Morphological, Behavioral, and Molecular Characterization of Avian Schistosomes (Digenea: Schistosomatidae) in the Native Snail Chilina dombeyana (Chilinidae) from Southern Chile
Abstract
:1. Introduction
2. Results
2.1. Freshwater Snails as Intermediate Hosts
2.2. Morphological Description of Intramolluscan Stages
2.2.1. Sporocysts
2.2.2. Furcocercariae
2.3. Release, Behavior, and Life Span of Cercariae
2.4. Phylogenetic Analyses
3. Discussion
4. Material and Methods
4.1. Sampling and Study Area
4.2. Collection and Description of Intramolluscan Stages
4.3. Molecular Analyses
4.3.1. DNA Extraction and Polymerase Chain Reaction (PCR)
4.3.2. Phylogenetic Analyses
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Dvořák, J.; Vaňáčová, Š.; Hampl, V.; Flegr, J.; Horák, P. Comparison of European Trichobilharzia species based on ITS1 and ITS2 sequences. Parasitology 2002, 124, 307–313. [Google Scholar] [CrossRef] [Green Version]
- Brant, S.V.; Loker, E.S. Molecular systematics of the avian schistosome genus Trichobilharzia (Trematoda: Schistosomatidae) in North America. J. Parasitol. 2009, 95, 941–963. [Google Scholar] [CrossRef] [Green Version]
- Horák, P.; Mikeš, L.; Lichtenbergová, L.; Skála, V.; Soldánová, M.; Brant, S.V. Avian schistosomes and outbreaks of Cercarial dermatitis. Clin. Microbiol. Rev. 2015, 28, 165–190. [Google Scholar] [CrossRef] [Green Version]
- Flores, V.; Viozzi, G.; Casalins, L.; Loker, E.S.; Brant, S.V. A new Schistosome (Digenea: Schistosomatidae) from the nasal tissue of South America black-necked swans, Cygnus melancoryphus (Anatidae) and the endemic pulmonate snail Chilina gibbosa. Zootaxa 2021, 4948, 404–418. [Google Scholar] [CrossRef]
- Soldánová, M.; Selbach, C.; Kalbe, M.; Kostadinova, A.; Sures, B. Swimmer’s itch: Etiology, impact, and risk factors in Europe. Trends Parasitol. 2013, 29, 65–74. [Google Scholar] [CrossRef]
- Horák, P.; Kolářová, L. Snails, waterfowl and Cercarial dermatitis. Freshw. Biol. 2011, 56, 779–790. [Google Scholar] [CrossRef]
- Horák, P.; Kolářová, L.E. Bird schistosomes: Do they die in mammalian skin? Trends Parasitol. 2001, 17, 66–69. [Google Scholar] [CrossRef]
- Marszewska, A.; Cichy, A.; Heese, T.; Żbikowska, E. The real threat of swimmers’ itch in anthropogenic recreational water body of the Polish Lowland. Parasitol. Res. 2016, 115, 3049–3056. [Google Scholar] [CrossRef] [Green Version]
- Kolářová, L.; Horák, P.; Čada, F. Histopathology of CNS and nasal infections caused by Trichobilharzia regenti in vertebrates. Parasitol. Res. 2001, 87, 644–650. [Google Scholar] [CrossRef]
- Brant, S.V.; Morgan, J.A.T.; Mkoji, G.M.; Snyder, S.D.; Rajapakse, R.P.V.J.; Loker, E.S. An approach to revealing blood fluke life cycles, taxonomy, and diversity: Provision of key reference data including DNA sequence from single life cycle stages. J. Parasitol. 2006, 92, 77–88. [Google Scholar] [CrossRef] [Green Version]
- Brant, S.V.; Loker, E.S. Schistosomes in the southwest United States and their potential for causing Cercarial dermatitis or “swimmer’s itch”. J. Helminthol. 2009, 83, 191–198. [Google Scholar] [CrossRef] [PubMed]
- Flores, V.; Brant, S.V.; Loker, E.S. Avian schistosomes from the South American endemic gastropod genus Chilina (Pulmonata: Chilinidae), with a brief review of South American schistosome species. J. Parasitol. 2015, 101, 565–576. [Google Scholar] [CrossRef] [PubMed]
