Aerobic Exercise Facilitates the Nuclear Translocation of SREBP2 by Activating AKT/SEC24D to Contribute Cholesterol Homeostasis for Improving Cognition in APP/PS1 Mice
Abstract
:1. Introduction
2. Results
2.1. Aerobic Exercise Improves Learning Memory in APP/PS1 Mice
2.2. Aerobic Exercise Promotes Nuclear Translocation of SREBP2 in the Brains of APP/PS1 Mice
2.3. Aerobic Exercise Activates AKT/SEC24D Signaling Pathway in APP/PS1 Mouse Brain to Promote Nuclear Translocation of SERBP2
2.4. Aerobic Exercise Promotes the Expression of Cholesterol-Synthesis-Related Proteases in the Brain of APP/PS1 Mice
2.5. Aerobic Exercise Promotes Neuronal Cholesterol Efflux and Reduces APP Amyloid Pathway Cleavage in the Brain of APP/PS1 Mice
2.6. Aerobic Exercise Promotes Cholesterol Turnover in the Brain of APP/PS1 Mice
2.7. Aerobic Exercise Improves Neurosynapses in APP/PS1 Mouse Brain
3. Discussion
4. Materials and Methods
4.1. Experimental Animals and Grouping
4.2. Exercise Programs
4.3. Morris Water Maze (MWM) Test
4.4. Brain Tissue Collection
4.5. Enzyme-Linked Immunosorbent Assay
4.6. Real-Time PCR
4.7. Western Blotting Analysis
4.8. Immunofluorescence Staining
4.9. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Loera-Valencia, R.; Goikolea, J.; Parrado-Fernandez, C.; Merino-Serrais, P.; Maioli, S. Alterations in cholesterol metabolism as a risk factor for developing Alzheimer’s disease: Potential novel targets for treatment. J. Steroid Biochem. Mol. Biol. 2019, 190, 104–114. [Google Scholar] [CrossRef]
- Feringa, F.M.; van der Kant, R. Cholesterol and Alzheimer’s Disease; From Risk Genes to Pathological Effects. Front. Aging Neurosci. 2021, 13, 690372. [Google Scholar] [CrossRef]
- Vance, J.E. Dysregulation of cholesterol balance in the brain: Contribution to neurodegenerative diseases. Dis. Model. Mech. 2012, 5, 746–755. [Google Scholar] [CrossRef] [PubMed]
- Ferris, H.A.; Perry, R.J.; Moreira, G.V.; Shulman, G.I.; Horton, J.D.; Kahn, C.R. Loss of astrocyte cholesterol synthesis disrupts neuronal function and alters whole-body metabolism. Proc. Natl. Acad. Sci. USA 2017, 114, 1189–1194. [Google Scholar] [CrossRef] [PubMed]
- Panchal, M.; Loeper, J.; Cossec, J.C.; Perruchini, C.; Lazar, A.; Pompon, D.; Duyckaerts, C. Enrichment of cholesterol in microdissected Alzheimer’s disease senile plaques as assessed by mass spectrometry. J. Lipid Res. 2010, 51, 598–605. [Google Scholar] [CrossRef] [PubMed]
- Lazar, A.N.; Bich, C.; Panchal, M.; Desbenoit, N.; Petit, V.W.; Touboul, D.; Dauphinot, L.; Marquer, C.; Laprevote, O.; Brunelle, A.; et al. Time-of-flight secondary ion mass spectrometry (TOF-SIMS) imaging reveals cholesterol overload in the cerebral cortex of Alzheimer disease patients. Acta Neuropathol. 2013, 125, 133–144. [Google Scholar] [CrossRef]
- Saher, G.; Quintes, S.; Nave, K.A. Cholesterol: A novel regulatory role in myelin formation. Neuroscientist 2011, 17, 79–93. [Google Scholar] [CrossRef]
- Dupree, J.L.; Pomicter, A.D. Myelin, DIGs, and membrane rafts in the central nervous system. Prostaglandins Other Lipid Mediat. 2010, 91, 118–129. [Google Scholar] [CrossRef]
