Dietary Glycine Prevents FOLFOX Chemotherapy-Induced Heart Injury: A Colorectal Cancer Liver Metastasis Treatment Model in Rats
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell Culture
2.1.1. Cell Line
2.1.2. Cell Proliferation and Viability Assay
2.2. Animal Experiments
2.3. Experimental Protocol
2.4. Tumor Implantation
2.5. Heart Ultrasound
2.6. Blood Sample Analysis
2.7. Histology and Immunohistochemistry
2.8. Electron Microscopy
2.9. Quantitative Polymerase Chain Reaction
2.9.1. RNA Isolation and Reverse Transcription
2.9.2. Real-Time PCR
2.10. Statistical Analysis
2.11. Ethics Approval and Consent to Participate
3. Results
3.1. Cell Experiments
3.2. Animal Experiments
3.2.1. General Health Conditions and Body Weight
3.2.2. Complete Blood Count
3.2.3. Glycine Concentration in Serum
3.2.4. BNP and h-FABP Concentrations in Serum
3.2.5. Heart Ultrasound
3.2.6. Fibrosis Index in the Myocardium
3.2.7. Apoptotic Index in the Myocardium
3.2.8. Electron Microscopy of Heart Tissue
3.2.9. qPCR of Heart Tissue
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
Abbreviations
BNP | brain natriuretic peptide |
CAB | chromotrope aniline blue |
CBC | complete blood count |
CCD | charge-coupled device |
CRC | colorectal cancer |
CRLM | colorectal liver metastasis |
CTx | chemotherapy |
ELISA | enzyme-linked immunosorbent assay |
FABL | α-fluoro-β-alanine hydrochloride |
FAC | fluoroacetate |
FHPA | a-fluoro-f-hydroxypropionic acid |
HCM | human cardiac myocyte |
HGB | hemoglobin |
h-FABP | heart fatty acid binding protein |
LV | left ventricle |
LVEDD | left ventricular end-diastolic diameter |
LVEF | left ventricle ejection fraction |
LVESD | left ventricular end-systolic diameter |
OX | oxaliplatin |
RBC | red blood cell |
WBC | white blood cell |
5-FU | 5-fluorouracil |
References
- Wu, X.; Pu, X.; Melkonian, S.C.; Spitz, M.R. Cancer epidemiology. In Holland-Frei Cancer Medicine; American Cancer Society: Atlanta, GA, USA, 2017; pp. 1–9. ISBN 978-1-119-00082-2. [Google Scholar]
- Luo, D.; Liu, Q.; Yu, W.; Ma, Y.; Zhu, J.; Lian, P.; Cai, S.; Li, Q.; Li, X. Prognostic value of distant metastasis sites and surgery in stage IV colorectal cancer: A population-based study. Int. J. Colorectal Dis. 2018, 33, 1241–1249. [Google Scholar] [CrossRef]
- Yoo, P.S.; Lopez-Soler, R.I.; Longo, W.E.; Cha, C.H. Liver resection for metastatic colorectal cancer in the age of neoadjuvant chemotherapy and bevacizumab. Clin. Colorectal Cancer 2006, 6, 202–207. [Google Scholar] [CrossRef]
- Mohelnikova-Duchonova, B.; Melichar, B.; Soucek, P. FOLFOX/FOLFIRI pharmacogenetics: The call for a personalized approach in colorectal cancer therapy. World J. Gastroenterol. 2014, 20, 10316–10330. [Google Scholar] [CrossRef] [PubMed]
- De Forni, M.; Malet-Martino, M.C.; Jaillais, P.; E Shubinski, R.; Bachaud, J.M.; Lemaire, L.; Canal, P.; Chevreau, C.; Carrie, D.; Soulié, P. Cardiotoxicity of high-dose continuous infusion fluorouracil: A prospective clinical study. J. Clin. Oncol. 1992, 10, 1795–1801. [Google Scholar] [CrossRef] [PubMed]
- Yeh, E.T.; Bickford, C.L. Cardiovascular complications of cancer therapy. J. Am. Coll. Cardiol. 2009, 53, 2231–2247. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Labianca, R.; Beretta, G.; Clerici, M.; Fraschini, P.; Luporini, G. Cardiac toxicity of 5-fluorouracil: A study on 1083 patients. Tumori J. 1982, 68, 505–510. [Google Scholar] [CrossRef]
