Physiological, Biochemical and Molecular Response of Different Winter Wheat Varieties under Drought Stress at Germination and Seedling Growth Stage
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Material and Treatments
2.2. Morpho-Physiological Traits Measurements
2.3. Determination of the Proline Content
2.4. Determination of the Lipid Peroxidation Level
2.5. Determination of the Glutathione Content
2.6. Antioxidant Enzymes Activity Determination
2.7. RNA Isolation, cDNA Synthesis, and Quantitative PCR
2.8. Data Analysis
3. Results
3.1. Morpho-Physiological Traits
3.2. Proline Content in Wheat Seedlings
3.3. Lipid Peroxidation Levels in Wheat Seedlings
3.4. GSH and GSSG Content in Wheat Seedlings
3.5. Antioxidant Enzymes Activities
3.6. Genes Relative Expression Levels
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Arora, N.K. Impact of climate change on agriculture production and its sustainable solutions. J. Environ. Sustain. 2019, 2, 95–96. [Google Scholar] [CrossRef] [Green Version]
- Spinoni, J.; Naumann, G.; Vogt, J.V.; Barbosa, P. The biggest drought events in Europe from 1950 to 2012. J. Hydrol. Reg. Stud. 2015, 3, 509–524. [Google Scholar] [CrossRef]
- Javadinejad, S.; Dara, R.; Jafary, F. Analysis and prioritization the effective factors on increasing farmers resilience under climate change and drought. Agric. Res. 2021, 10, 497–513. [Google Scholar] [CrossRef]
- Marinović, I.; Cindrić Kalin, K.; Güttler, I.; Pasarić, Z. Dry spells in Croatia: Observed climate change and climate projections. Atmosphere 2021, 12, 652. [Google Scholar] [CrossRef]
- Barić, M.; Kerfša, S.; Habus Jerčić, I.; Havrda, S.; Gelencir, D. Evaluation and characterization of Croatian winter wheat genotypes (T. aestivum L.) for drought tolerance. Cereal Res. Commun. 2008, 36, 1031–1034. [Google Scholar]
- Wolny, E.; Betekhtin, A.; Rojek, M.; Braszewska-Zalewska, A.; Lusinska, J.; Hasterok, R. Germination and the early stages of seedling development in Brachypodium distachyon. Int. J. Mol. Sci. 2018, 19, 2916. [Google Scholar] [CrossRef] [Green Version]
- Reddy, Y.A.N.; Reddy, Y.N.P.; Ramya, V.; Suma, L.S.; Reddy, A.B.N.; Krishna, S.S. Chapter 8—Drought adaptation: Approaches for crop improvement. In Millets and Pseudo Cereals; Singh, M., Sood, S., Eds.; Woodhead Publishing: Sawston, UK, 2021; pp. 143–158. [Google Scholar]
- Kizilgeçi, F.; Tazebay, N.; Namli, M.; Albayrak, Ö.; Yıldırım, M. The drought effect on seed germination and seedling growth in bread wheat (Triticum aestivum L.). Int. J. Agric. Environ. Food Sci. 2017, 1, 33–37. [Google Scholar] [CrossRef]
- Mahpara, S.; Zainab, A.; Ullah, R.; Kausar, S.; Bilal, M.; Latif, M.I.; Arif, M.; Akhtar, I.; Al-Hashimi, A.; Elshikh, M.S.; et al. The impact of PEG-induced drought stress on seed germination and seedling growth of different bread wheat (Triticum aestivum L.) genotypes. PLoS ONE 2022, 17, e0262937. [Google Scholar] [CrossRef]
