Toll-Like Receptor 4 Signaling in the Ileum and Colon of Gnotobiotic Piglets Infected with Salmonella Typhimurium or Its Isogenic ∆rfa Mutants
Abstract
:1. Introduction
2. Results
2.1. Virulence of Wild-Type Salmonella Typhimurium Strain LT2 for Germ-Free Piglets
2.2. Colonization of Germ-Free Piglets with Wild-Type Salmonella Typhimurium and Its Isogenic ∆rfa Mutants
2.3. Expression of TLR4 in the Colon of the Germ-Free and Wild-Type S. Typhimurium-Infected piglets
2.4. Relative Expression of TLR4, MD-2, CD14, LBP, TLR2, TLR9, MyD88, and TRIF mRNA in the Ileum
2.5. Relative Expression of TLR4, MD-2, CD14, and LBP mRNA in the Colon
2.6. Relative mRNA Expression of Inflammatory Cytokines IL-12/23 p40, IL-6, and IFN-γ in the Ileum and Colon
2.7. Local and Systemic Levels of Inflammatory Cytokines IL-12/23 p40, IL-6, and IFN-γ
2.8. Systemic Levels of C-Reactive Protein
3. Discussion
4. Conclusions
5. Materials and Methods
5.1. Ethical Statement
5.2. Bacterial Cultures
5.3. Gnotobiotic Piglets
5.4. Virulence of Wild Type Salmonella Typhimurium Strain LT2 for Germ-Free Piglets
5.5. Challenge of the Germ-Free Piglets with Wild-Type and ∆rfa Mutant Salmonella Typhimurium
5.6. Tissue Sample Collections
5.7. Immunohistochemistry Detection of TLR4 in the Colon
5.8. Isolation of Total RNA and Reverse Transcription
5.9. Real-Time PCR
5.10. Local and Systemic Levels of IL-12/23 p40, IL-6, and IFN-γ
5.11. Statistical Analysis
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Raetz, C.R.; Whitfield, C. Lipopolysaccharide endotoxins. Annu. Rev. Biochem. 2002, 71, 635–700. [Google Scholar] [CrossRef] [Green Version]
- Caroff, M.; Karibian, D. Structure of bacterial lipopolysaccharides. Carbohydr. Res. 2003, 338, 2431–2447. [Google Scholar] [CrossRef]
- Hitchcock, P.J.; Leive, L.; Makela, P.H.; Rietschel, E.T.; Strittmatter, W.; Morrison, D.C. Lipopolysaccharide nomenclature--past, present, and future. J. Bacteriol. 1986, 166, 699–705. [Google Scholar] [CrossRef] [Green Version]
- Molinaro, A.; Holst, O.; Di, L.F.; Callaghan, M.; Nurisso, A.; D′Errico, G.; Zamyatina, A.; Peri, F.; Berisio, R.; Jerala, R.; et al. Chemistry of lipid A: At the heart of innate immunity. Chemistry 2015, 21, 500–519. [Google Scholar] [CrossRef]
- Rietschel, E.T.; Brade, H.; Brade, L.; Brandenburg, K.; Schade, U.; Seydel, U.; Zahringer, U.; Galanos, C.; Luderitz, O.; Westphal, O. Lipid A, the endotoxic center of bacterial lipopolysaccharides: Relation of chemical structure to biological activity. Prog. Clin. Biol. Res. 1987, 231, 25–53. [Google Scholar] [CrossRef] [PubMed]
- Freudenberg, M.A.; Tchaptchet, S.; Keck, S.; Fejer, G.; Huber, M.; Schutze, N.; Beutler, B.; Galanos, C. Lipopolysaccharide sensing an important factor in the innate immune response to Gram-negative bacterial infections: Benefits and hazards of LPS hypersensitivity. Immunobiology 2008, 213, 193–203. [Google Scholar] [CrossRef] [PubMed]
