Colonization of Germ-Free Piglets with Commensal Lactobacillus amylovorus, Lactobacillus mucosae, and Probiotic E. coli Nissle 1917 and Their Interference with Salmonella Typhimurium
Abstract
:1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Isolation, Characterization, and Identification of Commensal Lactobacilli
2.3. Bacterial Strains and Bacterial Suspensions
2.4. Gnotobiotic Piglets
2.5. Experimental Design
2.6. Clinical Signs
2.7. Bacterial Colonization of the GIT and Translocation
2.8. Blood Plasma and Intestinal Lavage Supernatants
2.9. Histologic Assessment
2.10. Total RNA Isolation and Reverse Transcription
2.11. Real-Time PCR
2.12. Luminex xMAP Technology
2.13. Statistical Analysis
3. Results
3.1. Characterization and Identification of Lactobacilli
3.2. Clinical Signs
3.3. Colonization of the Intestine and Translocation of L. amylovorus, L. mucosae, E. coli Nissle 1917, and Their Interference with S. Typhimurium in the Gnotobiotic Piglets
3.4. S. Typhimurium in the Intestine, Its Translocation, and Interference with L. amylovorus, L. mucosae, and E. coli Nissle 1917
3.5. Histological Assessment in the Ileum of the Gnotobiotic Piglets
3.6. Transcriptions of Villin, Claudin-1, Claudin-2, and Occludin in the Intestine of the Gnotobiotic Piglets
3.7. Local and Systemic Levels of IL-8, TNF-α, and IL-10 in the Gnotobiotic Piglets
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Appendix A
Methods of Isolation, Characterization, and Identification of Lactobacilli
References
- Ley, R.E.; Hamady, M.; Lozupone, C.; Turnbaugh, P.J.; Ramey, R.R.; Bircher, J.S.; Schlegel, M.L.; Tucker, T.A.; Schrenzel, M.D.; Knight, R.; et al. Evolution of mammals and their gut microbes. Science 2008, 320, 1647–1651. [Google Scholar] [CrossRef] [PubMed]
- Schroeder, B.O.; Backhed, F. Signals from the gut microbiota to distant organs in physiology and disease. Nat. Med. 2016, 22, 1079–1089. [Google Scholar] [CrossRef] [PubMed]
- Wang, M.; Radlowski, E.C.; Monaco, M.H.; Fahey, G.C., Jr.; Gaskins, H.R.; Donovan, S.M. Mode of delivery and early nutrition modulate microbial colonization and fermentation products in neonatal piglets. J. Nutr. 2013, 143, 795–803. [Google Scholar] [CrossRef]
- Cromwell, G.L. Why and how antibiotics are used in swine production. Anim. Biotechnol. 2002, 13, 7–27. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Espinosa, C.D.; Abelilla, J.J.; Casas, G.A.; Lagos, L.V.; Lee, S.A.; Kwon, W.B.; Mathai, J.K.; Navarro, D.M.D.L.; Jaworski, N.W.; et al. Non-antibiotic feed additives in diets for pigs: A review. Anim. Nutr. 2018, 4, 113–125. [Google Scholar] [CrossRef] [PubMed]
- Matamoros, S.; Gras-Leguen, C.; Le, V.F.; Potel, G.; de La Cochetiere, M.F. Development of intestinal microbiota in infants and its impact on health. Trends Microbiol. 2013, 21, 167–173. [Google Scholar] [CrossRef] [PubMed]
- Levy, M.; Kolodziejczyk, A.A.; Thaiss, C.A.; Elinav, E. Dysbiosis and the immune system. Nat. Rev. Immunol. 2017, 17, 219–232. [Google Scholar] [CrossRef] [PubMed]
- Duar, R.M.; Lin, X.B.; Zheng, J.; Martino, M.E.; Grenier, T.; Perez-Munoz, M.E.; Leulier, F.; Ganzle, M.; Walter, J. Lifestyles in transition: Evolution and natural history of the genus Lactobacillus. FEMS Microbiol. Rev. 2017, 41, S27–S48. [Google Scholar] [CrossRef] [PubMed]
