Chitosan Oligosaccharides Improve Glucolipid Metabolism Disorder in Liver by Suppression of Obesity-Related Inflammation and Restoration of Peroxisome Proliferator-Activated Receptor Gamma (PPARγ)
Abstract
:1. Introduction
2. Result
2.1. Effect of COS and PA Treatment on HepG2 Cells Viability
2.2. COS Ameliorated PA-Induced Lipid Accumulation in HepG2 Cells
2.3. COS Reversed the upregulation of Proinflammatory Cytokines and Glucolipid Metabolism-Related Regulators at mRNA Level in PA-Induced HepG2 Cells
2.4. COS Reversed the downregulation of PPARγ at Both mRNA and Protein Levels in PA-Induced HepG2 Cells
2.5. COS Alleviated Glucose Intolerance in HFD-Fed Mice
2.6. COS Treatment Ameliorated Glucolipid Metabolism Disorder in HFD-Fed Mice
3. Discussion
4. Materials and Methods
4.1. Chemicals and Reagents
4.2. Cell Culture and Drug Treatment
4.3. Cell Viability Assay
4.4. Animal Experiment
4.5. Intraperitoneal Glucose Tolerance Test (IGTT)
4.6. Oil Red O Staining
4.7. RNA Extraction, cDNA Synthesis, and Quantitative Real-Time (qRT)-PCR
4.8. Western Blot Analysis
4.9. Statistics
Author Contributions
Funding
Conflicts of Interest
Abbreviations
NAFLDs | nonalcoholic fatty liver diseases |
COS | chitosan oligosaccharides |
PA | palmitic acid |
HFD | high-fat diet |
CD | chow diet |
IL-6 | interleukin-6 |
MCP-1 | monocyte chemoattractant protein 1 |
TNF-α | tumor necrosis factor-alpha |
PCK1 | phosphoenolpyruvate carboxykinase-1 |
SCD-1 | stearoyl-CoA desaturase |
ACC1 | acetyl-CoA carboxylase |
References
- Ogden, C.L.; Carroll, M.D.; Kit, B.K.; Flegal, K.M. Prevalence of obesity in the United States, 2009–2010. NCHS Data Brief 2012, 82, 1–8. [Google Scholar]
- Yu, Z.; Han, S.; Chu, J.; Xu, Z.; Zhu, C.; Guo, X. Trends in overweight and obesity among children and adolescents in China from 1981 to 2010: A meta-analysis. PLoS ONE 2012, 7, e51949. [Google Scholar] [CrossRef] [PubMed]
- Hotamisligil, G.S. Inflammation and metabolic disorders. Nature 2006, 444, 860–867. [Google Scholar] [CrossRef] [PubMed]
- Kissane, N.A.; Pratt, J.S. Medical and surgical treatment of obesity. Best Pract. Res. Clin. Anaesthesiol. 2011, 25, 11–25. [Google Scholar] [CrossRef] [PubMed]
- Baretic, M. Obesity drug therapy. Minerva Endocrinol. 2013, 38, 245–254. [Google Scholar] [PubMed]
- Zou, P.; Yang, X.; Wang, J.; Li, Y.; Yu, H.; Zhang, Y.; Liu, G. Advances in characterisation and biological activities of chitosan and chitosan oligosaccharides. Food Chem. 2016, 190, 1174–1181. [Google Scholar] [CrossRef] [PubMed]
- Kunanusornchai, W.; Witoonpanich, B.; Tawonsawatruk, T.; Pichyangkura, R.; Chatsudthipong, V.; Muanprasat, C. Chitosan oligosaccharide suppresses synovial inflammation via AMPK activation: An in vitro and in vivo study. Pharmacol. Res. 2016, 113 Pt A, 458–467. [Google Scholar] [CrossRef]
- Zhao, D.; Wang, J.; Tan, L.; Sun, C.; Dong, J. Synthesis of N-furoyl chitosan and chito-oligosaccharides and evaluation of their antioxidant activity in vitro. Int. J. Biol. Macromol. 2013, 59, 391–395. [Google Scholar] [CrossRef] [PubMed]