- Goritz, C.; Mauch, D.H.; Pfrieger, F.W. Multiple mechanisms mediate cholesterol-induced synaptogenesis in a CNS neuron. Mol. Cell Neurosci. 2005, 29, 190–201. [Google Scholar] [CrossRef]
- Chang, T.Y.; Yamauchi, Y.; Hasan, M.T.; Chang, C. Cellular cholesterol homeostasis and Alzheimer’s disease. J. Lipid Res. 2017, 58, 2239–2254. [Google Scholar] [CrossRef]
- Sharp, F.R.; DeCarli, C.S.; Jin, L.W.; Zhan, X. White matter injury, cholesterol dysmetabolism, and APP/Abeta dysmetabolism interact to produce Alzheimer’s disease (AD) neuropathology: A hypothesis and review. Front. Aging Neurosci. 2023, 15, 1096206. [Google Scholar] [CrossRef] [PubMed]
- Brown, M.S.; Goldstein, J.L. The SREBP pathway: Regulation of cholesterol metabolism by proteolysis of a membrane-bound transcription factor. Cell 1997, 89, 331–340. [Google Scholar] [CrossRef] [PubMed]
- Brown, M.S.; Radhakrishnan, A.; Goldstein, J.L. Retrospective on Cholesterol Homeostasis: The Central Role of Scap. Annu. Rev. Biochem. 2018, 87, 783–807. [Google Scholar] [CrossRef] [PubMed]
- Espenshade, P.J.; Cheng, D.; Goldstein, J.L.; Brown, M.S. Autocatalytic processing of site-1 protease removes propeptide and permits cleavage of sterol regulatory element-binding proteins. J. Biol. Chem. 1999, 274, 22795–22804. [Google Scholar] [CrossRef]
- Zelenski, N.G.; Rawson, R.B.; Brown, M.S.; Goldstein, J.L. Membrane topology of S2P, a protein required for intramembranous cleavage of sterol regulatory element-binding proteins. J. Biol. Chem. 1999, 274, 21973–21980. [Google Scholar] [CrossRef]
- Wang, C.; Zhao, F.; Shen, K.; Wang, W.; Siedlak, S.L.; Lee, H.G.; Phelix, C.F.; Perry, G.; Shen, L.; Tang, B.; et al. The sterol regulatory element-binding protein 2 is dysregulated by tau alterations in Alzheimer disease. Brain Pathol. 2019, 29, 530–543. [Google Scholar] [CrossRef]
- Scheltens, P.; Blennow, K.; Breteler, M.M.; de Strooper, B.; Frisoni, G.B.; Salloway, S.; Van der Flier, W.M. Alzheimer’s disease. Lancet 2016, 388, 505–517. [Google Scholar] [CrossRef]
- Mohamed, A.; Viveiros, A.; Williams, K.; Posse de Chaves, E. Abeta inhibits SREBP-2 activation through Akt inhibition. J. Lipid Res. 2018, 59, 1–13. [Google Scholar] [CrossRef]
- Sharpe, L.J.; Luu, W.; Brown, A.J. Akt phosphorylates Sec24: New clues into the regulation of ER-to-Golgi trafficking. Traffic 2011, 12, 19–27. [Google Scholar] [CrossRef]
- Cho, J.W.; Jung, S.Y.; Kim, D.Y.; Chung, Y.R.; Choi, H.H.; Jeon, J.W.; Han, J.H. PI3K-Akt-Wnt Pathway Is Implicated in Exercise-Induced Improvement of Short-term Memory in Cerebral Palsy Rats. Int. Neurourol. J. 2018, 22, S156–S164. [Google Scholar] [CrossRef]
- Testa, G.; Staurenghi, E.; Zerbinati, C.; Gargiulo, S.; Iuliano, L.; Giaccone, G.; Fanto, F.; Poli, G.; Leonarduzzi, G.; Gamba, P. Changes in brain oxysterols at different stages of Alzheimer’s disease: Their involvement in neuroinflammation. Redox Biol. 2016, 10, 24–33. [Google Scholar] [CrossRef] [PubMed]
- Petrov, A.M.; Pikuleva, I.A. Cholesterol 24-Hydroxylation by CYP46A1: Benefits of Modulation for Brain Diseases. Neurotherapeutics 2019, 16, 635–648. [Google Scholar] [CrossRef] [PubMed]