- Brugman, S.; Ikeda-Ohtsubo, W.; Braber, S.; Folkerts, G.; Pieterse, C.M.J.; Bakker, P.A.H.M. A Comparative review on microbiota manipulation: Lessons from fish, plants, livestock, and human research. Front. Nutr. 2018, 5, 80. [Google Scholar] [CrossRef]
- Sonnenborn, U. Escherichia coli strain Nissle 1917-from bench to bedside and back: History of a special Escherichia coli strain with probiotic properties. FEMS Microbiol. Lett. 2016, 363, fnw212. [Google Scholar] [CrossRef]
- Trebichavsky, I.; Splichal, I.; Rada, V.; Splichalova, A. Modulation of natural immunity in the gut by Escherichia coli strain Nissle 1917. Nutr. Rev. 2010, 68, 459–464. [Google Scholar] [CrossRef] [PubMed]
- Haraga, A.; Ohlson, M.B.; Miller, S.I. Salmonellae interplay with host cells. Nat. Rev. Microbiol. 2008, 6, 53–66. [Google Scholar] [CrossRef]
- Havelaar, A.H.; Kirk, M.D.; Torgerson, P.R.; Gibb, H.J.; Hald, T.; Lake, R.J.; Praet, N.; Bellinger, D.C.; de Silva, N.R.; Gargouri, N.; et al. World Health Organization Global Estimates and Regional Comparisons of the Burden of Foodborne Disease in 2010. PLoS. Med. 2015, 12, e1001923. [Google Scholar] [CrossRef] [PubMed]
- Keestra-Gounder, A.M.; Tsolis, R.M.; Baumler, A.J. Now you see me, now you don’t: The interaction of Salmonella with innate immune receptors. Nat. Rev. Microbiol. 2015, 13, 206–216. [Google Scholar] [CrossRef] [PubMed]
- Wen, S.C.; Best, E.; Nourse, C. Non-typhoidal Salmonella infections in children: Review of literature and recommendations for management. J. Paediatr. Child Health 2017, 53, 936–941. [Google Scholar] [CrossRef] [PubMed]
- Kim, H.B.; Isaacson, R.E. Salmonella in swine: Microbiota interactions. Annu. Rev. Anim. Biosci. 2017, 5, 43–63. [Google Scholar] [CrossRef] [PubMed]
- Majowicz, S.E.; Musto, J.; Scallan, E.; Angulo, F.J.; Kirk, M.; O’Brien, S.J.; Jones, T.F.; Fazil, A.; Hoekstra, R.M. The global burden of nontyphoidal Salmonella gastroenteritis. Clin. Infect. Dis. 2010, 50, 882–889. [Google Scholar] [CrossRef] [PubMed]
- Gonzalez, L.M.; Moeser, A.J.; Blikslager, A.T. Porcine models of digestive disease: The future of large animal translational research. Transl. Res. 2015, 166, 12–27. [Google Scholar] [CrossRef] [PubMed]
- Meurens, F.; Summerfield, A.; Nauwynck, H.; Saif, L.; Gerdts, V. The pig: A model for human infectious diseases. Trends Microbiol. 2012, 20, 50–57. [Google Scholar] [CrossRef]
- Huang, H.C.; Vlasova, A.N.; Kumar, A.; Kandasamy, S.; Fischer, D.D.; Deblais, L.; Paim, F.C.; Langel, S.N.; Alhamo, M.A.; Rauf, A.; et al. Effect of antibiotic, probiotic, and human rotavirus infection on colonisation dynamics of defined commensal microbiota in a gnotobiotic pig model. Benef. Microbes 2018, 9, 71–86. [Google Scholar] [CrossRef]
- Splichalova, A.; Jenistova, V.; Splichalova, Z.; Splichal, I. Colonization of preterm gnotobiotic piglets with probiotic Lactobacillus rhamnosus GG and its interference with Salmonella Typhimurium. Clin. Exp. Immunol. 2019, 195, 381–394. [Google Scholar] [CrossRef]
- Vlasova, A.N.; Paim, F.C.; Kandasamy, S.; Alhamo, M.A.; Fischer, D.D.; Langel, S.N.; Deblais, L.; Kumar, A.; Chepngeno, J.; Shao, L.; et al. Protein malnutrition modifies innate immunity and gene expression by intestinal epithelial cells and human rotavirus infection in neonatal gnotobiotic pigs. mSphere 2017, 2, e00046-17. [Google Scholar] [CrossRef] [PubMed]
