Identification and Expression Patterns of Opsin Genes in a Forest Insect, Dendrolimus punctatus
Abstract
:1. Introduction
2. Materials and Methods
2.1. Identification of Opsins
2.2. Sequencing Analysis and Phylogenetic Tree Construction
2.3. Quantification of Gene Expression Levels with Real-time PCR
3. Results
3.1. Opsin Identification and Sequence Analysis
3.2. Phylogenetic Analysis of the Opsins
3.3. Expression Levels of the Opsins during Four Development Stages
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Weiss, M.R. Vision and learning in some neglected pollinators: Beetles, flies, moths, and butterflies. In Cognitive Ecology of Pollination: Animal Behaviour and Floral Evolution; Thomson, J.D., Chittka, L., Eds.; Cambridge University Press: Cambridge, UK, 2001; pp. 171–190. [Google Scholar]
- Kelber, A. Ovipositing butterflies use a red receptor to see green. J. Exp. Biol. 1999, 202, 2619. [Google Scholar] [PubMed]
- Jiggins, C.D.; Naisbit, R.E.; Coe, R.L.; Mallet, J. Reproductive isolation caused by colour pattern mimicry. Nature 2001, 411, 302–305. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Endler, J.A.; Mappes, J. Predator mixes and the conspicuousness of aposematic signals. Am. Nat. 2004, 163, 532–547. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tang, Y.C.; Zhou, C.-L.; Chen, X.-M.; Zheng, H. Visual and olfactory responses of seven butterfly species during foraging. J. Insect Behav. 2013, 26, 387–401. [Google Scholar] [CrossRef]
- Su, C.Y.; Menuz, K.; Carlson, J.R. Olfactory perception: Receptors, cells, and circuits. Cell 2009, 139, 45–59. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Agnihotri, A.R.; Roy, A.A.; Joshi, R.S. Gustatory receptors in Lepidoptera: Chemosensation and beyond. Insect Mol. Biol. 2016, 25, 519–529. [Google Scholar] [CrossRef]
- Schoonhoven, L.M.; Van Loon, B.; Van Loon, J.J.; Dicke, M. Insect-Plant Biology; Oxford University Press on Demand: Oxford, UK, 2005. [Google Scholar]
- Reeves, J.L. Vision should not be overlooked as an important sensory modality for finding host plants. Environ. Entomol. 2011, 40, 855–863. [Google Scholar] [CrossRef]
- Shichida, Y.; Imai, H. Visual pigment: G-protein-coupled receptor for light signals. Cell. Mol. Life Sci. CMLS 1998, 54, 1299–1315. [Google Scholar] [CrossRef]
- Gartner, W.; Towner, P. Invertebrate visual pigments. Photochem. Photobiol. 1995, 62, 1–16. [Google Scholar] [CrossRef]
- Terakita, A. The opsins. Genome Biol. 2005, 6, 213. [Google Scholar] [CrossRef] [Green Version]
- Briscoe, A. The evolution of color vision in insects. Annu. Rev. Entomol. 2001, 46, 471. [Google Scholar] [CrossRef] [Green Version]
- Pohl, N.; Sison-Mangus, M.P.; Yee, E.N.; Liswi, S.W.; Briscoe, A.D. Impact of duplicate gene copies on phylogenetic analysis and divergence time estimates in butterflies. BMC Evol. Biol. 2009, 9, 99. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wakakuwa, M.; Kurasawa, M.; Giurfa, M.; Arikawa, K. Spectral heterogeneity of honeybee ommatidia. Naturwissenschaften 2005, 92, 464–467. [Google Scholar] [CrossRef] [PubMed]
- Menzel, R.; Backhaus, W. Color Vision Honey Bees: Phenomena and Physiological Mechanisms; Springer Berlin Heidelberg: Heidelberg, Germany, 1989. [Google Scholar]