- Chun, S.C.; Paramasivan, M.; Chandrasekaran, M. Proline accumulation influenced by osmotic stress in arbuscular mycorrhizal symbiotic plants. Front. Microbiol. 2018, 9, 2525. [Google Scholar] [CrossRef] [Green Version]
- Kulkarni, M.; Soolanayakanahally, R.; Ogawa, S.; Uga, Y.; Selvaraj, M.G.; Kagale, S. Drought response in wheat: Key genes and regulatory mechanisms controlling root system architecture and transpiration efficiency. Front. Chem. 2017, 5, 106. [Google Scholar] [CrossRef] [Green Version]
- Kuşvuran, Ş.; Daşgan, Y.; Abak, K. Responses of different melon genotypes to drought stress. Yüzüncü Yıl Univ. J. Agric. Sci. 2011, 21, 209–219. [Google Scholar]
- Qayyum, A.; Al Ayoubi, S.; Sher, A.; Bibi, Y.; Ahmad, S.; Shen, Z.; Jenks, M.A. Improvement in drought tolerance in bread wheat is related to an improvement in osmolyte production, antioxidant enzyme activities, and gaseous exchange. Saudi J. Biol. Sci. 2021, 28, 5238–5249. [Google Scholar] [CrossRef]
- Sanders, G.J.; Arndt, S.K. Osmotic adjustment under drought conditions. In Plant Responses to Drought Stress: From Morphological to Molecular Features; Aroca, R., Ed.; Springer: Berlin/Heidelberg, Germany, 2012; pp. 199–229. [Google Scholar]
- Reddy, A.R.; Chaitanya, K.V.; Vivekanandan, M. Drought-induced responses of photosynthesis and antioxidant metabolism in higher plants. J. Plant Physiol. 2004, 161, 1189–1202. [Google Scholar] [CrossRef]
- Mittler, R.; Vanderauwera, S.; Suzuki, N.; Miller, G.; Tognetti, V.B.; Vandepoele, K.; Gollery, M.; Shulaev, V.; Van Breusegem, F. ROS signaling: The new wave? Trends Plant Sci. 2011, 16, 300–309. [Google Scholar] [CrossRef]
- Cruz de Carvalho, M.H. Drought stress and reactive oxygen species: Production, scavenging and signaling. Plant Signal. Behav. 2008, 3, 156–165. [Google Scholar] [CrossRef] [Green Version]
- Mickky, B.M.; Aldesuquy, H.S. Impact of osmotic stress on seedling growth observations, membrane characteristics and antioxidant defense system of different wheat genotypes. Egypt. J. Basic Appl. Sci. 2019, 4, 47–54. [Google Scholar] [CrossRef] [Green Version]
- Ahmad, P.; Jaleel, C.A.; Salem, M.A.; Nabi, G.; Sharma, S. Roles of enzymatic and nonenzymatic antioxidants in plants during abiotic stress. Crit. Rev. Biotechnol. 2010, 30, 161–175. [Google Scholar] [CrossRef]
- Hasanuzzaman, M.; Bhuyan, M.; Anee, T.I.; Parvin, K.; Nahar, K.; Mahmud, J.A.; Fujita, M. Regulation of ascorbate-glutathione pathway in mitigating oxidative damage in plants under abiotic stress. Antioxidants 2019, 8, 384. [Google Scholar] [CrossRef] [Green Version]
- Pandey, P.; Singh, J.; Achary, V.M.M.; Reddy, M.K. Redox homeostasis via gene families of ascorbate-glutathione pathway. Front. Environ. Sci. 2015, 3, 25. [Google Scholar] [CrossRef] [Green Version]