- Azuma, K.; Osaki, T.; Minami, S.; Okamoto, Y. Anticancer and anti-inflammatory properties of chitin and chitosan oligosaccharides. J. Funct. Biomater. 2015, 6, 33–49. [Google Scholar] [CrossRef] [PubMed]
- Pan, H.; Yang, Q.; Huang, G.; Ding, C.; Cao, P.; Huang, L.; Xiao, T.; Guo, J.; Su, Z. Hypolipidemic effects of chitosan and its derivatives in hyperlipidemic rats induced by a high-fat diet. Food Nutr. Res. 2016, 60, 31137. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Huang, L.; Chen, J.; Cao, P.; Pan, H.; Ding, C.; Xiao, T.; Zhang, P.; Guo, J.; Su, Z. Anti-obese effect of glucosamine and chitosan oligosaccharide in high-fat diet-induced obese rats. Mar. Drugs 2015, 13, 2732–2756. [Google Scholar] [CrossRef] [PubMed]
- Pan, H.; Fu, C.; Huang, L.; Jiang, Y.; Deng, X.; Guo, J.; Su, Z. Anti-Obesity Effect of Chitosan Oligosaccharide Capsules (COSCs) in Obese Rats by Ameliorating Leptin Resistance and Adipogenesis. Mar. Drugs 2018, 16, 198. [Google Scholar] [CrossRef] [PubMed]
- Egan, A.M.; Sweeney, T.; Hayes, M.; O’Doherty, J.V. Prawn Shell Chitosan Has Anti-Obesogenic Properties, Influencing Both Nutrient Digestibility and Microbial Populations in a Pig Model. PLoS ONE 2015, 10, e0144127. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chae, S.Y.; Jang, M.K.; Nah, J.W. Influence of molecular weight on oral absorption of water soluble chitosans. J. Control. Release 2005, 102, 383–394. [Google Scholar] [CrossRef] [PubMed]
- Ge, J.; Miao, J.J.; Sun, X.Y.; Yu, J.Y. Huangkui capsule, an extract from Abelmoschus manihot (L.) medic, improves diabetic nephropathy via activating peroxisome proliferator-activated receptor (PPAR)-alpha/gamma and attenuating endoplasmic reticulum stress in rats. J. Ethnopharmacol. 2016, 189, 238–249. [Google Scholar] [CrossRef] [PubMed]
- Lee, H.; Kang, R.; Kim, Y.S.; Chung, S.I.; Yoon, Y. Platycodin D inhibits adipogenesis of 3T3-L1 cells by modulating Kruppel-like factor 2 and peroxisome proliferator-activated receptor gamma. Phytother. Res. 2010, 24 (Suppl. 2), 161–167. [Google Scholar] [CrossRef] [PubMed]
- Sakamoto, Y.; Naka, A.; Ohara, N.; Kondo, K.; Iida, K. Daidzein regulates proinflammatory adipokines thereby improving obesity-related inflammation through PPARgamma. Mol. Nutr. Food Res. 2014, 58, 718–726. [Google Scholar] [CrossRef] [PubMed]
- Lehrke, M.; Lazar, M.A. The many faces of PPARgamma. Cell 2005, 123, 993–999. [Google Scholar] [CrossRef] [PubMed]
- Barak, Y.; Nelson, M.C.; Ong, E.S.; Jones, Y.Z.; Ruiz-Lozano, P.; Chien, K.R.; Koder, A.; Evans, R.M. PPAR gamma is required for placental, cardiac, and adipose tissue development. Mol. Cell 1999, 4, 585–595. [Google Scholar] [CrossRef]
- Virtue, S.; Masoodi, M.; Velagapudi, V.; Tan, C.Y.; Dale, M.; Suorti, T.; Slawik, M.; Blount, M.; Burling, K.; Campbell, M.; et al. Lipocalin prostaglandin D synthase and PPARgamma2 coordinate to regulate carbohydrate and lipid metabolism in vivo. PLoS ONE 2012, 7, e39512. [Google Scholar] [CrossRef] [PubMed]