- Huber, M.; Kalis, C.; Keck, S.; Jiang, Z.; Georgel, P.; Du, X.; Shamel, L.; Sovath, S.; Mudd, S.; Beutler, B.; et al. R-form LPS, the master key to the activation ofTLR4/MD-2-positive cells. Eur. J. Immunol. 2006, 36, 701–711. [Google Scholar] [CrossRef]
- Nikaido, H. Prevention of drug access to bacterial targets: Permeability barriers and active efflux. Science 1994, 264, 382–388. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Beveridge, T.J. Structures of gram-negative cell walls and their derived membrane vesicles. J. Bacteriol. 1999, 181, 4725–4733. [Google Scholar] [CrossRef] [Green Version]
- Cinel, I.; Opal, S.M. Molecular biology of inflammation and sepsis: A primer. Crit. Care Med. 2009, 37, 291–304. [Google Scholar] [CrossRef]
- Cohen, J. The immunopathogenesis of sepsis. Nature 2002, 420, 885–891. [Google Scholar] [CrossRef] [PubMed]
- Beutler, B.; Hoebe, K.; Du, X.; Ulevitch, R.J. How we detect microbes and respond to them: The Toll-like receptors and their transducers. J. Leukoc. Biol. 2003, 74, 479–485. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Freudenberg, M.A.; Merlin, T.; Gumenscheimer, M.; Kalis, C.; Landmann, R.; Galanos, C. Role of lipopolysaccharide susceptibility in the innate immune response to Salmonella typhimurium infection: LPS, a primary target for recognition of Gram-negative bacteria. Microbes Infect. 2001, 3, 1213–1222. [Google Scholar] [CrossRef]
- Cavaillon, J.M. Exotoxins and endotoxins: Inducers of inflammatory cytokines. Toxicon 2018, 149, 45–53. [Google Scholar] [CrossRef]
- Cavaillon, J.M.; Singer, M.; Skirecki, T. Sepsis therapies: Learning from 30 years of failure of translational research to propose new leads. EMBO Mol. Med. 2020, 12, e10128. [Google Scholar] [CrossRef]
- Mehta, S.; Gill, S.E. Improving clinical outcomes in sepsis and multiple organ dysfunction through precision medicine. J. Thorac. Dis. 2019, 11, 21–28. [Google Scholar] [CrossRef]
- Liu, D.; Cao, S.; Zhou, Y.; Xiong, Y. Recent advances in endotoxin tolerance. J. Cell Biochem. 2019, 120, 56–70. [Google Scholar] [CrossRef] [Green Version]
- Ryu, J.K.; Kim, S.J.; Rah, S.H.; Kang, J.I.; Jung, H.E.; Lee, D.; Lee, H.K.; Lee, J.O.; Park, B.S.; Yoon, T.Y.; et al. Reconstruction of LPS transfer cascade reveals structural determinants within LBP, CD14, and TLR4-MD2 for efficient LPS recognition and transfer. Immunity 2017, 46, 38–50. [Google Scholar] [CrossRef] [Green Version]
- Kagan, J.C. Lipopolysaccharide detection across the kingdoms of life. Trends Immunol. 2017, 38, 696–704. [Google Scholar] [CrossRef]
- Oswald, I.P. Role of intestinal epithelial cells in the innate immune defence of the pig intestine. Vet. Res. 2006, 37, 359–368. [Google Scholar] [CrossRef] [Green Version]
- Heine, H.; Rietschel, E.T.; Ulmer, A.J. The biology of endotoxin. Mol. Biotechnol. 2001, 19, 279–296. [Google Scholar] [CrossRef]