- Sole-Domenech, S.; Sjovall, P.; Vukojevic, V.; Fernando, R.; Codita, A.; Salve, S.; Bogdanovic, N.; Mohammed, A.H.; Hammarstrom, P.; Nilsson, K.P.; et al. Localization of cholesterol, amyloid and glia in Alzheimer’s disease transgenic mouse brain tissue using time-of-flight secondary ion mass spectrometry (ToF-SIMS) and immunofluorescence imaging. Acta Neuropathol. 2013, 125, 145–157. [Google Scholar] [CrossRef]
- Xiong, H.; Callaghan, D.; Jones, A.; Walker, D.G.; Lue, L.F.; Beach, T.G.; Sue, L.I.; Woulfe, J.; Xu, H.; Stanimirovic, D.B.; et al. Cholesterol retention in Alzheimer’s brain is responsible for high beta- and gamma-secretase activities and Abeta production. Neurobiol. Dis. 2008, 29, 422–437. [Google Scholar] [CrossRef]
- Chew, C.; Sengelaub, D.R. Neuroprotective Effects of Exercise on the Morphology of Somatic Motoneurons Following the Death of Neighboring Motoneurons. Neurorehabilit. Neural Repair. 2019, 33, 656–667. [Google Scholar] [CrossRef]
- Tuan, L.H.; Tsao, C.Y.; Lee, L.J.; Lee, L.J. Voluntary exercise ameliorates synaptic pruning deficits in sleep-deprived adolescent mice. Brain Behav. Immun. 2021, 93, 96–110. [Google Scholar] [CrossRef]
- Jian, Y.; Yuan, S.; Yang, J.; Lei, Y.; Li, X.; Liu, W. Aerobic Exercise Alleviates Abnormal Autophagy in Brain Cells of APP/PS1 Mice by Upregulating AdipoR1 Levels. Int. J. Mol. Sci. 2022, 23, 9921. [Google Scholar] [CrossRef]
- Kawamura, S.; Matsushita, Y.; Kurosaki, S.; Tange, M.; Fujiwara, N.; Hayata, Y.; Hayakawa, Y.; Suzuki, N.; Hata, M.; Tsuboi, M.; et al. Inhibiting SCAP/SREBP exacerbates liver injury and carcinogenesis in murine nonalcoholic steatohepatitis. J. Clin. Investig. 2022, 132, e151895. [Google Scholar] [CrossRef] [PubMed]
- Dai, L.; Zou, L.; Meng, L.; Qiang, G.; Yan, M.; Zhang, Z. Cholesterol Metabolism in Neurodegenerative Diseases: Molecular Mechanisms and Therapeutic Targets. Mol. Neurobiol. 2021, 58, 2183–2201. [Google Scholar] [CrossRef]
- Varma, V.R.; Busra Luleci, H.; Oommen, A.M.; Varma, S.; Blackshear, C.T.; Griswold, M.E.; An, Y.; Roberts, J.A.; O’Brien, R.; Pletnikova, O.; et al. Abnormal brain cholesterol homeostasis in Alzheimer’s disease-a targeted metabolomic and transcriptomic study. NPJ Aging Mech. Dis. 2021, 7, 11. [Google Scholar] [CrossRef]
- Bai, X.; Mai, M.; Yao, K.; Zhang, M.; Huang, Y.; Zhang, W.; Guo, X.; Xu, Y.; Zhang, Y.; Qurban, A.; et al. The role of DHCR24 in the pathogenesis of AD: Re-cognition of the relationship between cholesterol and AD pathogenesis. Acta Neuropathol. Commun. 2022, 10, 35. [Google Scholar] [CrossRef]
- Cho, Y.Y.; Kwon, O.H.; Chung, S. Preferred Endocytosis of Amyloid Precursor Protein from Cholesterol-Enriched Lipid Raft Microdomains. Molecules 2020, 25, 5490. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Zhang, X.; Wang, T.; Liu, W.; Wang, L.; Hao, L.; Ju, M.; Xiao, R. 27-Hydroxycholesterol Promotes the Transfer of Astrocyte-Derived Cholesterol to Neurons in Co-cultured SH-SY5Y Cells and C6 Cells. Front. Cell Dev. Biol. 2020, 8, 580599. [Google Scholar] [CrossRef] [PubMed]
- Fabelo, N.; Martin, V.; Marin, R.; Moreno, D.; Ferrer, I.; Diaz, M. Altered lipid composition in cortical lipid rafts occurs at early stages of sporadic Alzheimer’s disease and facilitates APP/BACE1 interactions. Neurobiol. Aging 2014, 35, 1801–1812. [Google Scholar] [CrossRef]