- Tontonoz, P.; Spiegelman, B.M. Fat and beyond: The diverse biology of PPARgamma. Annu. Rev. Biochem. 2008, 77, 289–312. [Google Scholar] [CrossRef] [PubMed]
- Alqahtani, S.; Mahmoud, A.M. Gamma-Glutamylcysteine Ethyl Ester Protects against Cyclophosphamide-Induced Liver Injury and Hematologic Alterations via Upregulation of PPARgamma and Attenuation of Oxidative Stress, Inflammation, and Apoptosis. Oxid. Med. Cell. Longev. 2016, 2016, 4016209. [Google Scholar] [CrossRef] [PubMed]
- Yang, L.; Stimpson, S.A.; Chen, L.; Harrington, W.W.; Rockey, D.C. Effectiveness of the PPARgamma agonist, GW570, in liver fibrosis. Inflamm. Res. 2010, 59, 1061–1071. [Google Scholar] [CrossRef] [PubMed]
- Nan, Y.M.; Han, F.; Kong, L.B.; Zhao, S.X.; Wang, R.Q.; Wu, W.J.; Yu, J. Adenovirus-mediated peroxisome proliferator activated receptor gamma overexpression prevents nutritional fibrotic steatohepatitis in mice. Scand. J. Gastroenterol. 2011, 46, 358–369. [Google Scholar] [CrossRef] [PubMed]
- Huang, Y.Y.; Gusdon, A.M.; Qu, S. Nonalcoholic fatty liver disease: Molecular pathways and therapeutic strategies. Lipids Health. Dis. 2013, 12, 171. [Google Scholar] [CrossRef] [PubMed]
- Ferre, P. The biology of peroxisome proliferator-activated receptors: Relationship with lipid metabolism and insulin sensitivity. Diabetes 2004, 53 (Suppl. 1), 43–50. [Google Scholar] [CrossRef]
- Liu, H.T.; Li, W.M.; Li, X.Y.; Xu, Q.S.; Liu, Q.S.; Bai, X.F.; Yu, C.; Du, Y.G. Chitosan oligosaccharides inhibit the expression of interleukin-6 in lipopolysaccharide-induced human umbilical vein endothelial cells through p38 and ERK1/2 protein kinases. Basic Clin. Pharmacol. Toxicol. 2010, 106, 362–371. [Google Scholar] [CrossRef] [PubMed]
- Shi, L.L.; Li, Y.; Wang, Y.; Feng, Y. MDG-1, an Ophiopogon polysaccharide, regulate gut microbiota in high-fat diet-induced obese C57BL/6 mice. Int. J. Biol. Macromol. 2015, 81, 576–583. [Google Scholar] [CrossRef] [PubMed]
- Kong, X.F.; Zhou, X.L.; Lian, G.Q.; Blachier, F.; Liu, G.; Tan, B.E.; Nyachoti, C.M.; Yin, Y.L. Dietary supplementation with chitooligosaccharides alters gut microbiota and modifies intestinal luminal metabolites in weaned Huanjiang mini-piglets. Livest. Sci. 2014, 160, 97–101. [Google Scholar] [CrossRef]
- Qiao, Y.; Bai, X.F.; Du, Y.G. Chitosan oligosaccharides protect mice from LPS challenge by attenuation of inflammation and oxidative stress. Int. Immunopharmacol. 2011, 11, 121–127. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sauer, M.; Doss, S.; Ehler, J.; Mencke, T.; Wagner, N.M. Procalcitonin Impairs Liver Cell Viability and Function in vitro: A Potential New Mechanism of Liver Dysfunction and Failure during Sepsis? BioMed Res. Int. 2017, 2017, 6130725. [Google Scholar] [CrossRef] [PubMed]
- Ishiyama, J.; Taguchi, R.; Yamamoto, A.; Murakami, K. Palmitic acid enhances lectin-like oxidized LDL receptor (LOX-1) expression and promotes uptake of oxidized LDL in macrophage cells. Atherosclerosis 2010, 209, 118–124. [Google Scholar] [CrossRef] [PubMed]