- Noctor, G.; Foyer, C.H. Ascorbate and glutathione: Keeping active oxygen under control. Annu. Rev. Plant Physiol. Plant Mol. Biol. 1998, 49, 249–279. [Google Scholar] [CrossRef]
- Hasanuzzaman, M.; Nahar, K.; Anee, T.I.; Fujita, M. Glutathione in plants: Biosynthesis and physiological role in environmental stress tolerance. Physiol. Mol. Biol. Plants 2017, 23, 249–268. [Google Scholar] [CrossRef] [PubMed]
- Hossain, M.A.; Piyatida, P.; da Silva, J.A.T.; Fujita, M. Molecular mechanism of heavy metal toxicity and tolerance in plants: Central role of glutathione in detoxification of reactive oxygen species and methylglyoxal and in heavy metal chelation. J. Bot. 2012, 2012, 872875. [Google Scholar] [CrossRef]
- Chaves, M.M.; Maroco, J.P.; Pereira, J.S. Understanding plant responses to drought—From genes to the whole plant. Funct. Plant Biol. 2003, 30, 239–264. [Google Scholar] [CrossRef] [PubMed]
- De Carvalho, K.; de Campos, M.K.F.; Domingues, D.S.; Pereira, L.F.P.; Vieira, L.G.E. The accumulation of endogenous proline induces changes in gene expression of several antioxidant enzymes in leaves of transgenic Swingle citrumelo. Mol. Biol. Rep. 2013, 40, 3269–3279. [Google Scholar] [CrossRef]
- Slama, I.; Abdelly, C.; Bouchereau, A.; Flowers, T.; Savouré, A. Diversity, distribution and roles of osmoprotective compounds accumulated in halophytes under abiotic stress. Ann. Bot. 2015, 115, 433–447. [Google Scholar] [CrossRef] [Green Version]
- Szabados, L.; Kovács, H.; Zilberstein, A.; Bouchereau, A. Plants in extreme environments. Adv. Bot. Res. 2011, 57, 105–150. [Google Scholar] [CrossRef]
- Maghsoudi, K.; Emam, Y.; Niazi, A.; Pessarakli, M.; Arvin, M.J. P5CS expression level and proline accumulation in the sensitive and tolerant wheat cultivars under control and drought stress conditions in the presence/absence of silicon and salicylic acid. J. Plant Interact. 2018, 13, 461–471. [Google Scholar] [CrossRef]
- Mwadzingeni, L.; Shimelis, H.; Tesfay, S.; Tsilo, T.J. Screening of bread wheat genotypes for drought tolerance using phenotypic and proline analyses. Front. Plant Sci. 2016, 7, 1276. [Google Scholar] [CrossRef] [Green Version]
- Hu, C.A.; Delauney, A.J.; Verma, D.P. A bifunctional enzyme (delta 1-pyrroline-5-carboxylate synthetase) catalyzes the first two steps in proline biosynthesis in plants. Proc. Natl. Acad. Sci. USA 1992, 89, 9354–9358. [Google Scholar] [CrossRef] [Green Version]
- Meena, M.; Divyanshu, K.; Kumar, S.; Swapnil, P.; Zehra, A.; Shukla, V.; Yadav, M.; Upadhyay, R.S. Regulation of L-proline biosynthesis, signal transduction, transport, accumulation and its vital role in plants during variable environmental conditions. Heliyon 2019, 5, e02952. [Google Scholar] [CrossRef] [Green Version]
- Vendruscolo, E.C.G.; Schuster, I.; Pileggi, M.; Scapim, C.A.; Molinari, H.B.C.; Marur, C.J.; Vieira, L.G.E. Stress-induced synthesis of proline confers tolerance to water deficit in transgenic wheat. J. Plant Physiol. 2007, 164, 1367–1376. [Google Scholar] [CrossRef]