- Kawai, T.; Akira, S. Toll-like receptors and their crosstalk with other innate receptors in infection and immunity. Immunity 2011, 34, 637–650. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cao, X. Self-regulation and cross-regulation of pattern-recognition receptor signalling in health and disease. Nat. Rev. Immunol. 2016, 16, 35–50. [Google Scholar] [CrossRef] [PubMed]
- Park, B.S.; Lee, J.O. Recognition of lipopolysaccharide pattern by TLR4 complexes. Exp. Mol. Med. 2013, 45, e66. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Raby, A.C.; Holst, B.; Le, B.E.; Diaz, C.; Ferran, E.; Conraux, L.; Guillemot, J.C.; Coles, B.; Kift-Morgan, A.; Colmont, C.S.; et al. Targeting the TLR co-receptor CD14 with TLR2-derived peptides modulates immune responses to pathogens. Sci. Transl. Med. 2013, 5, 185ra64. [Google Scholar] [CrossRef] [PubMed]
- Baumann, C.L.; Aspalter, I.M.; Sharif, O.; Pichlmair, A.; Bluml, S.; Grebien, F.; Bruckner, M.; Pasierbek, P.; Aumayr, K.; Planyavsky, M.; et al. CD14 is a coreceptor of Toll-like receptors 7 and 9. J. Exp. Med. 2010, 207, 2689–2701. [Google Scholar] [CrossRef] [PubMed]
- Osuchowski, M.F.; Ayala, A.; Bahrami, S.; Bauer, M.; Boros, M.; Cavaillon, J.M.; Chaudry, I.H.; Coopersmith, C.M.; Deutschman, C.; Drechsler, S.; et al. Minimum quality threshold in pre-clinical sepsis studies (MQTiPSS): An international expert consensus initiative for improvement of animal modeling in sepsis. Infection 2018, 46, 687–691. [Google Scholar] [CrossRef] [Green Version]
- Bassols, A.; Costa, C.; Eckersall, P.D.; Osada, J.; Sabria, J.; Tibau, J. The pig as an animal model for human pathologies: A proteomics perspective. Proteom. Clin. Appl. 2014, 8, 715–731. [Google Scholar] [CrossRef]
- Xiao, L.; Estelle, J.; Kiilerich, P.; Ramayo-Caldas, Y.; Xia, Z.; Feng, Q.; Liang, S.; Pedersen, A.O.; Kjeldsen, N.J.; Liu, C.; et al. A reference gene catalogue of the pig gut microbiome. Nat. Microbiol. 2016, 1, 16161. [Google Scholar] [CrossRef]
- Burrin, D.; Sangild, P.T.; Stoll, B.; Thymann, T.; Buddington, R.; Marini, J.; Olutoye, O.; Shulman, R.J. Translational Advances in Pediatric Nutrition and Gastroenterology: New Insights from Pig Models. Annu. Rev. Anim Biosci. 2020, 8, 321–354. [Google Scholar] [CrossRef] [Green Version]
- Meurens, F.; Summerfield, A.; Nauwynck, H.; Saif, L.; Gerdts, V. The pig: A model for human infectious diseases. Trends Microbiol. 2012, 20, 50–57. [Google Scholar] [CrossRef] [PubMed]
- Waterhouse, A.; Leslie, D.C.; Bolgen, D.E.; Lightbown, S.; Dimitrakakis, N.; Cartwright, M.J.; Seiler, B.; Lightbown, K.; Smith, K.; Lombardo, P.; et al. Modified Clinical Monitoring Assesment Criteria for Multi-Organ Failure during Bacteremia and Sepsis Progression in a Pig Model. Adv. Crit. Care Med. 2018, 1, 2. Available online: http://www.scientificoajournals.org/pdf/ccm.1002.pdf (accessed on 16 August 2020).