- Lewandowski, C.T.; Laham, M.S.; Thatcher, G.R.J. Remembering your A, B, C’s: Alzheimer’s disease and ABCA1. Acta Pharm. Sin. B 2022, 12, 995–1018. [Google Scholar] [CrossRef] [PubMed]
- Marchi, C.; Adorni, M.P.; Caffarra, P.; Ronda, N.; Spallazzi, M.; Barocco, F.; Galimberti, D.; Bernini, F.; Zimetti, F. ABCA1- and ABCG1-mediated cholesterol efflux capacity of cerebrospinal fluid is impaired in Alzheimer’s disease. J. Lipid Res. 2019, 60, 1449–1456. [Google Scholar] [CrossRef]
- Gali, C.C.; Fanaee-Danesh, E.; Zandl-Lang, M.; Albrecher, N.M.; Tam-Amersdorfer, C.; Stracke, A.; Sachdev, V.; Reichmann, F.; Sun, Y.; Avdili, A.; et al. Amyloid-beta impairs insulin signaling by accelerating autophagy-lysosomal degradation of LRP-1 and IR-beta in blood-brain barrier endothelial cells in vitro and in 3XTg-AD mice. Mol. Cell Neurosci. 2019, 99, 103390. [Google Scholar] [CrossRef]
- Shinohara, M.; Fujioka, S.; Murray, M.E.; Wojtas, A.; Baker, M.; Rovelet-Lecrux, A.; Rademakers, R.; Das, P.; Parisi, J.E.; Graff-Radford, N.R.; et al. Regional distribution of synaptic markers and APP correlate with distinct clinicopathological features in sporadic and familial Alzheimer’s disease. Brain A J. Neurol. 2014, 137, 1533–1549. [Google Scholar] [CrossRef]
- Francis, G.A.; Fayard, E.; Picard, F.; Auwerx, J. Nuclear receptors and the control of metabolism. Annu. Rev. Physiol. 2003, 65, 261–311. [Google Scholar] [CrossRef]
- Qu, X.; Lin, L.; Yi, W.; Sun, C.; Chen, Y.; Chen, Y. Early Changes in Transcriptomic Profiles in Synaptodendrosomes Reveal Aberrant Synaptic Functions in Alzheimer’s Disease. Int. J. Mol. Sci. 2022, 23, 8888. [Google Scholar] [CrossRef]
- Mauch, D.H.; Nagler, K.; Schumacher, S.; Goritz, C.; Muller, E.C.; Otto, A.; Pfrieger, F.W. CNS synaptogenesis promoted by glia-derived cholesterol. Science 2001, 294, 1354–1357. [Google Scholar] [CrossRef] [PubMed]
- Guo, Y.; Wang, S.; Chao, X.; Li, D.; Wang, Y.; Guo, Q.; Chen, T. Multi-omics studies reveal ameliorating effects of physical exercise on neurodegenerative diseases. Front. Aging Neurosci. 2022, 14, 1026688. [Google Scholar] [CrossRef]
- Lissner, L.J.; Wartchow, K.M.; Toniazzo, A.P.; Goncalves, C.A.; Rodrigues, L. Object recognition and Morris water maze to detect cognitive impairment from mild hippocampal damage in rats: A reflection based on the literature and experience. Pharmacol. Biochem. Behav. 2021, 210, 173273. [Google Scholar] [CrossRef]
- Huuha, A.M.; Norevik, C.S.; Moreira, J.B.N.; Kobro-Flatmoen, A.; Scrimgeour, N.; Kivipelto, M.; Van Praag, H.; Ziaei, M.; Sando, S.B.; Wisloff, U.; et al. Can exercise training teach us how to treat Alzheimer’s disease? Ageing Res. Rev. 2022, 75, 101559. [Google Scholar] [CrossRef] [PubMed]
- Li, T.; Su, Q.; Zhang, Z.; Zhang, Y.; Yang, M.; Wang, Z.; Guo, J.; Wang, Z.; Wu, M.; Cai, H.; et al. Ube2c-inhibition alleviated amyloid pathology and memory deficits in APP/PS1 mice model of AD. Prog. Neurobiol. 2022, 215, 102298. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Wei, W.; Zhao, M.; Ma, L.; Jiang, X.; Pei, H.; Cao, Y.; Li, H. Interaction between Abeta and Tau in the Pathogenesis of Alzheimer’s Disease. Int. J. Biol. Sci. 2021, 17, 2181–2192. [Google Scholar] [CrossRef]