- Rezkalla, S.; A Kloner, R.; Ensley, J.; Al-Sarraf, M.; Revels, S.; Olivenstein, A.; Bhasin, S.; Kerpel-Fronious, S.; Turi, Z.G. Continuous ambulatory ECG monitoring during fluorouracil therapy: A prospective study. J. Clin. Oncol. 1989, 7, 509–514. [Google Scholar] [CrossRef]
- Jensen, S.A.; Hasbak, P.; Mortensen, J.; Sørensen, J.B. Fluorouracil induces myocardial ischemia with increases of plasma brain natriuretic peptide and lactic acid but without dysfunction of left ventricle. J. Clin. Oncol. 2010, 28, 5280–5286. [Google Scholar] [CrossRef]
- Madeddu, C.; Deidda, M.; Piras, A.; Cadeddu, C.; Demurtas, L.; Puzzoni, M.; Piscopo, G.; Scartozzi, M.; Mercuro, G. Pathophysiology of cardiotoxicity induced by nonanthracycline chemotherapy. J. Cardiovasc. Med. 2016, 17, S12–S18. [Google Scholar] [CrossRef]
- El Azim, B.H.A. Biochemical studies of captopril against 5-Flurouracil induced heart Toxicity in rats. Int. J. Adv. Res. 2015, 3, 247–261. [Google Scholar]
- Oun, R.; Moussa, Y.; Wheate, N.J. The side effects of platinum-based chemotherapy drugs: A review for chemists. Dalton Trans. 2018, 47, 6645–6653. [Google Scholar] [CrossRef] [PubMed]
- Oun, R.; Rowan, E.G. Cisplatin induced arrhythmia; electrolyte imbalance or disturbance of the SA node? Eur. J. Pharmacol. 2017, 811, 125–128. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Morrow, P.K.; Hoff, P.M. Does the addition of oxaliplatin increase the risk of capecitabine-induced cardiotoxicity? Nat. Rev. Clin. Oncol. 2006, 3, 76–77. [Google Scholar] [CrossRef] [PubMed]
- Kwakman, J.J.M.; Simkens, L.H.; Mol, L.; Kok, W.E.; Koopman, M.; Punt, C.J.A. Incidence of capecitabine-related cardiotoxicity in different treatment schedules of metastatic colorectal cancer: A retrospective analysis of the CAIRO studies of the Dutch Colorectal Cancer Group. Eur. J. Cancer 2017, 76, 93–99. [Google Scholar] [CrossRef]
- Schemmer, P.; Zhong, Z.; Galli, U.; Wheeler, M.D.; Xiangli, L.; Bradford, B.U.; Conzelmann, L.O.; Forman, D.; Boyer, J.; Thurman, R.G. Glycine reduces platelet aggregation. Amino Acids 2012, 44, 925–931. [Google Scholar] [CrossRef] [Green Version]
- Zhong, Z.; Jones, S.; Thurman, R.G. Glycine minimizes reperfusion injury in a low-flow, reflow liver perfusion model in the rat. Am. J. Physiol. Liver Physiol. 1996, 270, G332–G338. [Google Scholar] [CrossRef]
- Ruiz-Ramirez, A.; Ortiz-Balderas, E.; Cardozo-Saldana, G.; Díaz-Díaz, E.; El-Hafidi, M. Glycine restores glutathione and protects against oxidative stress in vascular tissue from sucrose-fed rats. Clin. Sci. 2014, 126, 19–29. [Google Scholar] [CrossRef]
- Wang, W.; Wu, Z.; Lin, G.; Hu, S.; Wang, B.; Dai, Z.; Wu, G. Glycine stimulates protein synthesis and inhibits oxidative stress in pig small intestinal epithelial cells. J. Nutr. 2014, 144, 1540–1548. [Google Scholar] [CrossRef] [Green Version]
- Zhong, Z.; Wheeler, M.D.; Li, X.; Froh, M.; Schemmer, P.; Yin, M.; Bunzendaul, H.; Bradford, B.; Lemasters, J.J. L-glycine: A novel antiinflammatory, immunomodulatory, and cytoprotective agent. Curr. Opin. Clin. Nutr. Metab. Care 2003, 6, 229–240. [Google Scholar] [CrossRef]