- Abedini, R.; GhaneGolmohammadi, F.; PishkamRad, R.; Pourabed, E.; Jafarnezhad, A.; Shobbar, Z.S.; Shahbazi, M. Plant dehydrins: Shedding light on structure and expression patterns of dehydrin gene family in barley. J. Plant Res. 2017, 130, 747–763. [Google Scholar] [CrossRef]
- Hu, L.; Wang, Z.; Du, H.; Huang, B. Differential accumulation of dehydrins in response to water stress for hybrid and common bermudagrass genotypes differing in drought tolerance. J. Plant Physiol. 2010, 167, 103–109. [Google Scholar] [CrossRef]
- Saibi, W.; Feki, K.; Ben Mahmoud, R.; Brini, F. Durum wheat dehydrin (DHN-5) confers salinity tolerance to transgenic Arabidopsis plants through the regulation of proline metabolism and ROS scavenging system. Planta 2015, 242, 1187–1194. [Google Scholar] [CrossRef]
- Brini, F.; Hanin, M.; Lumbreras, V.; Amara, I.; Khoudi, H.; Hassairi, A.; Pages, M.; Masmoudi, K. Overexpression of wheat dehydrin DHN-5 enhances tolerance to salt and osmotic stress in Arab. thaliana. Plant Cell Rep. 2007, 26, 2017–2026. [Google Scholar] [CrossRef]
- Brini, F.; Yamamoto, A.; Jlaiel, L.; Takeda, S.; Hobo, T.; Dinh, H.Q.; Hattori, T.; Masmoudi, K.; Hanin, M. Pleiotropic effects of the wheat dehydrin DHN-5 on stress responses in Arabidopsis. Plant Cell Physiol. 2011, 52, 676–688. [Google Scholar] [CrossRef] [Green Version]
- Yamaguchi-Shinozaki, K.; Shinozaki, K. Transcriptional regulatory networks in cellular responses and tolerance to dehydration and cold stresses. Annu. Rev. Plant Biol. 2006, 57, 781–803. [Google Scholar] [CrossRef] [Green Version]
- Wang, H.; Wang, H.; Shao, H.; Tang, X. Recent advances in utilizing transcription factors to improve plant abiotic stress tolerance by transgenic technology. Front. Plant Sci. 2016, 7, 67. [Google Scholar] [CrossRef] [Green Version]
- Javed, T.; Shabbir, R.; Ali, A.; Afzal, I.; Zaheer, U.; Gao, S.J. Transcription factors in plant stress responses: Challenges and potential for sugarcane improvement. Plants 2020, 9, 491. [Google Scholar] [CrossRef]
- Chen, X.; Li, C.; Wang, H.; Guo, Z. WRKY transcription factors: Evolution, binding, and action. Phytopathol. Res. 2019, 1, 13. [Google Scholar] [CrossRef]
- Chen, F.; Hu, Y.; Vannozzi, A.; Wu, K.; Cai, H.; Qin, Y.; Mullis, A.; Lin, Z.; Zhang, L. The WRKY Transcription factor family in model plants and crops. Crit. Rev. Plant Sci. 2018, 36, 311–335. [Google Scholar] [CrossRef]
- Sharoni, A.M.; Nuruzzaman, M.; Satoh, K.; Shimizu, T.; Kondoh, H.; Sasaya, T.; Choi, I.-R.; Omura, T.; Kikuchi, S. Gene structures, classification and expression models of the AP2/EREBP transcription factor family in rice. Plant Cell Physiol. 2011, 52, 344–360. [Google Scholar] [CrossRef]