- Pinto, H.A.; Brant, S.V.; de Melo, A.L. Physa marmorata (Mollusca: Physidae) as a natural intermediate host of Trichobilharzia (Trematoda: Schistosomatidae), a potential causative agent of avian cercarial dermatitis in Brazil. Acta Trop. 2014, 138, 38–43. [Google Scholar] [CrossRef] [PubMed]
- Pinto, H.A.; Pulido-Murillo, E.A.; de Melo, A.L.; Brant, S.V. Putative new genera and species of avian schistosomes potentially involved in human Cercarial dermatitis in the Americas, Europe and Africa. Acta Trop. 2017, 176, 415–420. [Google Scholar] [CrossRef] [PubMed]
- Ebbs, E.T.; Loker, E.S.; Davis, N.E.; Flores, V.; Veleizan, A.; Brant, S.V. Schistosomes with wings: How host phylogeny and ecology shape the global distribution of Trichobilharzia querquedulae (Schistosomatidae). Int. J. Parasitol. 2016, 46, 669–677. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Oyarzún-Ruiz, P.; Muñoz, P.; Paredes, E.; Valenzuela, G.; Ruiz, J. Gastrointestinal helminths and related histopathological lesions in black-necked swans Cygnus melancoryphus from the Carlos Anwandter Nature Sanctuary, Southern Chile. Rev. Bras. Parasitol. Vet. 2019, 28, 613–624. [Google Scholar] [CrossRef]
- Brant, S.V.; Loker, E.S.; Casalins, L.; Flores, V. Phylogenetic Placement of a Schistosome from an Unusual Marine Snail Host, the False Limpet (Siphonaria lessoni) and Gulls (Larus dominicanus) from Argentina with a Brief Review of Marine Schistosomes from Snails. J. Parasitol. 2017, 103, 75–82. [Google Scholar] [CrossRef]
- Szidat, L. Cercarias schistosomicas y Dermatitis schistosomica humana en la República Argentina. Común. Del Inst. Nac. Investig. Las Cienc. Nat. 1951, 2, 129–150. [Google Scholar]
- Szidat, L. Investigaciones sobre Cercaria chascomusi n. sp. Agente causal de la una nueva enfermedad humana en la Argentina. Boletín Del Mus. Cienc. Nat. “Bernardino Rivadavia” Inst. Nac. Investig. Las Cienc. Nat. Cienc. Zoológicas 1958, 18, 1–16. [Google Scholar]
- Martorelli, S.R. Sobre una cercaria de la familia Schistosomatidae (Digenea) parásita de Chilina gibbosa Sowerby, 1841 en Lago Pellegrini, Provincia de Rio Negro, República Argentina. Neotropica 1984, 30, 97–106. [Google Scholar]
- Horák, P.; Schets, F.M.; Kolářová, L.; Brant, S.V. Trichobilharzia. In Molecular Detection of Human Parasitic Pathogens; Liu, D., Ed.; CRC Press Taylor and Francis: Boca Raton, FL, USA, 2012; pp. 455–465. [Google Scholar]
- Paré, J.A.; Black, S.R. Schistosomiasis in a Collection of Captive Chilean Flamingos (Phoenicopterus chilensis). J. Avian Med. Surg. 1999, 13, 187–191. [Google Scholar]
- Valdovinos, C.; Balboa, C. Cercarial dermatitis and lake eutrophication in south-central Chile. Epidemiol. Infect. 2008, 136, 391–394. [Google Scholar] [CrossRef] [PubMed]
- Kolářová, L.; Rudolfová, J.; Hampl, V.; Skírnisson, K. Allobilharzia visceralis gen. nov., sp. nov. (Schistosomatidae-Trematoda) from Cygnus cygnus (L.) (Anatidae). Parasitol. Int. 2006, 55, 179–186. [Google Scholar] [CrossRef] [PubMed]
- Helmer, N.; Blatterer, H.; Hörweg, C.; Reier, S.; Sattmann, H.; Schindelar, J.; Szucsich, N.U.; Haring, E. First Record of Trichobilharzia physellae (Talbot, 1936) in Europe, a Possible Causative Agent of Cercarial Dermatitis. Pathogens 2021, 10, 1473. [Google Scholar] [CrossRef]