- Sharpe, L.J.; Coates, H.W.; Brown, A.J. Post-translational control of the long and winding road to cholesterol. J. Biol. Chem. 2020, 295, 17549–17559. [Google Scholar] [CrossRef]
- Zhong, S.; Li, J.; Wei, M.; Deng, Z.; Liu, X. Fresh and Browned Lotus Root Extracts Promote Cholesterol Metabolism in FFA-Induced HepG2 Cells through Different Pathways. Foods 2023, 12, 1781. [Google Scholar] [CrossRef]
- Moutinho, M.; Nunes, M.J.; Rodrigues, E. Cholesterol 24-hydroxylase: Brain cholesterol metabolism and beyond. Biochim. Biophys. Acta 2016, 1861, 1911–1920. [Google Scholar] [CrossRef]
- Lund, E.G.; Guileyardo, J.M.; Russell, D.W. cDNA cloning of cholesterol 24-hydroxylase, a mediator of cholesterol homeostasis in the brain. Proc. Natl. Acad. Sci. USA 1999, 96, 7238–7243. [Google Scholar] [CrossRef]
- Avila-Munoz, E.; Arias, C. Cholesterol-induced astrocyte activation is associated with increased amyloid precursor protein expression and processing. Glia 2015, 63, 2010–2022. [Google Scholar] [CrossRef] [PubMed]
- Barrett, P.J.; Song, Y.; Van Horn, W.D.; Hustedt, E.J.; Schafer, J.M.; Hadziselimovic, A.; Beel, A.J.; Sanders, C.R. The amyloid precursor protein has a flexible transmembrane domain and binds cholesterol. Science 2012, 336, 1168–1171. [Google Scholar] [CrossRef] [PubMed]
- Marquer, C.; Devauges, V.; Cossec, J.C.; Liot, G.; Lecart, S.; Saudou, F.; Duyckaerts, C.; Leveque-Fort, S.; Potier, M.C. Local cholesterol increase triggers amyloid precursor protein-Bace1 clustering in lipid rafts and rapid endocytosis. FASEB J. Off. Publ. Fed. Am. Soc. Exp. Biol. 2011, 25, 1295–1305. [Google Scholar] [CrossRef]
- Geifman, N.; Brinton, R.D.; Kennedy, R.E.; Schneider, L.S.; Butte, A.J. Evidence for benefit of statins to modify cognitive decline and risk in Alzheimer’s disease. Alzheimers Res. Ther. 2017, 9, 10. [Google Scholar] [CrossRef] [PubMed]
- Tong, X.K.; Royea, J.; Hamel, E. Simvastatin rescues memory and granule cell maturation through the Wnt/beta-catenin signaling pathway in a mouse model of Alzheimer’s disease. Cell Death Dis. 2022, 13, 325. [Google Scholar] [CrossRef] [PubMed]
- Nabizadeh, F.; Valizadeh, P.; Balabandian, M.; Alzheimer’s disease Neuroimaging Initiative (ADNI). Does statin use affect amyloid beta deposition and brain metabolism? CNS Neurosci. Ther. 2023, 29, 1434–1443. [Google Scholar] [CrossRef]
- Li, D.; Zhang, J.; Liu, Q. Brain cell type-specific cholesterol metabolism and implications for learning and memory. Trends Neurosci. 2022, 45, 401–414. [Google Scholar] [CrossRef]
- Feldman, H.H.; Doody, R.S.; Kivipelto, M.; Sparks, D.L.; Waters, D.D.; Jones, R.W.; Schwam, E.; Schindler, R.; Hey-Hadavi, J.; DeMicco, D.A.; et al. Randomized controlled trial of atorvastatin in mild to moderate Alzheimer disease: LEADe. Neurology 2010, 74, 956–964. [Google Scholar] [CrossRef]
- Yu, H.; Zhang, C.; Xia, J.; Xu, B. Treadmill Exercise Ameliorates Adult Hippocampal Neurogenesis Possibly by Adjusting the APP Proteolytic Pathway in APP/PS1 Transgenic Mice. Int. J. Mol. Sci. 2021, 22, 9570. [Google Scholar] [CrossRef]