- Riechmann, J.L.; Meyerowitz, E.M. The AP2/EREBP family of plant transcription factors. Biol. Chem. 1998, 379, 633–646. [Google Scholar] [CrossRef]
- Shen, Y.G.; Zhang, W.K.; He, S.J.; Zhang, J.S.; Liu, Q.; Chen, S.Y. An EREBP/AP2-type protein in Triticum aestivum was a DRE-binding transcription factor induced by cold, dehydration and ABA stress. Theor. Appl. Genet. 2003, 106, 923–930. [Google Scholar] [CrossRef]
- Kurahashi, Y.; Terashima, A.; Takumi, S. Variation in dehydration tolerance, ABA sensitivity and related gene expression patterns in D-genome progenitor and synthetic hexaploid wheat lines. Int. J. Mol. Sci. 2009, 10, 2733–2751. [Google Scholar] [CrossRef] [Green Version]
- Zotova, L.; Kurishbayev, A.; Jatayev, S.; Khassanova, G.; Zhubatkanov, A.; Serikbay, D.; Sereda, S.; Sereda, T.; Shvidchenko, V.; Lopato, S.; et al. Genes encoding transcription factors TaDREB5 and TaNFYC-A7 are differentially expressed in leaves of bread wheat in response to drought, dehydration and ABA. Front. Plant Sci. 2018, 9, 1441. [Google Scholar] [CrossRef]
- Liu, M.; Wang, Z.; Xiao, H.M.; Yang, Y. Characterization of TaDREB1 in wheat genotypes with different seed germination under osmotic stress. Hereditas 2018, 155, 26. [Google Scholar] [CrossRef]
- Qin, Y.; Tian, Y.; Liu, X. A wheat salinity-induced WRKY transcription factor TaWRKY93 confers multiple abiotic stress tolerance in Arabidopsis thaliana. Biochem. Biophys. Res. Commun. 2015, 464, 428–433. [Google Scholar] [CrossRef]
- Niu, X.; Luo, T.; Zhao, H.; Su, Y.; Ji, W.; Li, H. Identification of wheat DREB genes and functional characterization of TaDREB3 in response to abiotic stresses. Gene 2020, 740, 144514. [Google Scholar] [CrossRef]
- Gao, H.; Wang, Y.; Xu, P.; Zhang, Z. Overexpression of a WRKY transcription factor TaWRKY2 enhances drought stress tolerance in transgenic wheat. Front. Plant Sci. 2018, 9, 997. [Google Scholar] [CrossRef] [Green Version]
- Wang, C.; Deng, P.; Chen, L.; Wang, X.; Ma, H.; Hu, W.; Yao, N.; Feng, Y.; Chai, R.; Yang, G.; et al. A Wheat WRKY transcription factor TaWRKY10 confers tolerance to multiple abiotic stresses in transgenic tobacco. PLoS ONE 2013, 8, e65120. [Google Scholar] [CrossRef] [PubMed]
- Niu, C.F.; Wei, W.; Zhou, Q.Y.; Tian, A.G.; Hao, Y.J.; Zhang, W.K.; Ma, B.; Lin, Q.; Zhang, Z.B.; Zhang, J.S.; et al. Wheat WRKY genes TaWRKY2 and TaWRKY19 regulate abiotic stress tolerance in transgenic Arabidopsis plants. Plant Cell Environ. 2012, 35, 1156–1170. [Google Scholar] [CrossRef] [PubMed]
- Barrs, H. Determination of water deficits in plant tissue. In Water Deficits and Plant Growth; Kozlowski, T., Ed.; Academic Press: Cambridge, MA, USA, 1968; Volume 1, pp. 235–368. [Google Scholar]
- Carillo, P.; Gibon, Y. PROTOCOL Extraction and Determination of Proline. 2011. Available online: https://www.researchgate.net/publication/211353600_PROTOCOL_Extraction_and_determination_of_proline (accessed on 3 March 2022).
