolbright, B.L.; Ayres, M.; Taylor, J.A., 3rd. Metabolic changes in bladder cancer. Urol. Oncol. 2018, 36, 327–337. [Google Scholar] [CrossRef]
- Cornel, A.M.; Mimpen, I.L.; Nierkens, S. MHC Class I Downregulation in Cancer: Underlying Mechanisms and Potential Targets for Cancer Immunotherapy. Cancers 2020, 12, 1760. [Google Scholar] [CrossRef]
- Taylor, D.D.; Gercel-Taylor, C. Tumour-derived exosomes and their role in cancer-associated T-cell signalling defects. Br. J. Cancer 2005, 92, 305–311. [Google Scholar] [CrossRef]
- Chen, Z.; Chen, L.; Baker, K.; Olszak, T.; Zeissig, S.; Huang, Y.-H.; Kuo, T.T.; Mandelboim, O.; Beauchemin, N.; Lanier, L.L.; et al. CEACAM1 dampens antitumor immunity by down-regulating NKG2D ligand expression on tumor cells. J. Exp. Med. 2011, 208, 2633–2640. [Google Scholar] [CrossRef]
- Pende, D.; Rivera, P.; Marcenaro, S.; Chang, C.-C.; Biassoni, R.; Conte, R.; Kubin, M.; Cosman, D.; Ferrone, S.; Moretta, L.; et al. Major histocompatibility complex class I-related chain A and UL16-binding protein expression on tumor cell lines of different histotypes: Analysis of tumor susceptibility to NKG2D-dependent natural killer cell cytotoxicity. Cancer Res. 2002, 62, 6178–6186. [Google Scholar]
- Whiteside, T.L.; Mandapathil, M.; Szczepanski, M.; Szajnik, M. Mechanisms of tumor escape from the immune system: Adenosine-producing Treg, exosomes and tumor-associated TLRs. Bull. Cancer 2011, 98, E25–E31. [Google Scholar] [CrossRef]
- McGilvray, R.W.; Eagle, R.A.; Watson, N.F.; Al-Attar, A.; Ball, G.; Jafferji, I.; Trowsdale, J.; Durrant, L.G. NKG2D ligand expression in human colorectal cancer reveals associations with prognosis and evidence for immunoediting. Clin. Cancer Res. 2009, 15, 6993–7002. [Google Scholar] [CrossRef] [Green Version]
- Li, K.; Mandai, M.; Hamanishi, J.; Matsumura, N.; Suzuki, A.; Yagi, H.; Yamaguchi, K.; Baba, T.; Fujii, S.; Konishi, I. Clinical significance of the NKG2D ligands, MICA/B and ULBP2 in ovarian cancer: High expression of ULBP2 is an indicator of poor prognosis. Cancer Immunol. Immunother. 2009, 58, 641–652. [Google Scholar] [CrossRef]
- Eisele, G.; Wischhusen, J.; Mittelbronn, M.; Meyermann, R.; Waldhauer, I.; Steinle, A.; Weller, M.; Friese, M.A. TGF-beta and metalloproteinases differentially suppress NKG2D ligand surface expression on malignant glioma cells. Brain 2006, 129 Pt 9, 2416–2425. [Google Scholar] [CrossRef] [Green Version]
- Baginska, J.; Viry, E.; Paggetti, J.; Medves, S.; Berchem, G.; Moussay, E.; Janji, B. The critical role of the tumor microenvironment in shaping natural killer cell-mediated anti-tumor immunity. Front Immunol. 2013, 4, 490. [Google Scholar] [CrossRef] [PubMed]
- Nielsen, N.; Odum, N.; Urso, B.; Lanier, L.L.; Spee, P. Cytotoxicity of CD56(bright) NK cells towards autologous activated CD4+ T cells is mediated through NKG2D, LFA-1 and TRAIL and dampened via CD94/NKG2A. PLoS ONE 2012, 7, e31959. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Carballido, J.; Alvarez-Mon, M.; Solovera, O.J.; Menendez-Ondina, L.; Durantez, A. Clinical significance of natural killer activity in patients with transitional cell carcinoma of the bladder. J. Urol. 1990, 143, 29–33. [Google Scholar] [CrossRef] [PubMed]