- Hurley, D.; McCusker, M.P.; Fanning, S.; Martins, M. Salmonella-host interactions-modulation of the host innate immune system. Front. Immunol. 2014, 5, 481. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Campos, J.; Mourao, J.; Peixe, L.; Antunes, P. Non-typhoidal Salmonella in the pig production chain: A comprehensive analysis of Its impact on human health. Pathogens 2019, 8, 19. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kaiser, P.; Hardt, W.D. Salmonella typhimurium diarrhea: Switching the mucosal epithelium from homeostasis to defense. Curr. Opin. Immunol. 2011, 23, 456–463. [Google Scholar] [CrossRef] [PubMed]
- Barthel, M.; Hapfelmeier, S.; Quintanilla-Martinez, L.; Kremer, M.; Rohde, M.; Hogardt, M.; Pfeffer, K.; Russmann, H.; Hardt, W.D. Pretreatment of mice with streptomycin provides a Salmonella enterica serovar Typhimurium colitis model that allows analysis of both pathogen and host. Infect. Immun. 2003, 71, 2839–2858. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, S.; Kingsley, R.A.; Santos, R.L.; Andrews-Polymenis, H.; Raffatellu, M.; Figueiredo, J.; Nunes, J.; Tsolis, R.M.; Adams, L.G.; Baumler, A.J. Molecular pathogenesis of Salmonella enterica serotype typhimurium-induced diarrhea. Infect. Immun. 2003, 71, 1–12. [Google Scholar] [CrossRef] [Green Version]
- Wen, S.C.; Best, E.; Nourse, C. Non-typhoidal Salmonella infections in children: Review of literature and recommendations for management. J. Paediatr. Child. Health 2017, 53, 936–941. [Google Scholar] [CrossRef]
- Rai, B.; Utekar, T.; Ray, R. Preterm delivery and neonatal meningitis due to transplacental acquisition of non-typhoidal Salmonella serovar montevideo. BMJ Case. Rep. 2014, 2014. [Google Scholar] [CrossRef] [Green Version]
- Mooser, C.; Gomez de, A.M.; Ganal-Vonarburg, S.C. Standardization in host-microbiota interaction studies: Challenges, gnotobiology as a tool, and perspective. Curr. Opin. Microbiol. 2018, 44, 50–60. [Google Scholar] [CrossRef]
- Ducarmon, Q.R.; Zwittink, R.D.; Hornung, B.V.H.; van, S.W.; Young, V.B.; Kuijper, E.J. Gut icrobiota and Colonization Resistance against Bacterial Enteric Infection. Microbiol. Mol. Biol. Rev. 2019, 83. [Google Scholar] [CrossRef]
- Splichalova, A.; Splichal, I.; Chmelarova, P.; Trebichavsky, I. Alarmin HMGB1 is released in the small intestine of gnotobiotic piglets infected with enteric pathogens and its level in plasma reflects severity of sepsis. J. Clin. Immunol. 2011, 31, 488–497. [Google Scholar] [CrossRef] [PubMed]
- Splichalova, A.; Trebichavsky, I.; Rada, V.; Vlkova, E.; Sonnenborn, U.; Splichal, I. Interference of Bifidobacterium choerinum or Escherichia coli Nissle 1917 with Salmonella Typhimurium in gnotobiotic piglets correlates with cytokine patterns in blood and intestine. Clin. Exp. Immunol. 2011, 163, 242–249. [Google Scholar] [CrossRef] [PubMed]
- Foster, N.; Lovell, M.A.; Marston, K.L.; Hulme, S.D.; Frost, A.J.; Bland, P.; Barrow, P.A. Rapid protection of gnotobiotic pigs against experimental salmonellosis following induction of polymorphonuclear leukocytes by avirulent Salmonella enterica. Infect. Immun. 2003, 71, 2182–2191. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Splichalova, A.; Slavikova, V.; Splichalova, Z.; Splichal, I. Preterm life in sterile conditions: A study on preterm, germ-free piglets. Front. Immunol. 2018, 9, 220. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Basic, M.; Bleich, A. Gnotobiotics: Past, present and future. Lab. Anim. 2019, 53, 232–243. [Google Scholar] [CrossRef]
