Comparative Study of Gold and Carbon Nanoparticles in Nucleic Acid Lateral Flow Assay
Abstract
:1. Introduction
2. Materials and Methods
2.1. Reagents and Equipment
2.2. Carbon Nanoparticles Modification and Storage
2.3. Characterization of CNPs by Transmission Electron Microscopy
2.4. Bacterial Strains Culture, DNA Extraction, and Double-Tagging PCR
2.5. Double-Tagging PCR and Quantification by Gel Electrophoresis
2.6. Lateral Flow Assays Based on Carbon and Gold Nanoparticles as Signal-Generating Systems
2.7. Data Interpretation and Analysis
3. Results and Discussion
3.1. Characterization of CNPs by Transmission Electron Microscopy
3.2. Double-Tagging PCR and Quantification by Gel Electrophoresis
3.3. Lateral Flow Assays Based on Carbon and Gold Nanoparticles as Signal-Generating Systems
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Mabey, D.; Peeling, R.W.; Ustianowski, A.; Perkins, M.D. Diagnostics for the developing world. Nat. Rev. Microbiol. 2004, 2, 231–240. [Google Scholar] [CrossRef]
- Land, K.J.; Boeras, D.I.; Chen, X.S.; Ramsay, A.R.; Peeling, R.W. REASSURED diagnostics to inform disease control strategies, strengthen health systems and improve patient outcomes. Nat. Microbiol. 2019, 4, 46–54. [Google Scholar] [CrossRef] [PubMed]
- Rosen S Market. Trends in Lateral Flow Immunoassays. In Lateral Flow Immunoassay; Wong, R., Tse, H., Eds.; Humana Press: Totowa, NJ, USA, 2009. [Google Scholar]
- Bishop, J.D.; Hsieh, H.V.; Gasperino, D.J.; Weigl, B.H. Sensitivity enhancement in lateral flow assays: A systems perspective. Lab Chip. 2019, 19, 2486–2499. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, L.; Yang, D.; Liu, G. Signal amplification strategies for paper-based analytical devices. Biosens. Bioelectron. 2019, 136, 60–75. [Google Scholar] [CrossRef] [PubMed]
- Foubert, A.; Beloglazova, N.V.; De Saeger, S. Comparative study of colloidal gold and quantum dots as labels for multiplex screening tests for multi-mycotoxin detection. Anal. Chim. Acta 2017, 955, 48–57. [Google Scholar] [CrossRef] [PubMed]
- Suryoprabowo, S.; Liu, L.; Kuang, H.; Cui, G.; Xu, C. Fluorescence based immunochromatographic sensor for rapid and sensitive detection of tadalafil and comparison with a gold lateral flow immunoassay. Food Chem. 2021, 342, 128255. [Google Scholar] [CrossRef] [PubMed]
- Roda, A.; Cavalera, S.; Di Nardo, F.; Calabria, D.; Rosati, S.; Simoni, P.; Colitti, B.; Baggiani, C.; Roda, M.; Anfossi, L. Dual lateral flow optical/chemiluminescence immunosensors for the rapid detection of salivary and serum IgA in patients with COVID-19 disease. Biosens. Bioelectron. 2021, 172, 112765. [Google Scholar] [CrossRef] [PubMed]
- Park, J.-M.; Jung, H.-W.; Chang, Y.W.; Kim, H.-S.; Kang, M.-J.; Pyun, J.-C. Chemiluminescence lateral flow immunoassay based on Pt nanoparticle with peroxidase activity. Anal. Chim. Acta 2015, 853, 360–367. [Google Scholar] [CrossRef]
- Wei, D.; Zhang, X.; Chen, B.; Zeng, K. Using bimetallic Au@Pt nanozymes as a visual tag and as an enzyme mimic in enhanced sensitive lateral-flow immunoassays: Application for the detection of streptomycin. Anal. Chim. Acta 2020, 1126, 106–113. [Google Scholar] [CrossRef]