- Morita, T.; Tokue, A.; Minato, N. Analysis of natural killer activity and natural killer cell subsets in patients with bladder cancer. Cancer Immunol. Immunother. 1990, 32, 191–194. [Google Scholar] [CrossRef]
- Kowal, J.; Tkach, M.; Thery, C. Biogenesis and secretion of exosomes. Curr. Opin. Cell Biol. 2014, 29, 116–125. [Google Scholar] [CrossRef] [Green Version]
- Nolte-'t Hoen, E.; Cremer, T.; Gallo, R.C.; Margolis, L.B. Extracellular vesicles and viruses: Are they close relatives? Proc. Natl. Acad. Sci. USA 2016, 113, 9155–9161. [Google Scholar] [CrossRef] [Green Version]
- Isaac, R.; Reis, F.C.G.; Ying, W.; Olefsky, J.M. Exosomes as mediators of intercellular crosstalk in metabolism. Cell Metab. 2021, 33, 1744–1762. [Google Scholar] [CrossRef]
- Keller, S.; Ridinger, J.; Rupp, A.K.; Janssen, J.W.; Altevogt, P. Body fluid derived exosomes as a novel template for clinical diagnostics. J. Transl. Med. 2011, 9, 86. [Google Scholar] [CrossRef] [Green Version]
- Oltra, E. Relevance of splicing on tumor-released exosome landscape: Implications in cancer therapeutics. Front Endocrinol. 2014, 5, 194. [Google Scholar] [CrossRef] [Green Version]
- Akers, J.C.; Gonda, D.; Kim, R.; Carter, B.S.; Chen, C.C. Biogenesis of extracellular vesicles (EV): Exosomes, microvesicles, retrovirus-like vesicles, and apoptotic bodies. J. Neurooncol. 2013, 113, 1–11. [Google Scholar] [CrossRef] [Green Version]
- Zhang, H.-D.; Jiang, L.-H.; Hou, J.-C.; Zhong, S.-L.; Zhu, L.-P.; Wang, D.-D.; Zhou, S.-Y.; Yang, S.-J.; Wang, J.-Y.; Zhang, Q.; et al. Exosome: A novel mediator in drug resistance of cancer cells. Epigenomics 2018, 10, 1499–1509. [Google Scholar] [CrossRef]
- Maisano, D.; Mimmi, S.; Dattilo, V.; Marino, F.; Gentile, M.; Vecchio, E.; Fiume, G.; Nisticò, N.; Aloisio, A.; de Santo, M.P.; et al. A novel phage display based platform for exosome diversity characterization. Nanoscale 2022, 14, 2998–3003. [Google Scholar] [CrossRef]
- Whiteside, T.L. Immune modulation of T-cell and NK (natural killer) cell activities by TEXs (tumour-derived exosomes). Biochem. Soc. Trans. 2013, 41, 245–251. [Google Scholar] [CrossRef]
- Xia, Y.; Zhang, Q.; Zhen, Q.; Zhao, Y.; Liu, N.; Li, T.; Hao, Y.; Zhang, Y.; Luo, C.; Wu, X. Negative regulation of tumor-infiltrating NK cell in clear cell renal cell carcinoma patients through the exosomal pathway. Oncotarge 2017, 8, 37783–37795. [Google Scholar] [CrossRef] [Green Version]
- Olejarz, W.; Dominiak, A.; Zolnierzak, A.; Kubiak-Tomaszewska, G.; Lorenc, T. Tumor-Derived Exosomes in Immunosuppression and Immunotherapy. J. Immunol. Res. 2020, 2020, 6272498. [Google Scholar] [CrossRef]
- Coca, S.; Perez-Piqueras, J.; Martinez, D.; Colmenarejo, A.; Saez, M.A.; Vallejo, C.; Martos, J.A.; Moreno, M. The prognostic significance of intratumoral natural killer cells in patients with colorectal carcinoma. Cancer 1997, 79, 2320–2328. [Google Scholar] [CrossRef]