- Maneikyte, J.; Bausys, A.; Leber, B.; Horvath, A.; Feldbacher, N.; Hoefler, G.; Strupas, K.; Stiegler, P.; Schemmer, P. Dietary glycine decreases both tumor volume and vascularization in a combined colorectal liver metastasis and chemotherapy model. Int. J. Boil. Sci. 2019, 15, 1582–1590. [Google Scholar] [CrossRef] [Green Version]
- Mikalauskas, S.; Mikalauskiene, L.; Bruns, H.; Nickkholgh, A.; Hoffmann, K.; Longerich, T.; Strupas, K.; Büchler, M.W.; Schemmer, P. Dietary glycine protects from chemotherapy-induced hepatotoxicity. Amino Acids 2011, 40, 1139–1150. [Google Scholar] [CrossRef] [PubMed]
- Říha, H.; Papoušek, F.; Neckář, J.; Pirk, J.; Ošťádal, B. Effects of isoflurane concentration on basic echocardiographic parameters of the left ventricle in rats. Physiol. Res. 2012, 61, 419–423. [Google Scholar] [CrossRef] [PubMed]
- Stiegler, P.; Sereinigg, M.; Puntschart, M.A.; Bradatsch, A.; Seifert-Held, T.; Wiederstein-Grasser, I.; Leber, B.; Stadelmeyer, E.; Dandachi, N.; Zelzer, S.; et al. Oxidative stress and apoptosis in a pig model of brain death (BD) and living donation (LD). J. Transl. Med. 2013, 11, 244. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dalzell, J.R.; Samuel, L. The spectrum of 5-fluorouracil cardiotoxicity. Anti-Cancer Drugs 2009, 20, 79–80. [Google Scholar] [CrossRef]
- Sara, J.D.; Kaur, J.; Khodadadi, R.; Rehman, M.; Lobo, R.; Chakrabarti, S.; Herrmann, J.; Lerman, A.; Grothey, A. 5-fluorouracil and cardiotoxicity: A review. Ther. Adv. Med. Oncol. 2018, 10, 1758835918780140. [Google Scholar] [CrossRef] [Green Version]
- Jansen, M.C.; Bueno-De-Mesquita, H.B.; Räsänen, L.; Fidanza, F.; Menotti, A.; Nissinen, A.; Feskens, E.J.; Kok, F.J.; Kromhout, D. Consumption of plant foods and stomach cancer mortality in the seven countries study. Is grain consumption a risk factor? Nutr. Cancer 1999, 34, 49–55. [Google Scholar] [CrossRef]
- Depetris, I.; Marino, D.; Bonzano, A.; Cagnazzo, C.; Filippi, R.; Aglietta, M.; Leone, F. Fluoropyrimidine-induced cardiotoxicity. Crit. Rev. Oncol. 2018, 124, 1–10. [Google Scholar] [CrossRef]
- Mosseri, M.; Fingert, H.J.; Varticovski, L.; Chokshi, S.; Isner, J.M. In vitro evidence that myocardial ischemia resulting from 5-fluorouracil chemotherapy is due to protein kinase C-mediated vasoconstriction of vascular smooth muscle. Cancer Res. 1993, 53, 3028–3033. [Google Scholar]
- Porta, C.; Moroni, M.; Ferrari, S.; Nastasi, G. Endothelin-1 and 5-fluorouracil-induced cardiotoxicity. Neoplasma 1998, 45, 81–82. [Google Scholar]
- Jensen, S.A.; Sørensen, J.B. 5-Fluorouracil-based therapy induces endovascular injury having potential significance to development of clinically overt cardiotoxicity. Cancer Chemother. Pharmacol. 2011, 69, 57–64. [Google Scholar] [CrossRef]
- Lamberti, M.; Porto, S.; Marra, M.; Zappavigna, S.; Grimaldi, A.; Feola, D.; Pesce, D.; Naviglio, S.; Spina, A.; Sannolo, N.; et al. 5-Fluorouracil induces apoptosis in rat cardiocytes through intracellular oxidative stress. J. Exp. Clin. Cancer Res. 2012, 31, 60. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lamberti, M.; Porto, S.; Zappavigna, S.; Addeo, E.; Marra, M.; Miraglia, N.; Sannolo, N.; Vanacore, D.; Stiuso, P.; Caraglia, M. A mechanistic study on the cardiotoxicity of 5-fluorouracil in vitro and clinical and occupational perspectives. Toxicol. Lett. 2014, 227, 151–156. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Focaccetti, C.; Bruno, A.; Magnani, E.; Bartolini, D.; Principi, E.; Dallaglio, K.; Bucci, E.O.; Finzi, G.; Sessa, F.; Noonan, D.M.; et al. Effects of 5-fluorouracil on morphology, cell cycle, proliferation, apoptosis, autophagy and ros production in endothelial cells and cardiomyocytes. PLoS ONE 2015, 10, e0115686. [Google Scholar] [CrossRef] [PubMed]