- Splichalova, A.; Slavikova, V.; Splichalova, Z.; Splichal, I. Preterm life in sterile conditions: A study on preterm, germ-free piglets. Front. Immunol. 2018, 9, 220. [Google Scholar] [CrossRef] [PubMed]
- Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative C(T) method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef]
- Splichalova, A.; Trebichavsky, I.; Rada, V.; Vlkova, E.; Sonnenborn, U.; Splichal, I. Interference of Bifidobacterium choerinum or Escherichia coli Nissle 1917 with Salmonella Typhimurium in gnotobiotic piglets correlates with cytokine patterns in blood and intestine. Clin. Exp. Immunol. 2011, 163, 242–249. [Google Scholar] [CrossRef] [PubMed]
- Crespo-Piazuelo, D.; Estelle, J.; Revilla, M.; Criado-Mesas, L.; Ramayo-Caldas, Y.; Ovilo, C.; Fernandez, A.I.; Ballester, M.; Folch, J.M. Characterization of bacterial microbiota compositions along the intestinal tract in pigs and their interactions and functions. Sci. Rep. 2018, 8, 12727. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Wu, W.; Lee, Y.K.; Xie, J.; Zhang, H. Spatial heterogeneity and co-occurrence of mucosal and luminal microbiome across swine intestinal tract. Front. Microbiol. 2018, 9, 48. [Google Scholar] [CrossRef]
- Valeriano, V.D.; Balolong, M.P.; Kang, D.K. Probiotic roles of Lactobacillus sp. in swine: Insights from gut microbiota. J. Appl. Microbiol. 2017, 122, 554–567. [Google Scholar] [CrossRef]
- Dowd, S.E.; Sun, Y.; Wolcott, R.D.; Domingo, A.; Carroll, J.A. Bacterial tag-encoded FLX amplicon pyrosequencing (bTEFAP) for microbiome studies: Bacterial diversity in the ileum of newly weaned Salmonella-infected pigs. Foodborne Pathog. Dis. 2008, 5, 459–472. [Google Scholar] [CrossRef] [PubMed]
- Konstantinov, S.R.; Awati, A.; Smidt, H.; Williams, B.A.; Akkermans, A.D.; de Vos, W.M. Specific response of a novel and abundant Lactobacillus amylovorus-like phylotype to dietary prebiotics in the guts of weaning piglets. Appl. Environ. Microbiol. 2004, 70, 3821–3830. [Google Scholar] [CrossRef] [PubMed]
- Roselli, M.; Finamore, A.; Britti, M.S.; Konstantinov, S.R.; Smidt, H.; de Vos, W.M.; Mengheri, E. The novel porcine Lactobacillus sobrius strain protects intestinal cells from enterotoxigenic Escherichia coli K88 infection and prevents membrane barrier damage. J. Nutr. 2007, 137, 2709–2716. [Google Scholar] [CrossRef] [PubMed]
- Roos, S.; Karner, F.; Axelsson, L.; Jonsson, H. Lactobacillus mucosae sp. nov., a new species with in vitro mucus-binding activity isolated from pig intestine. Int. J. Syst. Evol. Microbiol. 2000, 50, 251–258. [Google Scholar] [CrossRef] [PubMed]
- Henker, J.; Laass, M.; Blokhin, B.M.; Bolbot, Y.K.; Maydannik, V.G.; Elze, M.; Wolff, C.; Schulze, J. The probiotic Escherichia coli strain Nissle 1917 (EcN) stops acute diarrhoea in infants and toddlers. Eur. J. Pediatr. 2007, 166, 311–318. [Google Scholar] [CrossRef]
- Schroeder, B.; Duncker, S.; Barth, S.; Bauerfeind, R.; Gruber, A.D.; Deppenmeier, S.; Breves, G. Preventive effects of the probiotic Escherichia coli strain Nissle 1917 on acute secretory diarrhea in a pig model of intestinal infection. Dig. Dis. Sci. 2006, 51, 724–731. [Google Scholar] [CrossRef]