- Martiskainen, I.; Talha, S.M.; Vuorenpää, K.; Salminen, T.; Juntunen, E.; Chattopadhyay, S.; Kumar, D.; Vuorinen, T.; Pettersson, K.; Khanna, N.; et al. Upconverting nanoparticle reporter-based highly sensitive rapid lateral flow immunoassay for hepatitis B virus surface antigen. Anal. Bioanal. Chem. 2021, 413, 967–978. [Google Scholar] [CrossRef]
- Matsumura, Y.; Enomoto, Y.; Takahashi, M.; Maenosono, S. Metal (Au, Pt) Nanoparticle-Latex Nanocomposites as Probes for Immunochromatographic Test Strips with Enhanced Sensitivity. ACS Appl. Mater. Interfaces 2018, 10, 31977–31987. [Google Scholar] [CrossRef] [PubMed]
- Wang, M.-J.; Gray, C.A.; Reznek, S.A.; Mahmud, K.; Kutsovsky, Y. Kirk-Othmer Encyclopedia of Chemical Technology; John Wiley & Sons, Inc.: Hoboken, NJ, USA, 2003. [Google Scholar]
- Wissler, M. Graphite and carbon powders for electrochemical applications. J. Power Sources 2006, 156, 142–150. [Google Scholar] [CrossRef]
- Ban, S.; Malek, K.; Huang, C.; Liu, Z. A molecular model for carbon black primary particles with internal nanoporosity. Carbon 2011, 49, 3362–3370. [Google Scholar] [CrossRef] [Green Version]
- Ungár, T.; Gubicza, J.; Ribárik, G.; Pantea, C.; Zerda, T.W. Microstructure of carbon blacks determined by X-ray diffraction profile analysis. Carbon 2002, 40, 929–937. [Google Scholar] [CrossRef] [Green Version]
- Fan, C.; Liu, Y.; Zhu, J.; Wang, L.; Chen, X.; Zhang, S.; Song, H.; Jia, D. Understanding the structural transformation of carbon black from solid spheres to hollow polyhedra during high temperature treatment. RSC Adv. 2019, 9, 29779–29783. [Google Scholar] [CrossRef] [Green Version]
- Jawhari, T.; Roid, A.; Casado, J. Raman spectroscopic characterization of some commercially available carbon black materials. Carbon 1995, 33, 1561–1565. [Google Scholar] [CrossRef]
- Pividori, M.I.; Merkoçi, A.; Alegret, S. Graphite-epoxy composites as a new transducing material for electrochemical genosensing. Biosens. Bioelectron. 2003, 19, 473–484. [Google Scholar] [CrossRef]
- Van Amerongen, A.; Wichers, J.H.; Berendsen, L.B.; Timmermans, A.J.; Keizer, G.D.; van Doorn, A.W.; Bantjes, A.; van Gelder, W.M. Colloidal carbon particles as a new label for rapid immunochemical test methods: Quantitative computer image analysis of results. J. Biotechnol. 1993, 30, 185–195. [Google Scholar] [CrossRef] [Green Version]
- Posthuma-Trumpie, G.A.; Korf, J.; Van Amerongen, A. Lateral flow (immuno) assay: Its strengths, weaknesses, opportunities and threats. A literature survey. Anal. Bioanal. Chem. 2009, 393, 569–582. [Google Scholar] [CrossRef] [Green Version]
- Posthuma-Trumpie, G.A.; Korf, J.; Van Amerongen, A. Development of a competitive lateral flow immunoassay for progesterone: Influence of coating conjugates and buffer components. Anal. Bioanal. Chem. 2008, 392, 1215–1223. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pividori, M.I.; Alegret, S. Graphite-epoxy platforms for electrochemical genosensing. Anal. Lett. 2003, 36, 1669–1695. [Google Scholar] [CrossRef]
- Pividori, M.I.; Alegret, S. DNA adsorption on carbonaceous materials. In Immobilisation of DNA on Chips I; Wittmann, C., Ed.; Springer: Berlin, Germany, 2005; pp. 1–36. [Google Scholar]