- Salata, C.; Ferreira-Machado, S.C.; De Andrade, C.B.V.; Mencalha, A.; Mandarim-De-Lacerda, C.A.; De Almeida, C.E. Apoptosis induction of cardiomyocytes and subsequent fibrosis after irradiation and neoadjuvant chemotherapy. Int. J. Radiat. Biol. 2014, 90, 284–290. [Google Scholar] [CrossRef]
- Levick, S.P.; Soto-Pantoja, D.R.; Bi, J.; Hundley, W.G.; Widiapradja, A.; Manteufel, E.J.; Bradshaw, T.W.; Meléndez, G.C. Doxorubicin-induced myocardial fibrosis involves the neurokinin-1 receptor and direct effects on cardiac fibroblasts. Heart Lung Circ. 2018, 28, 1598–1605. [Google Scholar] [CrossRef]
- Sun, X.-P.; Wan, L.-L.; Yang, Q.; Huo, Y.; Han, Y.-L.; Guo, C. Scutellarin protects against doxorubicin-induced acute cardiotoxicity and regulates its accumulation in the heart. Arch. Pharmacal Res. 2017, 40, 875–883. [Google Scholar] [CrossRef] [Green Version]
- Razmaraii, N.; Babaei, H.; Nayebi, A.M.; Assadnassab, G.; Helan, J.A.; Azarmi, Y. Crocin treatment prevents doxorubicin-induced cardiotoxicity in rats. Life Sci. 2016, 157, 145–151. [Google Scholar] [CrossRef]
- Mishra, T.; Shokr, M.; Ahmed, A.; Afonso, L. Acute reversible left ventricular systolic dysfunction associated with 5-fluorouracil therapy: A rare and increasingly recognised cardiotoxicity of a commonly used drug. BMJ Case Rep. 2019, 12, e230499. [Google Scholar] [CrossRef]
- Fakhri, Y.; Dalsgaard, M.; Nielsen, D.; Madsen, P.L. 5-Fluorouracil-induced acute reversible heart failure not explained by coronary spasms, myocarditis or takotsubo: Lessons from MRI. BMJ Case Rep. 2016, 2016, bcr2015213783. [Google Scholar] [CrossRef]
- Y-Hassan, S.; Tornvall, P.; Törnerud, M.; Henareh, L. Capecitabine caused cardiogenic shock through induction of global takotsubo syndrome. Cardiovasc. Revascularization Med. 2013, 14, 57–61. [Google Scholar] [CrossRef]
- Sulpher, J.; Dattilo, F.; Dent, S.F.; Turek, M.; Reaume, M.N.; Johnson, C. Acute cardiogenic shock induced by infusional 5-fluorouracil. Case Rep. Oncol. Med. 2014, 2014, 819396. [Google Scholar] [CrossRef] [PubMed]
- Iskandar, M.; Quasem, W.; El-Omar, M. 5-Fluorouracil cardiotoxicity: Reversible left ventricular systolic dysfunction with early detection. BMJ Case Rep. 2015, 2015, bcr2015209347. [Google Scholar] [CrossRef] [Green Version]
- Elghandour, A.; El Sorady, M.; Azab, S.; Elrahman, M. Human heart-type fatty acid-binding protein as an early diagnostic marker of doxorubicin cardiac toxicity. Hematol. Rev. 2009, 1, 6. [Google Scholar] [CrossRef] [Green Version]
- Turan, T.; Çağrı, A.A.; Kul, S.; Cengiz, E.; Boyacı, F.; Erkan, H.; Akyüz, A.R.; Celik, S.; Ağaç, M.T.; Gokdeniz, T.; et al. Usefulness of heart-type fatty acid-binding protein and myocardial performance index for early detection of 5-fluorouracil cardiotoxicity. Angiology 2017, 68, 52–58. [Google Scholar] [CrossRef] [PubMed]