- Altenhoefer, A.; Oswald, S.; Sonnenborn, U.; Enders, C.; Schulze, J.; Hacker, J.; Oelschlaeger, T.A. The probiotic Escherichia coli strain Nissle 1917 interferes with invasion of human intestinal epithelial cells by different enteroinvasive bacterial pathogens. FEMS Immunol. Med. Microbiol. 2004, 40, 223–229. [Google Scholar] [CrossRef]
- Kandasamy, S.; Vlasova, A.N.; Fischer, D.; Kumar, A.; Chattha, K.S.; Rauf, A.; Shao, L.; Langel, S.N.; Rajashekara, G.; Saif, L.J. Differential effects of Escherichia coli Nissle and Lactobacillus rhamnosus strain GG on human rotavirus binding, infection, and B cell immunity. J. Immunol. 2016, 196, 1780–1789. [Google Scholar] [CrossRef]
- Paim, F.C.; Langel, S.N.; Fischer, D.D.; Kandasamy, S.; Shao, L.; Alhamo, M.A.; Huang, H.C.; Kumar, A.; Rajashekara, G.; Saif, L.J.; et al. Effects of Escherichia coli Nissle 1917 and Ciprofloxacin on small intestinal epithelial cell mRNA expression in the neonatal piglet model of human rotavirus infection. Gut Pathog. 2016, 8, 66. [Google Scholar] [CrossRef] [PubMed]
- Vlasova, A.N.; Kandasamy, S.; Chattha, K.S.; Rajashekara, G.; Saif, L.J. Comparison of probiotic lactobacilli and bifidobacteria effects, immune responses and rotavirus vaccines and infection in different host species. Vet. Immunol. Immunopathol. 2016, 172, 72–84. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kandasamy, S.; Vlasova, A.N.; Fischer, D.D.; Chattha, K.S.; Shao, L.; Kumar, A.; Langel, S.N.; Rauf, A.; Huang, H.C.; Rajashekara, G.; et al. Unraveling the differences between Gram-positive and Gram-negative probiotics in modulating protective immunity to enteric infections. Front. Immunol. 2017, 8, 334. [Google Scholar] [CrossRef]
- Pieper, R.; Janczyk, P.; Schumann, R.; Souffrant, W.B. The intestinal microflora of piglets around weaning - with emphasis on lactobacilli. Arch. Zootech. 2006, 9, 28–40. [Google Scholar]
- Pieper, R.; Janczyk, P.; Zeyner, A.; Smidt, H.; Guiard, V.; Souffrant, W.B. Ecophysiology of the developing total bacterial and lactobacillus communities in the terminal small intestine of weaning piglets. Microb. Ecol. 2008, 56, 474–483. [Google Scholar] [CrossRef] [PubMed]
- Grozdanov, L.; Zahringer, U.; Blum-Oehler, G.; Brade, L.; Henne, A.; Knirel, Y.A.; Schombel, U.; Schulze, J.; Sonnenborn, U.; Gottschalk, G.; et al. A single nucleotide exchange in the wzy gene is responsible for the semirough O6 lipopolysaccharide phenotype and serum sensitivity of Escherichia coli strain Nissle 1917. J. Bacteriol. 2002, 184, 5912–5925. [Google Scholar] [CrossRef] [PubMed]
- West, A.B.; Isaac, C.A.; Carboni, J.M.; Morrow, J.S.; Mooseker, M.S.; Barwick, K.W. Localization of villin, a cytoskeletal protein specific to microvilli, in human ileum and colon and in colonic neoplasms. Gastroenterology 1988, 94, 343–352. [Google Scholar] [CrossRef]
- Lhocine, N.; Arena, E.T.; Bomme, P.; Ubelmann, F.; Prevost, M.C.; Robine, S.; Sansonetti, P.J. Apical invasion of intestinal epithelial cells by Salmonella typhimurium requires villin to remodel the brush border actin cytoskeleton. Cell Host Microbe 2015, 17, 164–177. [Google Scholar] [CrossRef] [PubMed]
- Galen, J.E.; Buskirk, A.D.; Tennant, S.M.; Pasetti, M.F. Live attenuated human Salmonella vaccine candidates: Tracking the pathogen in natural infection and stimulation of host immunity. EcoSal Plus 2016, 7, 1–17. [Google Scholar] [CrossRef]