- Ostrowski de Núñez, M. Trematoda. Familias Strigeidae, Diplostomidae, Clinostomidae, Schistosomatidae, Spirorchiidae y Bucephalidae. In Fauna de Agua Dulce de la República Argentina; de Castellanos, Z.A., Ed.; Profadu CONICET: La Plata, Argentina, 1992; Volume 9, pp. 1–55. [Google Scholar]
- Martínez, D.; González, G. Aves De Chile: Guía de Campo y Breve Historia Natural; Ediciones del Naturalista: Santiago, Chile, 2017; 540p. [Google Scholar]
- Brant, S.V.; Cohen, A.N.; James, D.; Hui, L.; Hom, A.; Loker, E.S. Cercarial dermatitis transmitted by exotic marine snail. Emerg. Infect. Dis. 2010, 16, 1357–1365. [Google Scholar] [CrossRef]
- Oyarzún-Ruiz, P.; González-Acuña, D.A. Current knowledge of trematodes (Platyhelminthes: Digenea, Aspidogastrea) in Chile. Rev. Suisse Zool. 2022, accepted. [Google Scholar]
- Lie, K.J. Larval trematode antagonism: Principles and possible application as a control method. Exp. Parasitol. 1973, 33, 343–349. [Google Scholar] [CrossRef]
- Walker, J.C. Austrobilharzia terrigalensis: A schistosome dominant in interspecific interactions in the molluscan host. Int. J. Parasitol. 1979, 9, 137–140. [Google Scholar] [CrossRef]
- Valdovinos, C. Estado de conocimiento de los Gastrópodos dulceacuícolas de Chile. Gayana 2006, 70, 88–95. [Google Scholar] [CrossRef] [Green Version]
- Bórquez, J.; Valdovinos, C.; Brante, A. Genetic structure and diversity in the freshwater gastropod Chilina dombeiana in the Biobío River, Chile. Conserv. Genet. 2020, 21, 1023–1036. [Google Scholar] [CrossRef]
- Fuentealba, C.; Figueroa, R.; Morrone, J.J. Análisis de endemismo de moluscos dulceacuícolas de Chile. Rev. Chil. Hist. Nat. 2010, 83, 289–298. [Google Scholar] [CrossRef] [Green Version]
- Collado, G.A. Unraveling cryptic invasion of a freshwater snail in Chile based on molecular and morphological data. Biodivers. Conserv. 2017, 26, 567–578. [Google Scholar] [CrossRef]
- Al-Jubury, A.; Duan, Y.; Kania, P.W.; Tracz, E.S.; Bygum, A.; Jørgensen, L.V.G.; Horák, P.; Buchmann, K. Avian schistosome species in Danish freshwater lakes: Relation to biotic and abiotic factors. J. Helminthol. 2021, 95, e22. [Google Scholar] [CrossRef] [PubMed]
- Cort, W.W.; McMullen, D.B.; Olivier, L.; Brackett, S. Studies on schistosome dermatitis. VII. Seasonal incidence of Cercaria stagnicolae Talbot, 1936, in relation to the life cycle of its snail host, Stagnicola emarginata angulata (Soweeby). Am. J. Epidemiol. 1940, 32, 33–69. [Google Scholar] [CrossRef]
- Sckrabulis, J.P.; Flory, A.R.; Raffel, T.R. Direct onshore wind predicts daily swimmer’s itch (avian schistosome) incidence at a Michigan beach. Parasitology 2020, 147, 431–440. [Google Scholar] [CrossRef] [PubMed]
- Lichtenbergová, L.; Lassmann, H.; Jones, M.K.; Kolářová, L.; Horák, P. Trichobilharzia regenti: Host immune response in the pathogenesis of neuroinfection in mice. Exp. Parasitol. 2011, 128, 328–335. [Google Scholar] [CrossRef]
- Adlard, R.D.; Miller, T.L.; Smit, N.J. The butterfly effect: Parasite diversity, environment, and emerging disease in aquatic wildlife. Trends Parasitol. 2015, 31, 160–166. [Google Scholar] [CrossRef]
- Soldánová, M.; Kostadinova, A. Rapid colonisation of Lymnaea stagnalis by larval trematodes in eutrophic ponds in central Europe. Int. J. Parasitol. 2011, 41, 981–990. [Google Scholar] [CrossRef]