- Verma, S.; Dubey, R.S. Lead toxicity induces lipid peroxidation and alters the activities of antioxidant enzymes in growing rice plants. Plant Sci. 2003, 164, 645–655. [Google Scholar] [CrossRef]
- Griffith, O.W. Determination of glutathione and glutathione disulfide using glutathione reductase and 2-vinylpyridine. Anal. Biochem. 1980, 106, 207–212. [Google Scholar] [CrossRef]
- Aebi, H. Catalase in vitro. In Methods in Enzymology; Academic Press: Cambridge, MA, USA, 1984; Volume 105, pp. 121–126. [Google Scholar]
- Habig, W.H.; Pabst, M.J.; Jakoby, W.B. Glutathione S-Transferases: The first enzymatic step in mercapturic acid formation. J. Biol. Chem. 1974, 249, 7130–7139. [Google Scholar] [CrossRef]
- Nakano, Y.; Asada, K. Hydrogen Peroxide is scavenged by ascorbate-specific peroxidase in spinach chloroplasts. Plant Cell Physiol. 1981, 22, 867–880. [Google Scholar] [CrossRef]
- Racker, E. Glutathione reductase from bakers’ yeast and beef liver. J. Biol. Chem. 1955, 217, 855–865. [Google Scholar] [CrossRef]
- Ma, F.; Cheng, L. Exposure of the shaded side of apple fruit to full sun leads to up-regulation of both the xanthophyll cycle and the ascorbate–glutathione cycle. Plant Sci. 2004, 166, 1479–1486. [Google Scholar] [CrossRef]
- Murshed, R.; Lopez-Lauri, F.; Sallanon, H. Microplate quantification of enzymes of the plant ascorbate–glutathione cycle. Anal. Biochem. 2008, 383, 320–322. [Google Scholar] [CrossRef]
- Hossain, M.A.; Nakano, Y.; Asada, K. Monodehydroascorbate reductase in spinach chloroplasts and its participation in regeneration of ascorbate for scavenging hydrogen peroxide. Plant Cell Physiol. 1984, 25, 385–395. [Google Scholar] [CrossRef]
- Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
- Paolacci, A.R.; Tanzarella, O.A.; Porceddu, E.; Ciaffi, M. Identification and validation of reference genes for quantitative RT-PCR normalization in wheat. BMC Mol. Biol. 2009, 10, 11. [Google Scholar] [CrossRef] [Green Version]
- Ahmad, A.; Aslam, Z.; Javed, T.; Hussain, S.; Raza, A.; Shabbir, R.; Mora-Poblete, F.; Saeed, T.; Zulfiqar, F.; Ali, M.M.; et al. Screening of Wheat (Triticum aestivum L.) Genotypes for drought tolerance through agronomic and physiological response. Agronomy 2022, 12, 287. [Google Scholar] [CrossRef]
- Baloch, M.J.; Dunwell, J.; Khan, N.U.; Jatoi, W.A.; Khakhwani, A.A.; Vessar, N.F.; Gul, S. Morpho-physiological characterization of spring wheat genotypes under drought stress. Int. J. Agric. Biol. 2013, 15, 945–950. [Google Scholar]
- Ali, M.A.; Abbas, A.; Niaz, S.; Zulkiffal, M.; Ali, S. Morpho-physiological criteria for drought tolerance in sorghum (Sorghum bicolor) at seedling and post-anthesis stages. Int. J. Agric. Biol. 2009, 11, 674–680. [Google Scholar]
- Chowdhury, M.K.; Hasan, M.A.; Bahadur, M.M.; Islam, M.R.; Hakim, M.A.; Iqbal, M.A.; Javed, T.; Raza, A.; Shabbir, R.; Sorour, S.; et al. Evaluation of drought tolerance of some wheat (Triticum aestivum L.) genotypes through phenology, growth, and physiological indices. Agronomy 2021, 11, 1792. [Google Scholar] [CrossRef]
- Albuquerque, M.C.; Carvalho, N.M. Effect of the type of environmental stress on the emergence of sunflower (Helianthus annus L.), soybean (Glycine max (L.) Merril) and maize (Zea mays L.) seeds with different levels of vigor. Seed Sci. Technol. 2003, 31, 465–479. [Google Scholar] [CrossRef]