- Hodges, K.; Gill, R. Infectious diarrhea: Cellular and molecular mechanisms. Gut Microbes 2010, 1, 4–21. [Google Scholar] [CrossRef] [PubMed]
- Gunzel, D.; Yu, A.S. Claudins and the modulation of tight junction permeability. Physiol. Rev. 2013, 93, 525–569. [Google Scholar] [CrossRef] [PubMed]
- Kiela, P.R.; Ghishan, F.K. Physiology of intestinal absorption and secretion. Best Pract. Res. Clin Gastroenterol. 2016, 30, 145–159. [Google Scholar] [CrossRef]
- Gunzel, D.; Fromm, M. Claudins and other tight junction proteins. Compr. Physiol. 2012, 2, 1819–1852. [Google Scholar] [CrossRef] [PubMed]
- Edelblum, K.L.; Shen, L.; Weber, C.R.; Marchiando, A.M.; Clay, B.S.; Wang, Y.; Prinz, I.; Malissen, B.; Sperling, A.I.; Turner, J.R. Dynamic migration of gammadelta intraepithelial lymphocytes requires occludin. Proc. Natl. Acad. Sci. USA 2012, 109, 7097–7102. [Google Scholar] [CrossRef]
- Wang, H.; Ma, S. The cytokine storm and factors determining the sequence and severity of organ dysfunction in multiple organ dysfunction syndrome. Am. J. Emerg. Med. 2008, 26, 711–715. [Google Scholar] [CrossRef]
- Splichal, I.; Splichalova, A. Experimental enteric bacterial infections in pigs. J. Infect. Dis. 2018, 218, 504–505. [Google Scholar] [CrossRef] [PubMed]
- Eichner, M.; Protze, J.; Piontek, A.; Krause, G.; Piontek, J. Targeting and alteration of tight junctions by bacteria and their virulence factors such as Clostridium perfringens enterotoxin. Pflug. Arch. 2017, 469, 77–90. [Google Scholar] [CrossRef]
- Collado-Romero, M.; Arce, C.; Ramirez-Boo, M.; Carvajal, A.; Garrido, J.J. Quantitative analysis of the immune response upon Salmonella typhimurium infection along the porcine intestinal gut. Vet. Res. 2010, 41, 23. [Google Scholar] [CrossRef] [PubMed]
- Meurens, F.; Berri, M.; Auray, G.; Melo, S.; Levast, B.; Virlogeux-Payant, I.; Chevaleyre, C.; Gerdts, V.; Salmon, H. Early immune response following Salmonella enterica subspecies enterica serovar Typhimurium infection in porcine jejunal gut loops. Vet. Res. 2009, 40, 5. [Google Scholar] [CrossRef] [PubMed]
- Foster, N.; Lovell, M.A.; Marston, K.L.; Hulme, S.D.; Frost, A.J.; Bland, P.; Barrow, P.A. Rapid protection of gnotobiotic pigs against experimental salmonellosis following induction of polymorphonuclear leukocytes by avirulent Salmonella enterica. Infect. Immun. 2003, 71, 2182–2191. [Google Scholar] [CrossRef] [PubMed]
- Splichal, I.; Trebichavsky, I.; Splichalova, A.; Barrow, P.A. Protection of gnotobiotic pigs against Salmonella enterica serotype Typhimurium by rough mutant of the same serotype is accompanied by the change of local and systemic cytokine response. Vet. Immunol. Immunopathol. 2005, 103, 155–161. [Google Scholar] [CrossRef] [PubMed]
- Splichalova, A.; Splichal, I.; Chmelarova, P.; Trebichavsky, I. Alarmin HMGB1 is released in the small intestine of gnotobiotic piglets infected with enteric pathogens and its level in plasma reflects severity of sepsis. J. Clin. Immunol. 2011, 31, 488–497. [Google Scholar] [CrossRef] [PubMed]
- Ng, P.C.; Li, K.; Wong, R.P.; Chui, K.; Wong, E.; Li, G.; Fok, T.F. Proinflammatory and anti-inflammatory cytokine responses in preterm infants with systemic infections. Arch. Dis. Child. Fetal Neonatal Ed. 2003, 88, F209–F213. [Google Scholar] [CrossRef]