- Ishigami, S.; Natsugoe, S.; Tokuda, K.; Nakajo, A.; Xiangming, C.; Iwashige, H.; Aridome, K.; Hokita, S.; Aikou, T. Clinical impact of intratumoral natural killer cell and dendritic cell infiltration in gastric cancer. Cancer Lett. 2000, 159, 103–108. [Google Scholar] [CrossRef]
- Peng, Y.-P.; Zhu, Y.; Zhang, J.-J.; Xu, Z.-K.; Qian, Z.-Y.; Dai, C.-C.; Jiang, K.-R.; Wu, J.-L.; Gao, W.-T.; Li, Q.; et al. Comprehensive analysis of the percentage of surface receptors and cytotoxic granules positive natural killer cells in patients with pancreatic cancer, gastric cancer, and colorectal cancer. J. Transl. Med. 2013, 11, 262. [Google Scholar] [CrossRef] [Green Version]
- Parry, H.M.; Stevens, T.; Oldreive, C.; Zadran, B.; McSkeane, T.; Rudzki, Z.; Paneesha, S.; Chadwick, C.; Stankovic, T.; Pratt, G.; et al. NK cell function is markedly impaired in patients with chronic lymphocytic leukaemia but is preserved in patients with small lymphocytic lymphoma. Oncotarget 2016, 7, 68513–68526. [Google Scholar] [CrossRef] [Green Version]
- Hermann, G.G.; Petersen, K.R.; Steven, K.; Zeuthen, J. Reduced LAK cytotoxicity of peripheral blood mononuclear cells in patients with bladder cancer: Decreased LAK cytotoxicity caused by a low incidence of CD56+ and CD57+ mononuclear blood cells. J. Clin. Immunol. 1990, 10, 311–320. [Google Scholar] [CrossRef]
- Zhang, W.; Feng, H.; Chen, Q.; Lu, X.; Ge, J. The functional potency of natural killer cells in response to IL-2/IL-15/IL-21 stimulation is limited by a concurrent upregulation of Tim-3 in bladder cancer. Exp. Cell Res. 2018, 372, 92–98. [Google Scholar] [CrossRef] [PubMed]
- Mukherjee, N.; Ji, N.; Hurez, V.; Curiel, T.J.; Montgomery, M.O.; Braun, A.J.; Nicolas, M.; Aguilera, M.; Kaushik, D.; Liu, Q.; et al. Intratumoral CD56(bright) natural killer cells are associated with improved survival in bladder cancer. Oncotarget 2018, 9, 36492–36502. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, Q.; Wang, H.; Peng, H.; Huyan, T.; Cacalano, N.A. Exosomes: Versatile Nano Mediators of Immune Regulation. Cancers 2019, 11, 1557. [Google Scholar] [CrossRef] [Green Version]
- Clayton, A.; Mitchell, J.P.; Court, J.; Linnane, S.; Mason, M.D.; Tabi, Z. Human tumor-derived exosomes down-modulate NKG2D expression. J. Immunol. 2008, 180, 7249–7258. [Google Scholar] [CrossRef] [Green Version]
- Li, Q.; Wang, H.; Peng, H.; Huang, Q.; Huyan, T.; Huang, Q.; Yang, H.; Shi, J. MicroRNAs: Key Players in Bladder Cancer. Mol. Diagn. Ther. 2019, 23, 579–601. [Google Scholar] [CrossRef] [PubMed]
- Liu, S.; Wang, Y.; Li, W.; Yu, S.; Wen, Z.; Chen, Z.; Lin, F. miR-221-5p acts as an oncogene and predicts worse survival in patients of renal cell cancer. Biomed. Pharmacother. 2019, 119, 109406. [Google Scholar] [CrossRef] [PubMed]
- Shao, N.; Ma, G.; Zhang, J.; Zhu, W. miR-221-5p enhances cell proliferation and metastasis through post-transcriptional regulation of SOCS1 in human prostate cancer. BMC Urol. 2018, 18, 14. [Google Scholar] [CrossRef] [Green Version]