- Briscoe, A.D. Six opsins from the butterfly Papilio Glaucus: Molecular phylogenetic evidence for paralogous origins of red-sensitive visual pigments in insects. J. Mol. Evol. 2000, 51, 110–121. [Google Scholar] [CrossRef] [PubMed]
- Yan, S.; Zhu, J.; Zhu, W.; Zhang, X.; Li, Z.; Liu, X.; Zhang, Q. The expression of three opsin genes from the compound eye of Helicoverpa armigera (lepidoptera: Noctuidae) is regulated by a circadian clock, light conditions and nutritional status. PLoS ONE 2014, 9, e111683. [Google Scholar] [CrossRef] [Green Version]
- Xu, P.; Lu, B.; Xiao, H.; Fu, X.; Murphy, R.W.; Wu, K. The evolution and expression of the moth visual opsin family. PLoS ONE 2013, 8, e78140. [Google Scholar] [CrossRef] [Green Version]
- Hartman, S.J.; Menon, I.; Haug-Collet, K.; Colley, N.J. Expression of rhodopsin and arrestin during the light-dark cycle in Drosophila. Mol. Vis. 2001, 7, 95–100. [Google Scholar]
- Vanhoutte, K.J.A.; Eggen, B.J.L.; Janssen, J.J.M.; Stavenga, D.G. Opsin cDNA sequences of a UV and green rhodopsin of the satyrine butterfly Bicyclus anynana. Insect Biochem. Mol. Biol. 2002, 32, 1383–1390. [Google Scholar] [CrossRef]
- Stavenga, D.G.; Arikawa, K. Evolution of color and vision of butterflies. Arthropod Struct. Dev. 2006, 35, 307–318. [Google Scholar] [CrossRef] [Green Version]
- Frentiu, F.D.; Bernard, G.D.; Cuevas, C.I.; Sison-Mangus, M.P.; Prudic, K.L.; Briscoe, A.D. Adaptive evolution of color vision as seen through the eyes of butterflies. Proc. Natl. Acad. Sci. USA 2007, 104, 8634–8640. [Google Scholar] [CrossRef] [Green Version]
- Warrant, E.; Dacke, M. Vision and visual navigation in nocturnal insects. Annu. Rev. Entomol. 2011, 56, 239–254. [Google Scholar] [CrossRef]
- Yan, S.; Meng, Q.; Zhao, S.; Lu, W.; Zhu, J.; Hui, L. Compound eyes vision of nocturnal moth and its light trap response. China Plant Prot. 2017, 37, 30–35. [Google Scholar]
- Oh, M.S.; Lee, C.H.; Lee, S.G.; Lee, H.S.; Oh, M.S.; Lee, C.H.; Lee, S.G.; Lee, H.S. Evaluation of high power light emitting diodes (hpleds) as potential attractants for adult Spodoptera exigua (Hübner) (Lepidoptera: Noctuidae). Environ. Sci. 2011, 54, 416–422. [Google Scholar] [CrossRef]
- Ballinger, D.G.; Benzer, S. Photophobe (ppb), a Drosophila mutant with a reversed sign of phototaxis; The mutation shows an allele-specific interaction with sevenless. Proc. Natl. Acad. Sci. USA 1988, 85, 3960–3964. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Inada, K.; Horie, T.; Kusakabe, T.; Tsuda, M. Targeted knockdown of an opsin gene inhibits the swimming behaviour photoresponse of ascidian larvae. Neurosci. Lett. 2003, 347, 167–170. [Google Scholar] [CrossRef]
- Gühmann, M.; Jia, H.; Randel, N.; Verasztó, C.; Bezares-Calderón, L.A.; Michiels, N.K.; Yokoyama, S.; Jékely, G. Spectral tuning of phototaxis by a go-opsin in the rhabdomeric eyes of Platynereis. Curr. Biol. 2015, 25, 2265–2271. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, Y.-J.; Yan, S.; Shen, Z.-J.; Li, Z.; Zhang, X.-F.; Liu, X.-M.; Zhang, Q.-W.; Liu, X.-X. The expression of three opsin genes and phototactic behavior of Spodoptera exigua (lepidoptera: Noctuidae): Evidence for visual function of opsin in phototaxis. Insect Biochem. Mol. Biol. 2018, 96, 27–35. [Google Scholar] [CrossRef]
- Xiao, G. Forest Insects of China, 2nd ed.; China Forestry Publishing House: Beijing, China, 1992; pp. 961–963. [Google Scholar]