- Kim, S.K.; Seo, G.; Oh, E.; Jin, S.-H.; Chae, G.T.; Lee, S.-B. Palmitate induces RIP1-dependent necrosis in RAW 264.7 cells. Atherosclerosis 2012, 225, 315–321. [Google Scholar] [CrossRef] [PubMed]
- Benoit, B.; Plaisancié, P.; Géloën, A.; Estienne, M.; Debard, C.; Meugnier, E.; Loizon, E.; Daira, P.; Bodennec, J.; Cousin, O.; et al. Pasture v. standard dairy cream in high-fat diet-fed mice: Improved metabolic outcomes and stronger intestinal barrier. Br. J. Nutr. 2014, 112, 520–535. [Google Scholar] [CrossRef] [PubMed]
- Zheng, J.; Cheng, G.; Li, Q.; Jiao, S.; Feng, C.; Zhao, X.; Yin, H.; Du, Y.; Liu, H. Chitin Oligosaccharide Modulates Gut Microbiota and Attenuates High-Fat-Diet-Induced Metabolic Syndrome in Mice. Mar. Drugs 2018, 16, 66. [Google Scholar] [CrossRef] [PubMed]
- Caesar, R.; Fåk, F.; Bäckhed, F. Effects of gut microbiota on obesity and atherosclerosis via modulation of inflammation and lipid metabolism. J. Intern. Med. 2010, 268, 320–328. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, W.; Fang, Q.; Zhong, P.; Chen, L.; Wang, L.; Zhang, Y.; Wang, J.; Li, X.; Wang, Y.; Wang, J.; et al. EGFR Inhibition Blocks Palmitic Acid-induced inflammation in cardiomyocytes and Prevents Hyperlipidemia-induced Cardiac Injury in Mice. Sci. Rep. 2016, 6, 24580. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhou, B.R.; Zhang, J.A.; Zhang, Q.; Permatasari, F.; Xu, Y.; Wu, D.; Yin, Z.Q.; Luo, D. Palmitic acid induces production of proinflammatory cytokines interleukin-6, interleukin-1beta, and tumor necrosis factor-alpha via a NF-kappaB-dependent mechanism in HaCaT keratinocytes. Mediat. Inflamm. 2013, 2013, 530429. [Google Scholar] [CrossRef] [PubMed]
- Lai, C.S.; Liao, S.N.; Tsai, M.L.; Kalyanam, N.; Majeed, M.; Majeed, A.; Ho, C.T.; Pan, M.H. Calebin-A inhibits adipogenesis and hepatic steatosis in high-fat diet-induced obesity via activation of AMPK signaling. Mol. Nutr. Food Res. 2015, 59, 1883–1895. [Google Scholar] [CrossRef] [PubMed]
- Hwang, J.S.; Park, J.W.; Nam, M.S.; Cho, H.; Han, I.O. Glucosamine enhances body weight gain and reduces insulin response in mice fed chow diet but mitigates obesity, insulin resistance and impaired glucose tolerance in mice high-fat diet. Metabolism 2015, 64, 368–379. [Google Scholar] [CrossRef] [PubMed]
- Poloni, S.; Blom, H.J.; Schwartz, I.V. Stearoyl-CoA Desaturase-1: Is It the Link between Sulfur Amino Acids and Lipid Metabolism? Biology 2015, 4, 383–396. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Berod, L.; Friedrich, C.; Nandan, A.; Freitag, J.; Hagemann, S.; Harmrolfs, K.; Sandouk, A.; Hesse, C.; Castro, C.N.; Bahre, H.; et al. De novo fatty acid synthesis controls the fate between regulatory T and T helper 17 cells. Nat. Med. 2014, 20, 1327–1333. [Google Scholar] [CrossRef] [PubMed]
- Schmilovitz-Weiss, H.; Hochhauser, E.; Cohen, M.; Chepurko, Y.; Yitzhaki, S.; Grossman, E.; Leibowitz, A.; Ackerman, Z.; Ben-Ari, Z. Rosiglitazone and bezafibrate modulate gene expression in a rat model of non-alcoholic fatty liver disease—A historical prospective. Lipids Health. Dis. 2013, 12, 41. [Google Scholar] [CrossRef] [PubMed]