- Lutz, H.L.; Tkach, V.V.; Weckstein, J.D. Methods for Specimen-based Studies of Avian Symbionts. In The Extended Specimen: Emerging Frontiers in Collections-Based Ornithological Research; Webster, M.S., Ed.; CRC Press: Boca Raton, FL, USA, 2017; pp. 157–183. [Google Scholar]
- Kolářová, L.; Horák, P.; Skírnisson, K. Methodical approaches in the identification of areas with a potential risk of infection by bird schistosomes causing Cercarial dermatitis. J. Helminthol. 2010, 84, 327–335. [Google Scholar] [CrossRef]
- Bush, A.O.; Lafferty, K.D.; Lotz, J.M.; Shostak, A.W. Parasitology meets ecology on its own terms: Margolis et al. revisited. J. Parasitol. 1997, 83, 575–583. [Google Scholar] [CrossRef]
- Khare, P.; Raj, V.; Chandra, S.; Agarwal, S. Quantitative and qualitative assessment of DNA extracted from saliva for its use in forensic identification. J. Forensic Dent. Sci. 2014, 6, 81–85. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lockyer, A.E.; Olson, P.D.; Østergaard, P.; Rollinson, D.; Johnston, D.A.; Attwood, S.W.; Southgate, V.R.; Horák, P.; Snyder, S.D.; Le, T.H.; et al. The phylogeny of the Schistosomatidae based on three genes with emphasis on the interrelationships of Schistosoma Weinland, 1858. Parasitology 2003, 126, 203–224. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tkach, V.; Pawlowski, J.; Mariaux, J. Phylogenetic analysis of the suborder Plagiorchiata (Platyhelminthes, Digenea) based on partial lsrDNA sequences. Int. J. Parasitol. 2000, 30, 83–93. [Google Scholar] [CrossRef]
- Olson, P.D.; Cribb, T.H.; Tkach, V.V.; Bray, R.A.; Littlewood, D.T.J. Phylogeny and classification of the Digenea (Platyhelminthes: Trematoda). Int. J. Parasitol. 2003, 33, 733–755. [Google Scholar] [CrossRef]
- Katoh, K.; Standley, D.M. MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef] [Green Version]
- Nguyen, L.T.; Schmidt, H.A.; von Haeseler, A.; Minh, B.Q. IQ-TREE: A Fast and Effective Stochastic Algorithm for Estimating Maximum-Likelihood Phylogenies. Mol. Biol. Evol. 2015, 32, 268–274. [Google Scholar] [CrossRef]
- Ronquist, F.; Teslenko, M.; van der Mark, P.; Ayres, D.L.; Darling, A.; Höhna, S.; Larget, B.; Liu, L.; Suchard, M.A.; Huelsenbeck, J.P. MrBayes 3.2: Efficient Bayesian Phylogenetic Inference and Model Choice Across a Large Model Space. Syst. Biol. 2012, 61, 539–542. [Google Scholar] [CrossRef] [Green Version]
- Kalyaanamoorthy, S.; Minh, B.Q.; Wong, T.K.F.; von Haeseler, A.; Jermiin, L.S. ModelFinder: Fast model selection for accurate phylogenetic estimates. Nat. Methods 2017, 14, 587–589. [Google Scholar] [CrossRef] [Green Version]
- Minh, B.Q.; Nguyen, M.A.T.; von Haeseler, A. Ultrafast Approximation for Phylogenetic Bootstrap. Mol. Biol. Evol. 2013, 30, 1188–1195. [Google Scholar] [CrossRef]
- Huelsenbeck, J.P.; Larget, B.; Alfaro, M.E. Bayesian Phylogenetic Model Selection Using Reversible Jump Markov Chain Monte Carlo. Mol. Biol. Evol. 2004, 21, 1123–1133. [Google Scholar] [CrossRef]
- Huelsenbeck, J.P.; Rannala, B. Frequentist Properties of Bayesian Posterior Probabilities of Phylogenetic Trees Under Simple and Complex Substitution Models. Syst. Biol. 2004, 53, 904–913. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Maddison, W.P.; Maddison, D.R. Mesquite: A Modular System for Evolutionary Analysis, Version 3.70. 2021. Available online: http://www.mesquiteproject.org (accessed on 20 January 2022).