- Salmon, H.; Berri, M.; Gerdts, V.; Meurens, F. Humoral and cellular factors of maternal immunity in swine. Dev. Comp. Immunol. 2009, 33, 384–393. [Google Scholar] [CrossRef]
- Roberts, R.M.; Green, J.A.; Schulz, L.C. The evolution of the placenta. Reproduction 2016, 152, R179–R189. [Google Scholar] [CrossRef] [Green Version]
- Galen, J.E.; Buskirk, A.D.; Tennant, S.M.; Pasetti, M.F. Live attenuated human Salmonella vaccine candidates: Tracking the pathogen in natural infection and stimulation of host immunity. Ecosal. Plus. 2016, 7. [Google Scholar] [CrossRef] [Green Version]
- Kong, Q.; Yang, J.; Liu, Q.; Alamuri, P.; Roland, K.L.; Curtiss, R. III Effect of deletion of genes involved in lipopolysaccharide core and O-antigen synthesis on virulence and immunogenicity of Salmonella enterica serovar Typhimurium. Infect. Immun. 2011, 79, 4227–4239. [Google Scholar] [CrossRef] [Green Version]
- Chang, Y.F.; Hou, J.N.; Lin, H.H.; Wu, C.P.; Chu, C. Differences in immune responses of pigs vaccinated with Salmonella Typhimurium and S. Choleraesuis strains and challenged with S. Choleraesuis. Comp. Immunol. Microbiol. Infect. Dis. 2019, 65, 41–47. [Google Scholar] [CrossRef]
- Iwasaki, A.; Medzhitov, R. Control of adaptive immunity by the innate immune system. Nat. Immunol. 2015, 16, 343–353. [Google Scholar] [CrossRef] [PubMed]
- McClelland, M.; Sanderson, K.E.; Spieth, J.; Clifton, S.W.; Latreille, P.; Courtney, L.; Porwollik, S.; Ali, J.; Dante, M.; Du, F.; et al. Complete genome sequence of Salmonella enterica serovar Typhimurium LT2. Nature 2001, 413, 852–856. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Clarke, R.C.; Gyles, C.L. Virulence of wild and mutant strains of Salmonella typhimurium in ligated intestinal segments of calves, pigs, and rabbits. Am. J. Vet. Res. 1987, 48, 504–510. [Google Scholar] [PubMed]
- Trebichavsky, I.; Dlabac, V.; Rehakova, Z.; Zahradnickova, M.; Splichal, I. Cellular changes and cytokine expression in the ilea of gnotobiotic piglets resulting from peroral Salmonella typhimurium challenge. Infect. Immun. 1997, 65, 5244–5249. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Splichal, I.; Rychlik, I.; Gregorova, D.; Sebkova, A.; Trebichavsky, I.; Splichalova, A.; Muneta, Y.; Mori, Y. Susceptibility of germ-free pigs to challenge with protease mutants of Salmonella enterica serovar Typhimurium. Immunobiology 2007, 212, 577–582. [Google Scholar] [CrossRef] [PubMed]
- Trebichavsky, I.; Splichalova, A.; Rychlik, I.; Hojna, H.; Muneta, Y.; Mori, Y.; Splichal, I. Attenuated aroA Salmonella enterica serovar Typhimurium does not induce inflammatory response and early protection of gnotobiotic pigs against parental virulent LT2 strain. Vaccine 2006, 24, 4285–4289. [Google Scholar] [CrossRef]
- Goldfarb, R.D.; Dellinger, R.P.; Parrillo, J.E. Porcine models of severe sepsis: Emphasis on porcine peritonitis. Shock 2005, 24 (Suppl. 1), 75–81. [Google Scholar] [CrossRef]
- Fink, M.P. Animal models of sepsis. Virulence 2014, 5, 143–153. [Google Scholar] [CrossRef]
- Pierrakos, C.; Vincent, J.L. Sepsis biomarkers: A review. Crit. Care 2010, 14, R15. [Google Scholar] [CrossRef] [Green Version]
- Galanos, C.; Freudenberg, M.A. Mechanisms of endotoxin shock and endotoxin hypersensitivity. Immunobiology 1993, 187, 346–356. [Google Scholar] [CrossRef]