- Yadav, P.V.; Kumari, M.; Ahmed, Z. Seed priming mediated germination improvement and tolerance to subsequent exposure to cold and salt stress in Capsicum. Res. J. Seed Sci. 2011, 4, 125–136. [Google Scholar] [CrossRef] [Green Version]
- Bateman, A.; Lewandrowski, W.; Stevens, J.; Muñoz-Rojas, M. The limitations of seedling growth and drought tolerance to novel soil substrates in arid systems: Implications for restoration success. In Proceedings of the EGU General Assembly, Vienna, Austria, 17–22 April 2016; p. 1722. [Google Scholar]
- Datta, J.K.; Mondal, T.; Banerjee, A.; Mondal, N.K. Assessment of drought tolerance of selected wheat cultivars under laboratory condition. J. Agric. Sci. Technol. 2011, 7, 383–393. [Google Scholar]
- Schonfeld, M.A.; Johnson, R.C.; Carver, B.F.; Mornhinweg, D.W. Water Relations in Winter Wheat as Drought Resistance Indicators. Crop. Sci. 1988, 28, 526–531. [Google Scholar] [CrossRef]
- Bayoumi, T.Y.; Eid, M.H.; Metwali, E.M. Application of physiological and biochemical indices as a screening technique for drought tolerance in wheat genotypes. Afr. J. Biotechnol. 2008, 7, 2341–2352. [Google Scholar]
- Fang, Y.; Du, Y.; Wang, J.; Wu, A.; Qiao, S.; Xu, B.; Zhang, S.; Siddique, K.H.M.; Chen, Y. Moderate drought stress affected root growth and grain yield in old, modern and newly released cultivars of winter wheat. Front. Plant Sci. 2017, 8, 672. [Google Scholar] [CrossRef] [Green Version]
- Socias, X.; Correia, M.J.; Chaves, M.; Medrano, H. The role of abscisic acid and water relations in drought responses of subterranean clover. J. Exp. Bot. 1997, 48, 1281–1288. [Google Scholar] [CrossRef] [Green Version]
- Farooq, M.; Wahid, A.; Kobayashi, N.; Fujita, D.; Basra, S.M.A. Plant drought stress: Effects, mechanisms and management. Agron. Sustain. Dev. 2009, 29, 185–212. [Google Scholar] [CrossRef] [Green Version]
- Li, W.; Herrera-Estrella, L.; Tran, L.-S.P. The Yin–Yang of cytokinin homeostasis and drought acclimation/adaptation. Trends Plant Sci. 2016, 21, 548–550. [Google Scholar] [CrossRef] [PubMed]
- Werner, T.; Nehnevajova, E.; Köllmer, I.; Novák, O.; Stmad, M.; Krämer, U.; Schmülling, T. Root-specific reduction of cytokinin causes enhanced root growth, drought tolerance, and leaf mineral enrichment in Arabidopsis and tobacco. Plant Cell 2010, 22, 3905–3920. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Poorter, H.; Niklas, K.J.; Reich, P.B.; Oleksyn, J.; Poot, P.; Mommer, L. Biomass allocation to leaves, stems and roots: Meta-analyses of interspecific variation and environmental control. New Phytol. 2012, 193, 30–50. [Google Scholar] [CrossRef] [PubMed]
- Liu, D.; Yang, W.; Zhao, X. Studies on watermelon drought tolerance identification indices and method in gravel-mulched land of northwest China. China Veg. 2008, 7, 17–21. [Google Scholar]
- Arai-Sanoh, Y.; Takai, T.; Yoshinaga, S.; Nakano, H.; Kojima, M.; Sakakibara, H.; Kondo, M.; Uga, Y. Deep rooting conferred by DEEPER ROOTING 1 enhances rice yield in paddy fields. Sci. Rep. 2014, 4, 5563. [Google Scholar] [CrossRef] [Green Version]
- Dello Ioio, R.; Linhares, F.S.; Scacchi, E.; Casamitjana-Martinez, E.; Heidstra, R.; Costantino, P.; Sabatini, S. Cytokinins determine Arabidopsis root-meristem size by controlling cell differentiation. Curr. Biol. 2007, 17, 678–682. [Google Scholar] [CrossRef] [Green Version]