- Kiener, M.; Chen, L.; Krebs, M.; Grosjean, J.; Klima, I.; Kalogirou, C.; Riedmiller, H.; Kneitz, B.; Thalmann, G.N.; Snaar-Jagalska, E.; et al. miR-221-5p regulates proliferation and migration in human prostate cancer cells and reduces tumor growth in vivo. BMC Cancer 2019, 19, 627. [Google Scholar] [CrossRef]
- Jiang, X.; Jiang, M.; Guo, S.; Cai, P.; Wang, W.; Li, Y. Promotion of miR-221-5p on the Sensitivity of Gastric Cancer Cells to Cisplatin and Its Effects on Cell Proliferation and Apoptosis by Regulating DDR1. Onco. Targets Ther. 2020, 13, 2333–2345. [Google Scholar] [CrossRef] [Green Version]
- Li, Q.; Huyan, T.; Cai, S.; Huang, Q.; Zhang, M.; Peng, H.; Zhang, Y.; Liu, N.; Zhang, W. The role of exosomal miR-375-3p: A potential suppressor in bladder cancer via the Wnt/beta-catenin pathway. FASEB J. 2020, 34, 12177–12196. [Google Scholar] [CrossRef]
- Li, G.; Zhang, H.; Ma, H.; Qu, S.; Xing, Q.; Wang, G. MiR-221-5p is involved in the regulation of inflammatory responses in acute gouty arthritis by targeting IL-1beta. Int. J. Rheum. Dis. 2021, 24, 335–340. [Google Scholar] [CrossRef]
- Fang, K.; Sideri, A.; Law, I.K.M.; Bakirtzi, K.; Koon, H.W.; Oikonomopoulos, A.; Hommes, D.W.; Iliopoulos, D.; Polytarchou, C. Identification of a novel substance P (SP)-neurokinin-1 receptor (NK-1R) microRNA-221-5p inflammatory network in human colonic epithelial cells. Cell Mol. Gastroenterol. Hepatol. 2015, 1, 503–515. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Feng, H.; Zhang, Z.; Qing, X.; French, S.W.; Liu, D. miR-186-5p promotes cell growth, migration and invasion of lung adenocarcinoma by targeting PTEN. Exp. Mol. Pathol. 2019, 108, 105–113. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Z.; Zhang, W.; Mao, J.; Xu, Z.; Fan, M. miR-186-5p Functions as a Tumor Suppressor in Human Osteosarcoma by Targeting FOXK1. Cell Physiol. Biochem. 2019, 52, 553–564. [Google Scholar] [PubMed] [Green Version]
- Liu, X.; Zhou, X.; Chen, Y.; Huang, Y.; He, J.; Luo, H. miR-186-5p targeting SIX1 inhibits cisplatin resistance in non-small-cell lung cancer cells (NSCLCs). Neoplasma 2020, 67, 147–157. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Xia, L.; Zhou, Z.; Zuo, Z.; Xu, C.; Song, H.; Cai, J. MiR-186-5p upregulation inhibits proliferation, metastasis and epithelial-to-mesenchymal transition of colorectal cancer cell by targeting ZEB1. Arch. Biochem. Biophys. 2018, 640, 53–60. [Google Scholar] [CrossRef]
- Zhu, K.; Su, Y.; Xu, B.; Wang, Z.; Sun, H.; Wang, L.; Sun, C.; He, X. MicroRNA-186-5p represses neuroblastoma cell growth via downregulation of Eg5. Am. J. Transl. Res. 2019, 11, 2245–2256. [Google Scholar]
- Huyan, T.; Li, H.; Peng, H.; Chen, J.; Yang, R.; Zhang, W.; Li, Q. Extracellular Vesicles—Advanced Nanocarriers in Cancer Therapy: Progress and Achievements. Int. J. Nanomed. 2020, 15, 6485–6502. [Google Scholar] [CrossRef]