- Splichal, I.; Trebichavsky, I.; Splichalova, A.; Barrow, P.A. Protection of gnotobiotic pigs against Salmonella enterica serotype Typhimurium by rough mutant of the same serotype is accompanied by the change of local and systemic cytokine response. Vet. Immunol. Immunopathol. 2005, 103, 155–161. [Google Scholar] [CrossRef]
- Splichal, I.; Donovan, S.M.; Jenistova, V.; Splichalova, I.; Salmonova, H.; Vlkova, E.; Neuzil, B.V.; Sinkora, M.; Killer, J.; Skrivanova, E.; et al. High mobility group box 1 and TLR4 signaling pathway in gnotobiotic piglets colonized/infected with L. amylovorus, L. mucosae, E. coli Nissle 1917 and S. Typhimurium. Int. J. Mol. Sci. 2019, 20, 6294. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Splichalova, A.; Splichalova, Z.; Karasova, D.; Rychlik, I.; Trevisi, P.; Sinkora, M.; Splichal, I. Impact of the lipopolysaccharide chemotype of Salmonella enterica serovar Typhimurium on virulence in gnotobiotic piglets. Toxins 2019, 11, 534. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Awoniyi, M.; Miller, S.I.; Wilson, C.B.; Hajjar, A.M.; Smith, K.D. Homeostatic regulation of Salmonella-induced mucosal inflammation and injury by IL-23. PLoS. ONE. 2012, 7, e37311. [Google Scholar] [CrossRef] [PubMed]
- Kak, G.; Raza, M.; Tiwari, B.K. Interferon-gamma (IFN-gamma): Exploring its implications in infectious diseases. Biomol. Concepts 2018, 9, 64–79. [Google Scholar] [CrossRef] [PubMed]
- Song, J.; Park, D.W.; Moon, S.; Cho, H.J.; Park, J.H.; Seok, H.; Choi, W.S. Diagnostic and prognostic value of interleukin-6, pentraxin 3, and procalcitonin levels among sepsis and septic shock patients: A prospective controlled study according to the Sepsis-3 definitions. BMC Infect. Dis. 2019, 19, 968. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Splichal, I.; Splichalova, A. Experimental Enteric Bacterial Infections in Pigs. J. Infect. Dis. 2018, 218, 504–505. [Google Scholar] [CrossRef] [Green Version]
- Thorgersen, E.B.; Hellerud, B.C.; Nielsen, E.W.; Barratt-Due, A.; Fure, H.; Lindstad, J.K.; Pharo, A.; Fosse, E.; Tonnessen, T.I.; Johansen, H.T.; et al. CD14 inhibition efficiently attenuates early inflammatory and hemostatic responses in Escherichia coli sepsis in pigs. FASEB J. 2010, 24, 712–722. [Google Scholar] [CrossRef] [Green Version]
- Burkey, T.E.; Skjolaas, K.A.; Dritz, S.S.; Minton, J.E. Expression of Toll-like receptors, interleukin 8, macrophage migration inhibitory factor, and osteopontin in tissues from pigs challenged with Salmonella enterica serovar Typhimurium or serovar Choleraesuis. Vet. Immunol. Immunopathol. 2007, 115, 309–319. [Google Scholar] [CrossRef]
- Burkey, T.E.; Skjolaas, K.A.; Dritz, S.S.; Minton, J.E. Expression of porcine Toll-like receptor 2, 4 and 9 gene transcripts in the presence of lipopolysaccharide and Salmonella enterica serovars Typhimurium and Choleraesuis. Vet. Immunol. Immunopathol. 2009, 130, 96–101. [Google Scholar] [CrossRef]
- Collado-Romero, M.; Arce, C.; Ramirez-Boo, M.; Carvajal, A.; Garrido, J.J. Quantitative analysis of the immune response upon Salmonella typhimurium infection along the porcine intestinal gut. Vet. Res. 2010, 41, 23. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vaure, C.; Liu, Y. A comparative review of toll-like receptor 4 expression and functionality in different animal species. Front. Immunol. 2014, 5, 316. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vogt, S.L.; Pena-Diaz, J.; Finlay, B.B. Chemical communication in the gut: Effects of microbiota-generated metabolites on gastrointestinal bacterial pathogens. Anaerobe 2015, 34, 106–115. [Google Scholar] [CrossRef]