- Zhao, C.H.; Li, Q.; Guo, X.Y.; Wang, X.Y. New components of sex pheromone in the pine caterpillar moth, Dendrolimus punctatus: Identification of chemical structures and field tests. Acta Entomol. Sin. 1993, 36, 247–350. [Google Scholar]
- Zhang, S.-F.; Zhang, Z.; Kong, X.-B.; Wang, H.-B. Molecular characterization and phylogenetic analysis of three odorant binding protein gene transcripts in Dendrolimus species (lepidoptera: Lasiocampidae). Insect Sci. 2014, 21, 597–608. [Google Scholar] [CrossRef]
- Zhang, S.-F.; Zhang, Z.; Kong, X.-B.; Wang, H.-B.; Liu, F. Dynamic changes in chemosensory gene expression during the Dendrolimus punctatus mating process. Front. Physiol. 2018, 8, 1127. [Google Scholar] [CrossRef] [Green Version]
- Zhang, S.-F.; Liu, H.-H.; Kong, X.-B.; Wang, H.-B.; Liu, F.; Zhang, Z. Identification and expression profiling of chemosensory genes in Dendrolimus punctatus walker. Front. Physiol. 2017, 8, 471. [Google Scholar] [CrossRef] [PubMed]
- Le, S.Q.; Olivier, G. An Improved General Amino Acid Replacement Matrix. Mol. Biol. Evol. 2008, 25, 1307–1320. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Awata, H.; Wakakuwa, M.; Arikawa, K. Evolution of color vision in pierid butterflies: Blue opsin duplication, ommatidial heterogeneity and eye regionalization in Colias erate. J. Comp. Physiol. A 2009, 195, 401–408. [Google Scholar] [CrossRef] [PubMed]
- Ni, J.D.; Baik, L.S.; Holmes, T.C.; Montell, C. A rhodopsin in the brain functions in circadian photoentrainment in Drosophila. Nature 2017, 545, 340–344. [Google Scholar] [CrossRef] [Green Version]
- Sakai, K.; Tsutsui, K.; Yamashita, T.; Iwabe, N.; Takahashi, K.; Wada, A.; Shichida, Y. Drosophila melanogaster rhodopsin Rh7 is a UV-to-visible light sensor with an extraordinarily broad absorption spectrum. Sci. Rep. 2017, 7, 7349. [Google Scholar] [CrossRef]
- White, R.H.; Xu, H.; Münch, T.A.; Bennett, R.R.; Grable, E.A. The retina of Manduca sexta: Rhodopsin expression, the mosaic of green-, blue- and uv-sensitive photoreceptors, and regional specialization. J. Exp. Biol. 2003, 206, 3337–3348. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Purpose/Primer Name | Sequence (5′—3′) |
---|---|
DpunOpsinLW-5′ | GCCTGCGGAACTGACTA |
DpunOpsinLW-3′ | CGACAGCCTGAACAATAAA |
DpunOpsinBlue-5′ | GCTGGAGATGCCTTTGC |
DpunOpsinBlue-3′ | TGCTGGGAGGAGGGTAA |
DpunOpsinUV-5′ | TGTTTCTTATTTGTGGCTTCC |
DpunOpsinUV-3′ | TTGTCGTCGGGTTCGTC |
DpunOpsinUV-L-5′ | TAGCGACTTTATCAGCA |
DpunOpsinUV-L-3′ | CCATAGCCAATATCCAA |
Dpunbeta-Actin-5′ | GCGATCTTACCGACTACCTCA |
Dpunbeta-Actin-3′ | TCTGGGCAACGGAACCT |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, S.; Kong, X.; Liu, F.; Zhang, Z. Identification and Expression Patterns of Opsin Genes in a Forest Insect, Dendrolimus punctatus. Insects 2020, 11, 116. https://0-doi-org.brum.beds.ac.uk/10.3390/insects11020116
Zhang S, Kong X, Liu F, Zhang Z. Identification and Expression Patterns of Opsin Genes in a Forest Insect, Dendrolimus punctatus. Insects. 2020; 11(2):116. https://0-doi-org.brum.beds.ac.uk/10.3390/insects11020116
Chicago/Turabian StyleZhang, Sufang, Xiangbo Kong, Fu Liu, and Zhen Zhang. 2020. "Identification and Expression Patterns of Opsin Genes in a Forest Insect, Dendrolimus punctatus" Insects 11, no. 2: 116. https://0-doi-org.brum.beds.ac.uk/10.3390/insects11020116