- Ye, X.-D.; He, Y.; Wang, S.; Wong, G.T.; Irwin, M.G.; Xia, Z. Heart-type fatty acid binding protein (H-FABP) as a biomarker for acute myocardial injury and long-term post-ischemic prognosis. Acta Pharmacol. Sin. 2018, 39, 1155–1163. [Google Scholar] [CrossRef] [PubMed]
- Haltern, G.; Peiniger, S.; Bufe, A.; Reiss, G.; Gülker, H.; Scheffold, T. Comparison of usefulness of heart-type fatty acid binding protein versus cardiac troponin T for diagnosis of acute myocardial infarction. Am. J. Cardiol. 2010, 105, 1–9. [Google Scholar] [CrossRef]
- Horacek, J.M.; Vašatová, M.; Pudil, R.; Tichy, M.; Zak, P.; Jakl, M.; Jebavy, L.; Malý, J. Biomarkers for the early detection of anthracycline-induced cardiotoxicity: Current status. Biomed. Pap. Med Fac. Palacky Univ. Olomouc 2014, 158, 511–517. [Google Scholar] [CrossRef] [Green Version]
- Arellano, M.; Malet-Martino, M.; Martino, R.; Gires, P. The anti-cancer drug 5-fluorouracil is metabolized by the isolated perfused rat liver and in rats into highly toxic fluoroacetate. Br. J. Cancer 1998, 77, 79–86. [Google Scholar] [CrossRef] [Green Version]
- Reis-Mendes, A.F.; Sousa, E.; Bastos, M.D.L.; Costa, V.M. The role of the metabolism of anticancer drugs in their induced-cardiotoxicity. Curr. Drug Metab. 2015, 17, 75–90. [Google Scholar] [CrossRef]
- Meldrum, G.K.; Bignell, J.T.; Rowley, I. The use of sodium fluoroacetate (compound 1080) for the control of the rabbit in Tasmania. Aust. Vet. J. 1957, 33, 186–196. [Google Scholar] [CrossRef]
- Zhang, R.W.; Soong, S.J.; Liu, T.P.; Barnes, S.; Diasio, S.B. Pharmacokinetics and tissue distribution of 2-fluoro-beta-alanine in rats. Potential relevance to toxicity pattern of 5-fluorouracil. Drug Metab. Dispos. 1992, 20, 113–119. [Google Scholar] [PubMed]
- Hahn, R.G. Glycine is toxic. Acta Anaesthesiol. Scand. 2006, 50, 261–262. [Google Scholar] [CrossRef] [PubMed]
- Zhang, W.; Andersson, B.S.; Hahn, R.G. Effect of irrigating fluids and prostate tissue extracts on isolated cardiomyocytes. Urology 1995, 46, 821–824. [Google Scholar] [CrossRef]
- Olsson, J.; Hahn, R.G. Glycine toxicity after high-dose i.v. infusion of 1.5% glycine in the mouse. Br. J. Anaesth. 1999, 82, 250–254. [Google Scholar] [CrossRef]
- Luntz, S.P.; Unnebrink, K.; Seibert-Grafe, M.; Bunzendahl, H.; Kraus, T.W.; Büchler, M.W.; Klar, E.; Schemmer, P. HEGPOL: Randomized, placebo controlled, multicenter, double-blind clinical trial to investigate hepatoprotective effects of glycine in the postoperative phase of liver transplantation [ISRCTN69350312]. BMC Surg. 2005, 5, 18. [Google Scholar] [CrossRef] [Green Version]
- Evins, A.E.; Fitzgerald, S.M.; Wine, L.; Rosselli, R.; Goff, D.C. Placebo-controlled trial of glycine added to clozapine in schizophrenia. Am. J. Psychiatry 2000, 157, 826–828. [Google Scholar] [CrossRef]
- Rivera, C.A.; Bradford, B.U.; Hunt, K.J.; Adachi, Y.; Schrum, L.W.; Koop, D.R.; Burchardt, E.-R.; Rippe, R.A.; Thurman, R.G. Attenuation of CCl4-induced hepatic fibrosis by GdCl3 treatment or dietary glycine. Am. J. Physiol. Gastrointest. Liver Physiol. 2001, 281, G200–G207. [Google Scholar] [CrossRef] [Green Version]