- Dziarski, R.; Wang, Q.; Miyake, K.; Kirschning, C.J.; Gupta, D. MD-2 enables Toll-like receptor 2 (TLR2)-mediated responses to lipopolysaccharide and enhances TLR2-mediated responses to Gram-positive and Gram-negative bacteria and their cell wall components. J. Immunol. 2001, 166, 1938–1944. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lembo, A.; Kalis, C.; Kirschning, C.J.; Mitolo, V.; Jirillo, E.; Wagner, H.; Galanos, C.; Freudenberg, M.A. Differential contribution of Toll-like receptors 4 and 2 to the cytokine response to Salmonella enterica serovar Typhimurium and Staphylococcus aureus in mice. Infect. Immun. 2003, 71, 6058–6062. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Van Bergenhenegouwen, J.; Plantinga, T.S.; Joosten, L.A.; Netea, M.G.; Folkerts, G.; Kraneveld, A.D.; Garssen, J.; Vos, A.P. TLR2 & Co: A critical analysis of the complex interactions between TLR2 and coreceptors. J. Leukoc. Biol. 2013, 94, 885–902. [Google Scholar] [CrossRef] [PubMed]
- Chen, G.Y.; Nunez, G. Sterile inflammation: Sensing and reacting to damage. Nat. Rev. Immunol. 2010, 10, 826–837. [Google Scholar] [CrossRef] [Green Version]
- Zughaier, S.M.; Zimmer, S.M.; Datta, A.; Carlson, R.W.; Stephens, D.S. Differential induction of the toll-like receptor 4-MyD88-dependent and -independent signaling pathways by endotoxins. Infect. Immun. 2005, 73, 2940–2950. [Google Scholar] [CrossRef] [Green Version]
- Tan, Y.; Kagan, J.C. A cross-disciplinary perspective on the innate immune responses to bacterial lipopolysaccharide. Mol. Cell 2014, 54, 212–223. [Google Scholar] [CrossRef] [Green Version]
- Cho, S.Y.; Choi, J.H. Biomarkers of sepsis. Infect. Chemother. 2014, 46, 1–12. [Google Scholar] [CrossRef]
- Splichalova, A.; Splichal, I. Local and systemic occurrences of HMGB1 in gnotobiotic piglets infected with E. coli O55 are related to bacterial translocation and inflammatory cytokines. Cytokine 2012, 60, 597–600. [Google Scholar] [CrossRef]
- Croxford, A.L.; Kulig, P.; Becher, B. IL-12-and IL-23 in health and disease. Cytokine Growth Factor Rev. 2014, 25, 415–421. [Google Scholar] [CrossRef] [PubMed]
- Bette, M.; Jin, S.C.; Germann, T.; Schafer, M.K.; Weihe, E.; Rude, E.; Fleischer, B. Differential expression of mRNA encoding interleukin-12 p35 and p40 subunits in situ. Eur. J. Immunol. 1994, 24, 2435–2440. [Google Scholar] [CrossRef] [PubMed]
- Castellheim, A.; Thorgersen, E.B.; Hellerud, B.C.; Pharo, A.; Johansen, H.T.; Brosstad, F.; Gaustad, P.; Brun, H.; Fosse, E.; Tonnessen, T.I.; et al. New biomarkers in an acute model of live Escherichia coli-induced sepsis in pigs. Scand. J. Immunol. 2008, 68, 75–84. [Google Scholar] [CrossRef] [PubMed]
- Takaoka, A.; Yanai, H. Interferon signalling network in innate defence. Cell Microbiol. 2006, 8, 907–922. [Google Scholar] [CrossRef]
- Trinchieri, G. Interleukin-12: A proinflammatory cytokine with immunoregulatory functions that bridge innate resistance and antigen-specific adaptive immunity. Annu. Rev. Immunol. 1995, 13, 251–276. [Google Scholar] [CrossRef]
- Ingram, J.P.; Brodsky, I.E.; Balachandran, S. Interferon-gamma in Salmonella pathogenesis: New tricks for an old dog. Cytokine 2017, 98, 27–32. [Google Scholar] [CrossRef]