- Kamerkar, S.; LeBleu, V.S.; Sugimoto, H.; Yang, S.; Ruivo, C.F.; Melo, S.A.; Lee, J.J.; Kalluri, R. Exosomes facilitate therapeutic targeting of oncogenic KRAS in pancreatic cancer. Nature 2017, 546, 498–503. [Google Scholar] [CrossRef] [Green Version]
- Li, Q.; Mei, Q.; Huyan, T.; Xie, L.; Che, S.; Yang, H.; Zhang, M.; Huang, Q. Effects of simulated microgravity on primary human NK cells. Astrobiology 2013, 13, 703–714. [Google Scholar] [CrossRef]
- Thery, C.; Amigorena, S.; Raposo, G.; Clayton, A. Isolation and characterization of exosomes from cell culture supernatants and biological fluids. In Current Protocols in Cell Biology; John Wiley & Sons, Inc.: Hoboken, NJ, USA, 2006; Chapter 3; Unit 3 22. [Google Scholar]
- Li, Q.; Huang, Q.; Huyan, T.; Wang, Y.; Huang, Q.; Shi, J. Bifacial effects of engineering tumour cell-derived exosomes on human natural killer cells. Exp. Cell Res. 2018, 363, 141–150. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Lamichhane, T.N.; Raiker, R.S.; Jay, S.M. Exogenous DNA Loading into Extracellular Vesicles via Electroporation is Size-Dependent and Enables Limited Gene Delivery. Mol. Pharm. 2015, 12, 3650–3657. [Google Scholar] [CrossRef] [PubMed]
Antibody | Brand | Catalog Number. |
---|---|---|
PE Mouse Anti-human NKG2A | R&D | FAB1059P |
PE Mouse Anti-human NKG2D | BD Pharmingen | 554680 |
PE Mouse Anti- human NKp30 | BD Pharmingen | 558407 |
PE Mouse Anti-human NKp44 | BD Pharmingen | 558563 |
PE Mouse Anti-human NKp46 | BD Pharmingen | 557991 |
PE Anti-human CD226 [DX11] | abcam | ab33337 |
Hsp70 | abcam | ab2787 |
CD63 | abcam | ab134045 |
CD81 | abcam | ab79559 |
IFN-γ | abcam | ab267369 |
Granzyme-B | abcam | ab255598 |
Perforin | abcam | ab256453 |
DAP10 | Santacruze | sc-374196 |
FOXO1 | abcam | ab179450 |
CD96 | abcam | ab264416 |
NKG2D | abcam | ab96606 |
β-actin | abcam | ab8226 |
miRNA ID | Accession Number | Forward Primer Sequence (5′–3′) | Tm | %GC |
---|---|---|---|---|
hsa-miR-221-5p | MIMAT0004568 | CGCGACCTGGCATACAATGT | 61.6 | 54.55% |
hsa-miR-186-5p | MIMAT0000456 | ATGCGCGCCAAAGAATTCTCC | 62.78 | 52.38% |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Huyan, T.; Gao, L.; Gao, N.; Wang, C.; Guo, W.; Zhou, X.; Li, Q. miR-221-5p and miR-186-5p Are the Critical Bladder Cancer Derived Exosomal miRNAs in Natural Killer Cell Dysfunction. Int. J. Mol. Sci. 2022, 23, 15177. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms232315177
Huyan T, Gao L, Gao N, Wang C, Guo W, Zhou X, Li Q. miR-221-5p and miR-186-5p Are the Critical Bladder Cancer Derived Exosomal miRNAs in Natural Killer Cell Dysfunction. International Journal of Molecular Sciences. 2022; 23(23):15177. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms232315177
Chicago/Turabian StyleHuyan, Ting, Lina Gao, Na Gao, Chaochao Wang, Wuli Guo, Xiaojie Zhou, and Qi Li. 2022. "miR-221-5p and miR-186-5p Are the Critical Bladder Cancer Derived Exosomal miRNAs in Natural Killer Cell Dysfunction" International Journal of Molecular Sciences 23, no. 23: 15177. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms232315177