- Wang, X.; Zhu, Y.T.; Zhu, Y.; Sun, Y.L.; Huang, J.; Li, Z.; Wang, Y.; Wu, J.C.; Qin, Z.H.; Lin, F. Long-term running exercise alleviates cognitive dysfunction in APP/PSEN1 transgenic mice via enhancing brain lysosomal function. Acta Pharmacol. Sin. 2022, 43, 850–861. [Google Scholar] [CrossRef]
- Pfrieger, F.W.; Ungerer, N. Cholesterol metabolism in neurons and astrocytes. Prog. Lipid Res. 2011, 50, 357–371. [Google Scholar] [CrossRef] [PubMed]
- Luo, J.; Yang, H.; Song, B.L. Mechanisms and regulation of cholesterol homeostasis. Nat. Rev. Mol. Cell Biol. 2020, 21, 225–245. [Google Scholar] [CrossRef]
- Panchoo, M.; Lacko, A. Scavenger receptor class B type 1 regulates neuroblastoma cell proliferation, migration and invasion. Biochem. Biophys. Res. Commun. 2018, 495, 614–620. [Google Scholar] [CrossRef] [PubMed]
- Xu, G.B.; Yang, L.Q.; Guan, P.P.; Wang, Z.Y.; Wang, P. Prostaglandin A1 Inhibits the Cognitive Decline of APP/PS1 Transgenic Mice via PPARgamma/ABCA1-dependent Cholesterol Efflux Mechanisms. Neurotherapeutics 2019, 16, 505–522. [Google Scholar] [CrossRef]
- Sarlak, Z.; Moazzami, M.; Attarzadeh Hosseini, M.; Gharakhanlou, R. The effects of aerobic training before and after the induction of Alzheimer’s disease on ABCA1 and APOE mRNA expression and the level of soluble Abeta1-42 in the hippocampus of male Wistar rats. Iran. J. Basic Med. Sci. 2019, 22, 399–406. [Google Scholar] [CrossRef] [PubMed]
- Moutinho, M.; Landreth, G.E. Therapeutic potential of nuclear receptor agonists in Alzheimer’s disease. J. Lipid Res. 2017, 58, 1937–1949. [Google Scholar] [CrossRef]
- Donkin, J.J.; Stukas, S.; Hirsch-Reinshagen, V.; Namjoshi, D.; Wilkinson, A.; May, S.; Chan, J.; Fan, J.; Collins, J.; Wellington, C.L. ATP-binding cassette transporter A1 mediates the beneficial effects of the liver X receptor agonist GW3965 on object recognition memory and amyloid burden in amyloid precursor protein/presenilin 1 mice. J. Biol. Chem. 2010, 285, 34144–34154. [Google Scholar] [CrossRef]
- Cramer, P.E.; Cirrito, J.R.; Wesson, D.W.; Lee, C.Y.; Karlo, J.C.; Zinn, A.E.; Casali, B.T.; Restivo, J.L.; Goebel, W.D.; James, M.J.; et al. ApoE-directed therapeutics rapidly clear beta-amyloid and reverse deficits in AD mouse models. Science 2012, 335, 1503–1506. [Google Scholar] [CrossRef]
- Zhan, N.; Wang, B.; Martens, N.; Liu, Y.; Zhao, S.; Voortman, G.; van Rooij, J.; Leijten, F.; Vanmierlo, T.; Kuipers, F.; et al. Identification of Side Chain Oxidized Sterols as Novel Liver X Receptor Agonists with Therapeutic Potential in the Treatment of Cardiovascular and Neurodegenerative Diseases. Int. J. Mol. Sci. 2023, 24, 1290. [Google Scholar] [CrossRef]
- Abildayeva, K.; Jansen, P.J.; Hirsch-Reinshagen, V.; Bloks, V.W.; Bakker, A.H.; Ramaekers, F.C.; de Vente, J.; Groen, A.K.; Wellington, C.L.; Kuipers, F.; et al. 24(S)-hydroxycholesterol participates in a liver X receptor-controlled pathway in astrocytes that regulates apolipoprotein E-mediated cholesterol efflux. J. Biol. Chem. 2006, 281, 12799–12808. [Google Scholar] [CrossRef]
- Shah, S.A.; Yoon, G.H.; Chung, S.S.; Abid, M.N.; Kim, T.H.; Lee, H.Y.; Kim, M.O. Osmotin reduced amyloid beta (Abeta) burden by inhibiting SREBP2 expression in APP/PS1 mice. Mol. Psychiatry 2017, 22, 323. [Google Scholar] [CrossRef] [PubMed]