- Singer, M.; Deutschman, C.S.; Seymour, C.W.; Shankar-Hari, M.; Annane, D.; Bauer, M.; Bellomo, R.; Bernard, G.R.; Chiche, J.D.; Coopersmith, C.M.; et al. The Third International Consensus Definitions for Sepsis and Septic Shock (Sepsis-3). JAMA 2016, 315, 801–810. [Google Scholar] [CrossRef]
- Mantovani, A.; Garlanda, C.; Doni, A.; Bottazzi, B. Pentraxins in innate immunity: From C-reactive protein to the long pentraxin PTX3. J. Clin. Immunol. 2008, 28, 1–13. [Google Scholar] [CrossRef]
- Reinhart, K.; Bauer, M.; Riedemann, N.C.; Hartog, C.S. New approaches to sepsis: Molecular diagnostics and biomarkers. Clin. Microbiol. Rev. 2012, 25, 609–634. [Google Scholar] [CrossRef] [Green Version]
- Fan, S.L.; Miller, N.S.; Lee, J.; Remick, D.G. Diagnosing sepsis—The role of laboratory medicine. Clin. Chim. Acta 2016, 460, 203–210. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Soderholm, A.T.; Pedicord, V.A. Intestinal epithelial cells: At the interface of the microbiota and mucosal immunity. Immunology 2019, 158, 267–280. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mandel, L.; Travnicek, J. The minipig as a model in gnotobiology. Nahrung 1987, 31, 613–618. [Google Scholar] [CrossRef] [PubMed]
- Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative C(T) method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef]
CRP | GF | WT | ∆rfaL | ∆rfaG | ∆rfaC |
---|---|---|---|---|---|
Mean ± SD (ng/mL) | 1.2 ± 1.4 a | 233.3 ± 76.7 b | 103.0 ± 22.6 c | 4.1 ± 5.6 a | 2.3 ± 2.3 a |
Gene | 5′-Forward Primer-3′ | 5′-Reverse Primer-3′ | #LNA Probe |
---|---|---|---|
BACT 1 | TCCCTGGAGAAGAGCTACGA | AAGAGCGCCTCTGGACAC | 9 |
CYPA 2 | CCTGAAGCATACGGGTCCT | AAAGACCACATGTTTGCCATC | 48 |
TLR4 3 | CCATGGCCTTTCTCTCCTG | TCAGCTCCATGCATTGGTAA | 33 |
MD-2 4 | GCTCTGAAGGGAGAGACTGTG | TTGTCCCGGAGAAAATCGTA | 12 |
CD14 5 | TCTCACCACCCTGGACCTAT | AACTTGCGCGGACAGAGA | 23 |
LBP 6 | ACTAGACGGCTCCTTTGACG | GCCCAGGAGAAGATTGACTG | 9 |
TLR2 3 | CTGCTCCTGTGACTTCCTGTC | AGGTAGTTCTCCGGCCAGTC | 40 |
TLR9 3 | CAATGACATCCATAGCCGAGT | CGTTGCCGCTAAAGTCCA | 3 |
MyD88 7 | GCAGCTGGAACAGACCAACT | GTGCCAGGCAGGACATCT | 41 |
TRIF 8 | ATCTCCCTGGAGGCACTGA | GCTGTCTACACCAGCCCACT | 49 |
IL-12p40 9 | TTCCTGTGTCCATGAAAACTTC | AGGTACCAGTGGCCCTGAAT | 77 |
IL-6 9 | CAAAGCCACCACCCCTAAC | TCCACTCGTTCTGTGACTGC | 40 |
INF-γ10 | TGGAAAGAGGAGAGTGACAAAAA | GAATGGCCTGGTTATCTTTGA | 21 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Splichal, I.; Rychlik, I.; Splichalova, I.; Karasova, D.; Splichalova, A. Toll-Like Receptor 4 Signaling in the Ileum and Colon of Gnotobiotic Piglets Infected with Salmonella Typhimurium or Its Isogenic ∆rfa Mutants. Toxins 2020, 12, 545. https://0-doi-org.brum.beds.ac.uk/10.3390/toxins12090545
Splichal I, Rychlik I, Splichalova I, Karasova D, Splichalova A. Toll-Like Receptor 4 Signaling in the Ileum and Colon of Gnotobiotic Piglets Infected with Salmonella Typhimurium or Its Isogenic ∆rfa Mutants. Toxins. 2020; 12(9):545. https://0-doi-org.brum.beds.ac.uk/10.3390/toxins12090545
Chicago/Turabian StyleSplichal, Igor, Ivan Rychlik, Iva Splichalova, Daniela Karasova, and Alla Splichalova. 2020. "Toll-Like Receptor 4 Signaling in the Ileum and Colon of Gnotobiotic Piglets Infected with Salmonella Typhimurium or Its Isogenic ∆rfa Mutants" Toxins 12, no. 9: 545. https://0-doi-org.brum.beds.ac.uk/10.3390/toxins12090545