- Jimenez-Flores, L.M.; Lopez-Briones, S.; Macias-Cervantes, M.H.; Ramirez-Emiliano, J.; Perez-Vazquez, V. A PPARgamma, NF-kappaB and AMPK-dependent mechanism may be involved in the beneficial effects of curcumin in the diabetic db/db mice liver. Molecules 2014, 19, 8289–8302. [Google Scholar] [CrossRef] [PubMed]
- Pascual, G.; Fong, A.L.; Ogawa, S.; Gamliel, A.; Li, A.C.; Perissi, V.; Rose, D.W.; Willson, T.M.; Rosenfeld, M.G.; Glass, C.K. A SUMOylation-dependent pathway mediates transrepression of inflammatory response genes by PPAR-gamma. Nature 2005, 437, 759–763. [Google Scholar] [CrossRef] [PubMed]
- Kaplan, J.; Nowell, M.; Chima, R.; Zingarelli, B. Pioglitazone reduces inflammation through inhibition of NF-kappaB in polymicrobial sepsis. Innate Immun. 2014, 20, 519–528. [Google Scholar] [CrossRef] [PubMed]
- Li, C.C.; Yang, H.T.; Hou, Y.C.; Chiu, Y.S.; Chiu, W.C. Dietary fish oil reduces systemic inflammation and ameliorates sepsis-induced liver injury by up-regulating the peroxisome proliferator-activated receptor gamma-mediated pathway in septic mice. J. Nutr. Biochem. 2014, 25, 19–25. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Du, Y.; Yu, X.; Mitsutomi, M.; Aiba, S. Preparation of chitooligosaccharides from chitosan by a complex enzyme. Carbohydr. Res. 1999, 320, 257–260. [Google Scholar] [CrossRef] [Green Version]
Gene | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
---|---|---|
β-Actin | AGGTGACAGCATTGCTTCTG | GCTGCCTCAACACCTCAAC |
IL-6 | GGCACTGGCAGAAAACAACC | GCAAGTCTCCTCATTGAATCC |
MCP-1 | GGGATCATCTTGCTGGTGAA | AGGTCCCTGTCATGCTTCTG |
TNF-α | AGGGTCTGGGCCATAGAACT | CCACCACGCTCTTCTGTCTAC |
PCK1 | CTGCATAACGGTCTGGACTTC | CAGCAACTGCCCGTACTCC |
SCD-1 | ATACCACCACCACCACCATT | CATACAGGGCTCCCAAGTGT |
ACC1 | CTGCCATCCCATGTGCTAAT | AGCAGTCGTTCCCCTTCATT |
PPARγ | TCGCTGATGCCTGCCTATG | GGAGCACCTTGGCGAACA |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bai, Y.; Zheng, J.; Yuan, X.; Jiao, S.; Feng, C.; Du, Y.; Liu, H.; Zheng, L. Chitosan Oligosaccharides Improve Glucolipid Metabolism Disorder in Liver by Suppression of Obesity-Related Inflammation and Restoration of Peroxisome Proliferator-Activated Receptor Gamma (PPARγ). Mar. Drugs 2018, 16, 455. https://0-doi-org.brum.beds.ac.uk/10.3390/md16110455
Bai Y, Zheng J, Yuan X, Jiao S, Feng C, Du Y, Liu H, Zheng L. Chitosan Oligosaccharides Improve Glucolipid Metabolism Disorder in Liver by Suppression of Obesity-Related Inflammation and Restoration of Peroxisome Proliferator-Activated Receptor Gamma (PPARγ). Marine Drugs. 2018; 16(11):455. https://0-doi-org.brum.beds.ac.uk/10.3390/md16110455
Chicago/Turabian StyleBai, Yibo, Junping Zheng, Xubing Yuan, Siming Jiao, Cui Feng, Yuguang Du, Hongtao Liu, and Lanyan Zheng. 2018. "Chitosan Oligosaccharides Improve Glucolipid Metabolism Disorder in Liver by Suppression of Obesity-Related Inflammation and Restoration of Peroxisome Proliferator-Activated Receptor Gamma (PPARγ)" Marine Drugs 16, no. 11: 455. https://0-doi-org.brum.beds.ac.uk/10.3390/md16110455