- Gogos, C.A.; Drosou, E.; Bassaris, H.P.; Skoutelis, A. Pro- versus anti-inflammatory cytokine profile in patients with severe sepsis: A marker for prognosis and future therapeutic options. J. Infect. Dis. 2000, 181, 176–180. [Google Scholar] [CrossRef] [PubMed]
- Splichalova, A.; Splichal, I. Local and systemic occurrences of HMGB1 in gnotobiotic piglets infected with E. coli O55 are related to bacterial translocation and inflammatory cytokines. Cytokine 2012, 60, 597–600. [Google Scholar] [CrossRef] [PubMed]
- Vlkova, E.; Grmanova, M.; Rada, V.; Homutova, I.; Dubna, S. Selection of probiotic bifidobacteria for lambs. Czech J. Anim. Sci. 2009, 54, 552–565. [Google Scholar] [CrossRef] [Green Version]
- Kim, B.J.; Kim, H.Y.; Yun, Y.J.; Kim, B.J.; Kook, Y.H. Differentiation of Bifidobacterium species using partial RNA polymerase â-subunit (rpoB) gene sequences. Int. J. Syst. Evol. Microbiol. 2010, 60, 2697–2704. [Google Scholar] [CrossRef] [PubMed]
Gene | 5′-forward primer-3′ | 5′-reverse primer-3′ | #LNA Probe |
---|---|---|---|
BACT 1 | TCCCTGGAGAAGAGCTACGA | AAGAGCGCCTCTGGACAC | 9 |
CYPA 2 | CCTGAAGCATACGGGTCCT | AAAGACCACATGTTTGCCATC | 48 |
VILLIN | GCATGAAGAAGGTGGAGACC | ACGTTCCTCTTGCCCTTGA | 42 |
CLD-1 3 | CACCACTTTGCAAGCAACC | TGGCCACAAAGATGGCTATT | 3 |
CLD-2 4 | CTCGCGCCAAAGACAGAG | ATGAAGATTCCACGCAACG | 77 |
OCLN 5 | AAAGAGCTCTCTCGACTGGATAAA | AGCAGCAGCCATGTACTCTTC | 42 |
GF | LA | LM | EcN | |
---|---|---|---|---|
Villus height (μm) | 705.2 ± 76.2 a | 610.0 ± 289.0 a | 679.7 ± 82.9 a | 450.2 ± 146.5 a |
Crypt depth (μm) | 74.1 ± 3.4 a | 74.5 ± 9.2 a | 78.8±6.6 a | 94.5 ± 5.0 b |
Height/Depth (ratio) | 10.2 ± 2.3 a | 8.6 ± 5.3 ab | 8.7 ± 1.4 ab | 4.8 ± 1.6 b |
Muscularis thickness (μm) | 54.2 ± 12.1 a | 54.2 ± 17.9 a | 47.6 ± 10.1 a | 71.2 ± 27.3 a |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Splichal, I.; Donovan, S.M.; Splichalova, Z.; Neuzil Bunesova, V.; Vlkova, E.; Jenistova, V.; Killer, J.; Svejstil, R.; Skrivanova, E.; Splichalova, A. Colonization of Germ-Free Piglets with Commensal Lactobacillus amylovorus, Lactobacillus mucosae, and Probiotic E. coli Nissle 1917 and Their Interference with Salmonella Typhimurium. Microorganisms 2019, 7, 273. https://0-doi-org.brum.beds.ac.uk/10.3390/microorganisms7080273
Splichal I, Donovan SM, Splichalova Z, Neuzil Bunesova V, Vlkova E, Jenistova V, Killer J, Svejstil R, Skrivanova E, Splichalova A. Colonization of Germ-Free Piglets with Commensal Lactobacillus amylovorus, Lactobacillus mucosae, and Probiotic E. coli Nissle 1917 and Their Interference with Salmonella Typhimurium. Microorganisms. 2019; 7(8):273. https://0-doi-org.brum.beds.ac.uk/10.3390/microorganisms7080273
Chicago/Turabian StyleSplichal, Igor, Sharon M. Donovan, Zdislava Splichalova, Vera Neuzil Bunesova, Eva Vlkova, Vera Jenistova, Jiri Killer, Roman Svejstil, Eva Skrivanova, and Alla Splichalova. 2019. "Colonization of Germ-Free Piglets with Commensal Lactobacillus amylovorus, Lactobacillus mucosae, and Probiotic E. coli Nissle 1917 and Their Interference with Salmonella Typhimurium" Microorganisms 7, no. 8: 273. https://0-doi-org.brum.beds.ac.uk/10.3390/microorganisms7080273