- Rambaut, A.; Drummond, A.J.; Xie, D.; Baele, G.; Suchard, M.A. Posterior Summarization in Bayesian Phylogenetics Using Tracer 1.7. Syst. Biol. 2018, 67, 901–904. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Taxon | Lineage I | Lineage II | Species inquirenda * | C. chilinae I | C. chilinae II | C. chilinicola | Lineage 1 | Lineage 2 | Lineage 2 | Lineage 2 | Lineage 3 |
---|---|---|---|---|---|---|---|---|---|---|---|
Host | C. dombeyana | C. dombeyana | C. dombeyana | C. fluminea | C. fluminea | C. gibbosa | C. gibbosa | C. gibbosa | C. perrieri | Chilina sp. | C. dombeyana, C. neuquenensis |
Locality (country) | Laguna Chica de San Pedro (CHI) | Laguna Chica de San Pedro (CHI) | Laguna Chica de San Pedro (CHI) | Delta Paraná (AR) | Delta Paraná (AR) | Pellegrini Reservoir (AR) | Pellegrini Reservoir, Nahuel Huapi lake (AR) | Pellegrini Reservoir (AR) | Santa Cruz river (AR) | Larga Larga (AR) | Mascardi lake (AR) |
Reference | This study | This study | [a] | [b] | [c] | [c] | [d] | [d] | [d] | [d] | [d] |
n cercariae | 23 | 96 | - | - | - | - | - | 10 | 25 | 5 | 20 |
L total | 959.4–1062 (101,006 ± 31.31) | 750–937 (839.07 ± 41.98) | 684–1212 | 930 | 990 | 1010 | 1045–1140 | 805–875 | 998–1085 | 1056–1114 | 816–931 |
L body | 342–432 (378.24 ± 22.12) | 185–315 (262.45 ± 24.36) | - | 280 | 280 | 330 | 400–435 | 245–270 | 259–317 | 259–278 | 269–307 |
W body | 61–92 (79.59 ± 8.92) | 45–84 (63.92 ± 7.35) | - | 70 | 70 | 110 | 90–100 | 60–65 | 58–77 | 67–77 | 83 |
L tail stem | 354–467 (422.21 ± 29.04) | 358–488 (422.55 ± 26.35) | - | 650 | 530 | 510 | 410–450 | 405–450 | 528–576 | 595–624 | 582–624 |
L furca | 193–228 (209.61 ± 9.39) | 131–176 (155.47 ± 9.28) | - | - | 180 | 170 | 235–290 | 125–175 | 163–211 | 182–211 | 192–240 |
L × W penetration organ | 109–135 (119.82 ± 7.31) × 40–62 (51.59 ± 5.07) | 54–93 (73.55 ± 6.07) × 28–52 (39.19 ± 4.26) | - | - | - | 90 × 50 | 100–113 × 50–63 | 65–85 × 38–45 | 77 × 40 | 96–108 × 36–43 | 99 × 48 |
D eye spots | 7–11 (9.18 ± 1.05) | 6–10 (8.22 ± 0.96) | - | - | - | - | - | - | - | - | - |
Eye spots position | 2nd third | 2nd third | - | - | - | 1st third | 2nd third | 2nd third | 2nd third | 2nd third | 2nd third |
Flame cells | 12 | 14 | - | 14 | - | 14 | - | - | 12 | - | 12 |
D Ace | 22–39 (31.86 ± 3.83) | 20–36 (26.31 ± 3.01) | - | - | 25 | 35 | 35–40 | 20–28 | 24–29 | 24–34 | 29–38 |
Ae-Ace | 199–270 (234.95 ± 19.58) | 91–188 (143.69 ± 17.13) | - | 200 | 200 | 180 | 250–300 | 130–150 | 153 | 182–202 | 193 |
L body: L tail stem | 1: 0.76–1.1 (0.9 ± 0.1) | 1:0.46–0.78 (0.62 ± 0.07) | - | 1:0.43 | 1:0.52 | 1:0.65 | 1:0.9–1 | 1:0.5–0.6 | 1:0.5–0.6 | 1:0.4–0.5 | 1:0.4–0.6 |
L tail stem: L furca | 1:1.65–2.19 (2.02 ± 0.14) | 1:2.32–3.14 (2.72 ± 0.17) | - | - | 1:2.9 | 1:3 | 1:1.5–1.8 | 1:2.3–3.4 | 1:2.5–3.4 | 1:3–3.3 | 1:2.4–3.3 |
L prim | 15–29 (21.87 ± 3.49) | 15–34 (21.25 ± 3.67) | - | - | - | - | - | - | - | - | - |
Ace-prim | 0–12 (4.87 ± 2.94) | 13–46 (32.73 ± 6.95) | - | - | - | - | - | - | - | - | - |