- Noguera, P.; Posthuma-Trumpie, G.A.; van Tuil, M.; van der Wal, F.J.; de Boer, A.; Moers, A.P.; van Amerongen, A. Carbon nanoparticles in lateral flow methods to detect genes encoding virulence factors of Shiga toxin-producing Escherichia coli. Anal. Bioanal. Chem. 2011, 399, 831–838. [Google Scholar] [CrossRef] [Green Version]
- Oliveira-Rodríguez, M.; Serrano-Pertierra, E.; García, A.C.; Martín, S.L.; Mo, M.Y.; Cernuda-Morollón, E.; Blanco-López, M.C. Point-of-care detection of extracellular vesicles: Sensitivity optimization and multiple-target detection. Biosens. Bioelectron. 2017, 87, 38–45. [Google Scholar] [CrossRef] [PubMed]
- Linares, E.M.; Kubota, L.T.; Michaelis, J.; Thalhammer, S. Enhancement of the detection limit for lateral flow immunoassays: Evaluation and comparison of bioconjugates. J. Immunol. Methods 2012, 375, 264–270. [Google Scholar] [CrossRef] [PubMed]
- Posthuma-Trumpie, G.A.; Wichers, J.H.; Koets, M.; Berendsen, L.B.; Van Amerongen, A. Amorphous carbon nanoparticles: A versatile label for rapid diagnostic (immuno)assays. Anal. Bioanal. Chem. 2012, 402, 593–600. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lermo, A.; Campoy, S.; Barbe, J.; Hernandez, S.; Alegret, S.; Pividori, M.I. In situ DNA amplification with magnetic primers for the electrochemical detection of food pathogens. Biosens. Bioelectron. 2007, 22, 2010–2017. [Google Scholar] [CrossRef] [PubMed]
- Lermo, A.; Zacco, E.; Barak, J.; Delwiche, M.; Campoy, S.; Barbe, J.; Alegret, S.; Pividori, M.I. Towards Q-PCR of pathogenic bacteria with improved electrochemical double-tagged genosensing detection. Biosens. Bioelectron. 2008, 23, 1805–1811. [Google Scholar] [CrossRef] [PubMed]
- Ben Aissa, A.; Jara, J.J.; Sebastián, R.M.; Vallribera, A.; Campoy, S.; Pividori, M.I. Comparing nucleic acid lateral flow and electrochemical genosensing for the simultaneous detection of foodborne pathogens. Biosens. Bioelectron. 2017, 88, 265–272. [Google Scholar] [CrossRef]
- Vidal, L.; Ben Aissa, A.; Salabert, J.; Jara, J.J.; Vallribera, A.; Pividori, M.I.; Sebastián, R.M. Biotinylated phosphorus dendrimers as control line in nucleic acid lateral flow tests. Biomacromolecules 2020, 21, 1315–1323. [Google Scholar] [CrossRef]
Strain and Gene | Primer Sequence | Type | 5′-Labels | Size (bp) |
---|---|---|---|---|
Escherichia coli DH5-α 16S ribosomal gene | AGAGTTTGATCCTGGCTCAG | Forward | biotin | 527 |
ATTACCGCGGCTGCTGGC | Reverse | digoxigenin |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Porras, J.C.; Bernuz, M.; Marfa, J.; Pallares-Rusiñol, A.; Martí, M.; Pividori, M.I. Comparative Study of Gold and Carbon Nanoparticles in Nucleic Acid Lateral Flow Assay. Nanomaterials 2021, 11, 741. https://0-doi-org.brum.beds.ac.uk/10.3390/nano11030741
Porras JC, Bernuz M, Marfa J, Pallares-Rusiñol A, Martí M, Pividori MI. Comparative Study of Gold and Carbon Nanoparticles in Nucleic Acid Lateral Flow Assay. Nanomaterials. 2021; 11(3):741. https://0-doi-org.brum.beds.ac.uk/10.3390/nano11030741
Chicago/Turabian StylePorras, Juan Carlos, Mireia Bernuz, Jennifer Marfa, Arnau Pallares-Rusiñol, Mercè Martí, and María Isabel Pividori. 2021. "Comparative Study of Gold and Carbon Nanoparticles in Nucleic Acid Lateral Flow Assay" Nanomaterials 11, no. 3: 741. https://0-doi-org.brum.beds.ac.uk/10.3390/nano11030741