- Molander-Melin, M.; Blennow, K.; Bogdanovic, N.; Dellheden, B.; Mansson, J.E.; Fredman, P. Structural membrane alterations in Alzheimer brains found to be associated with regional disease development; increased density of gangliosides GM1 and GM2 and loss of cholesterol in detergent-resistant membrane domains. J. Neurochem. 2005, 92, 171–182. [Google Scholar] [CrossRef] [PubMed]
- Perez-Canamas, A.; Sarroca, S.; Melero-Jerez, C.; Porquet, D.; Sansa, J.; Knafo, S.; Esteban, J.A.; Sanfeliu, C.; Ledesma, M.D. A diet enriched with plant sterols prevents the memory impairment induced by cholesterol loss in senescence-accelerated mice. Neurobiol. Aging 2016, 48, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Barbero-Camps, E.; Fernandez, A.; Martinez, L.; Fernandez-Checa, J.C.; Colell, A. APP/PS1 mice overexpressing SREBP-2 exhibit combined Abeta accumulation and tau pathology underlying Alzheimer’s disease. Hum. Mol. Genet. 2013, 22, 3460–3476. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; He, Q.; Huang, T.; Zhao, N.; Liang, F.; Xu, B.; Chen, X.; Li, T.; Bi, J. Treadmill Exercise Decreases Abeta Deposition and Counteracts Cognitive Decline in APP/PS1 Mice, Possibly via Hippocampal Microglia Modifications. Front. Aging Neurosci. 2019, 11, 78. [Google Scholar] [CrossRef]
Gene | Forward Primer | Reverse Primer |
---|---|---|
LXRβ | CTGAAGGCGTCCACCATTGAGATC | TGATGGCGATAAGCAAGGCATACTC |
PPARγ | GCCAAGGTGCTCCAGAAGATGAC | GTGAAGGCTCATGTCTGTCTCTGTC |
RXRγ | GGAGCCGAGAGCGAGCAGAG | CCACGTTCATGTCACCGTAGGATTC |
LDLR | TGAGGTTCCTGTCCATCTTCTTCC | GATGTTCTTCAGCCGCCAGTTC |
SR-B1 | GTGCCCATCATCTGCCAACTG | GCTGTCCGCTGAGAGAGTCC |
ABCG1 | TGCTGCTGCCTCACCTCAC | TCTCGTCTGCCTTCATCCTTCTC |
ABCG4 | ACATGCTACTGCCTCACCTCAC | GTTCCTTCTTCACCTCTTGCTTCTC |
GAPDH | TGAAGGTCGGTGTGAACGGATTTG | TCGCTCCTGGAAGATGGTGATGG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hu, Z.; Yuan, Y.; Tong, Z.; Liao, M.; Yuan, S.; Wu, W.; Tang, Y.; Wang, Y.; Tang, C.; Liu, W. Aerobic Exercise Facilitates the Nuclear Translocation of SREBP2 by Activating AKT/SEC24D to Contribute Cholesterol Homeostasis for Improving Cognition in APP/PS1 Mice. Int. J. Mol. Sci. 2023, 24, 12847. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms241612847
Hu Z, Yuan Y, Tong Z, Liao M, Yuan S, Wu W, Tang Y, Wang Y, Tang C, Liu W. Aerobic Exercise Facilitates the Nuclear Translocation of SREBP2 by Activating AKT/SEC24D to Contribute Cholesterol Homeostasis for Improving Cognition in APP/PS1 Mice. International Journal of Molecular Sciences. 2023; 24(16):12847. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms241612847
Chicago/Turabian StyleHu, Zelin, Yangqi Yuan, Zhen Tong, Meiqing Liao, Shunling Yuan, Weijia Wu, Yingzhe Tang, Yirong Wang, Changfa Tang, and Wenfeng Liu. 2023. "Aerobic Exercise Facilitates the Nuclear Translocation of SREBP2 by Activating AKT/SEC24D to Contribute Cholesterol Homeostasis for Improving Cognition in APP/PS1 Mice" International Journal of Molecular Sciences 24, no. 16: 12847. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms241612847