Locality | Coordinates | Snail Species (n) | ||||
---|---|---|---|---|---|---|
Physella acuta (Physellidae) | Chilina dombeyana (Chilinidae) | Lymnaea sp. (Lymnaeidae) | Potamolithus spp. (Tateidae) | Ancylus sp. (Planorbidae) | ||
Ñuble region | ||||||
El Quillai | 36°39′31.22″ S, 72°12′11.76″ W | 20 | 0 | 0 | 0 | 0 |
Chillán river | 36°38′4.00″ S, 72°4′56.54″ W | 1 | 0 | 0 | 0 | 0 |
Ñuble river | 36°34′59.40″ S, 72°13′49.34″ W | 330 | 8 | 0 | 0 | 0 |
Biobío region | ||||||
University of Concepción (Udec) | 36°49′41.75″ S, 73°2′13.45″ W | 0 | 25 | 0 | 0 | 0 |
Laguna Chica de San Pedro (SP) | 36°50′54.34″ S, 73°5′5.16″ W | 57 | 447 | 56 | 57 | 0 |
Laguna Grande de San Pedro (SP) | 36°51′21.04″ S, 73°6′29.85″ W | 762 | 9 | 0 | 0 | 24 |
Los Ríos region | ||||||
Angachilla wetland | 39°51′23.21″ S, 73°14′5.71″ W | 93 | 121 | 0 | 5 | 0 |
Jardín Botánico (Valdivia city) | 39°48′10.46″ S, 73°14′56.07″ W | 6 | 104 | 0 | 14 | 0 |
Los Patos lagoon (Valdivia city) | 39°48′35.85″ S, 73°15′23.13″ W | 10 | 0 | 0 | 5 | 0 |
Austral University of Chile (UACh) | 39°48′11.76″ S, 73°15′19.21″ W | 111 | 0 | 19 | 0 | 0 |
Gene | Primer | Sequence | To (°C) † | Expected Length (bp) | Reference |
---|---|---|---|---|---|
COI | Cox1_schis’_5′ | TCTTTRGATCATAAGCG | * 50–46 phase 1; 45 phase 2 | 1000 | Lockyer et al. [46] |
Cox1_schis’_3′ | TAATGCATMGGAAAAAAACA | ||||
CO1F15 | TTTNTYTCTTTRGATCATAAGC | * 50–46 phase 1; 45 phase 2 | 600 | Brant & Loker [2] | |
CO1R15 | TGAGCWAYHACAAAYCAHGTATC | ||||
CO1RH3R internal | TAAACCTCAGGATGCCCAAAAAA | ||||
28S | U178 | GCACCCGCTGAAYTTAAG | * 55–51 phase 1; 50 phase 2 | 1500 | Lockyer et al. [46], Tkach et al. [47], Olson et al. [48] |
L1642 | CCAGCGCCATCCATTTTCA | ||||
DIG12 internal | AAGCATATCACTAAGCGG | ||||
ECD2 internal | CTTGGTCCGTGTTTCAAGACGGG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Oyarzún-Ruiz, P.; Thomas, R.; Santodomingo, A.; Collado, G.; Muñoz, P.; Moreno, L. Morphological, Behavioral, and Molecular Characterization of Avian Schistosomes (Digenea: Schistosomatidae) in the Native Snail Chilina dombeyana (Chilinidae) from Southern Chile. Pathogens 2022, 11, 332. https://0-doi-org.brum.beds.ac.uk/10.3390/pathogens11030332
Oyarzún-Ruiz P, Thomas R, Santodomingo A, Collado G, Muñoz P, Moreno L. Morphological, Behavioral, and Molecular Characterization of Avian Schistosomes (Digenea: Schistosomatidae) in the Native Snail Chilina dombeyana (Chilinidae) from Southern Chile. Pathogens. 2022; 11(3):332. https://0-doi-org.brum.beds.ac.uk/10.3390/pathogens11030332
Chicago/Turabian StyleOyarzún-Ruiz, Pablo, Richard Thomas, Adriana Santodomingo, Gonzalo Collado, Pamela Muñoz, and Lucila Moreno. 2022. "Morphological, Behavioral, and Molecular Characterization of Avian Schistosomes (Digenea: Schistosomatidae) in the Native Snail Chilina dombeyana (Chilinidae) from Southern Chile" Pathogens 11, no. 3: 332. https://0-doi-org.brum.beds.ac.uk/10.3390/pathogens11030332