- Senthilkumar, R.; Nalini, N. Glycine prevents hepatic fibrosis by preventing the accumulation of collagen in rats with alcoholic liver injury. Pol. J. Pharmacol. 2004, 56, 121–128. [Google Scholar]
- Ham, D.J.; Gardner, A.; Kennedy, T.L.; Trieu, J.; Naim, T.; Chee, A.; Alves, F.M.; Caldow, M.K.; Lynch, G.S.; Koopman, R. Glycine administration attenuates progression of dystrophic pathology in prednisolone-treated dystrophin/utrophin null mice. Sci. Rep. 2019, 9, 1–12. [Google Scholar] [CrossRef] [Green Version]
- Hinderer, S.; Schenke-Layland, K. Cardiac fibrosis—A short review of causes and therapeutic strategies. Adv. Drug Deliv. Rev. 2019, 146, 77–82. [Google Scholar] [CrossRef]
- Rose, M.L.; Madren, J.; Bunzendahl, H.; Thurman, R.G. Dietary glycine inhibits the growth of B16 melanoma tumors in mice. Carcinogenesis 1999, 20, 793–798. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bruns, H.; Kazanavicius, D.; Schultze, D.; Al Saeedi, M.; Yamanaka, K.; Strupas, K.; Schemmer, P. Glycine inhibits angiogenesis in colorectal cancer: Role of endothelial cells. Amino Acids 2016, 48, 2549–2558. [Google Scholar] [CrossRef] [PubMed]
Account Number | Forward (5′->3′) | Reverse (5′->3′) | Product Length |
---|---|---|---|
COL1A1 (Collagen1) | |||
NM_053304.1 | CAACCTCAAGAAGTCCCTGC | AGGTGAATCGACTGTTGCCT | 77 bp |
COL2A1 (Collagen 2) | |||
NM_012929.1 | CAGTCGCTGGTGCTGCT | GCCCTAATTTTCGGGCATCC | 76 bp |
BNP (Brain natriuretic peptide) | |||
NM_031545.1 | TTTCCTTAATCTGTCGCCGCT | GGATTGTTCTGGAGACTGGCT | 73 bp |
ACTB (beta-Actin) | |||
NM_031144.3 | GCAGGAGTACGATGAGTCCG | ACGCAGCTCAGTAACAGTCC | 74 bp |
Group | Day 6 (×109/L) | Day 14 (×109/L) | Day 17 (×109/L) | Day 21 (×109/L) |
---|---|---|---|---|
Glycine–FOLFOX | 11.1 (9.0; 12.4) | 11.5 (9.5; 13.0) | 4.6 (4.1; 5.2) | 0.5 (0.3; 0.9) |
Casein–FOLFOX | 10.4 (9.6; 11.6) | 11.6 (4.8; 12.7) | 4.5 (3.5; 5.0) | 0.4 (0.2; 0.6) |
Glycine–Control | 11.7 (10.6; 12.2) | 11.6 (10.4; 15.8) | 14.4 (12.4; 16.7) | 8.4 (7.3; 9.3) |
Casein–Control | 11.0 (10.7; 11.9) | 14.8 (10.5; 17.1) | 14.9 (10.6; 17.4) | 8.9 (7.3; 9.6) |
Glycine–Sham | 10.1 (9.7; 12.3) | 9.6 (8.7; 11.2) | 13.1 (12.8; 14.1) | 6.8 (6.1; 7.7) |
Casein–Sham | 10.7 (8.0; 10.7) | 10.2 (9.7; 10.4) | 16.6 (13.7; 23.3) | 7.0 (3.3; 8.4) |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Maneikyte, J.; Bausys, A.; Leber, B.; Feldbacher, N.; Hoefler, G.; Kolb-Lenz, D.; Strupas, K.; Stiegler, P.; Schemmer, P. Dietary Glycine Prevents FOLFOX Chemotherapy-Induced Heart Injury: A Colorectal Cancer Liver Metastasis Treatment Model in Rats. Nutrients 2020, 12, 2634. https://0-doi-org.brum.beds.ac.uk/10.3390/nu12092634
Maneikyte J, Bausys A, Leber B, Feldbacher N, Hoefler G, Kolb-Lenz D, Strupas K, Stiegler P, Schemmer P. Dietary Glycine Prevents FOLFOX Chemotherapy-Induced Heart Injury: A Colorectal Cancer Liver Metastasis Treatment Model in Rats. Nutrients. 2020; 12(9):2634. https://0-doi-org.brum.beds.ac.uk/10.3390/nu12092634
Chicago/Turabian StyleManeikyte, Juste, Augustinas Bausys, Bettina Leber, Nicole Feldbacher, Gerald Hoefler, Dagmar Kolb-Lenz, Kestutis Strupas, Philipp Stiegler, and Peter Schemmer. 2020. "Dietary Glycine Prevents FOLFOX Chemotherapy-Induced Heart Injury: A Colorectal Cancer Liver Metastasis Treatment Model in Rats" Nutrients 12, no. 9: 2634. https://0-doi-org.brum.beds.ac.uk/10.3390/nu12092634