- Werner, T.; Holst, K.; Pörs, Y.; Guivarc’h, A.; Mustroph, A.; Chriqui, D.; Grimm, B.; Schmülling, T. Cytokinin deficiency causes distinct changes of sink and source parameters in tobacco shoots and roots. J. Exp. Bot. 2008, 59, 2659–2672. [Google Scholar] [CrossRef] [Green Version]
- Pandey, H.C.; Bhatt, R.; Chandra, A.; Bhatt, R. Drought stress induced changes in lipid peroxidation and antioxidant system in genus Avena. J. Environ. Biol. 2010, 31, 435–440. [Google Scholar]
- Chakraborty, U.; Pradhan, B. Drought stress-induced oxidative stress and antioxidative responses in four wheat (Triticum aestivum L.) varieties. Arch. Agron. Soil Sci. 2012, 58, 617–630. [Google Scholar] [CrossRef]
- Sachdev, S.; Ansari, S.A.; Ansari, M.I.; Fujita, M.; Hasanuzzaman, M. Abiotic stress and reactive oxygen species: Generation, signaling, and defense mechanisms. Antioxidants 2021, 10, 277. [Google Scholar] [CrossRef]
- Al-Sammarraie, O.N.; Alsharafa, K.Y.; Al-limoun, M.O.; Khleifat, K.M.; Al-Sarayreh, S.A.; Al-Shuneigat, J.M.; Kalaji, H.M. Effect of various abiotic stressors on some biochemical indices of Lepidium sativum plants. Sci. Rep. 2020, 10, 21131. [Google Scholar] [CrossRef]
- Abid, M.; Ali, S.; Qi, L.K.; Zahoor, R.; Tian, Z.; Jiang, D.; Snider, J.L.; Dai, T. Physiological and biochemical changes during drought and recovery periods at tillering and jointing stages in wheat (Triticum aestivum L.). Sci. Rep. 2018, 8, 4615. [Google Scholar] [CrossRef]
- Arora, A.; Sairam, R.K.; Srivastava, G. Oxidative stress and antioxidative system in plants. Curr. Sci. 2001, 82, 1227–1238. [Google Scholar]
- Mittler, R. Oxidative stress, antioxidants and stress tolerance. Trends Plant Sci. 2002, 7, 405–410. [Google Scholar] [CrossRef]
- Dumanović, J.; Nepovimova, E.; Natić, M.; Kuča, K.; Jaćević, V. The significance of reactive oxygen species and antioxidant defense system in plants: A concise overview. Front. Plant Sci. 2021, 11, 2969. [Google Scholar] [CrossRef]
- Herbinger, K.; Tausz, M.; Wonisch, A.; Soja, G.; Sorger, A.; Grill, D. Complex interactive effects of drought and ozone stress on the antioxidant defence systems of two wheat cultivars. Plant Physiol. Biochem. 2002, 40, 691–696. [Google Scholar] [CrossRef]
- Štolfa, I.; Špoljarić Maronić, D.; Žuna Pfeiffer, T.; Lončarić, Z. Glutathione and related enzymes in response to abiotic stress. In Redox State as a Central Regulator of Plant-Cell Stress Responses; Gupta, D.K., Palma, J.M., Corpas, F.J., Eds.; Springer International Publishing: Berlin/Heidelberg, Germany, 2016; pp. 183–211. [Google Scholar]
- Gietler, M.; Nykiel, M.; Zagdańska, B.M. Changes in the reduction state of ascorbate and glutathione, protein oxidation and hydrolysis leading to the development of dehydration intolerance in Triticum aestivum L. seedlings. Plant Growth Regul. 2016, 79, 287–297. [Google Scholar] [CrossRef] [Green Version]
- Gill, S.; Anjum, N.; Hasanuzzaman, M.; Gill, R.; Trivedi, D.; Ahmad, I.; Pereira, E.; Tuteja, N. Glutathione and glutathione reductase: A boon in disguise for plant abiotic stress defense operations. Plant Physiol. Biochem. 2013, 70, 204–212. [Google Scholar] [CrossRef]
- Lascano, H.; Antonicelli, G.; Luna, C.; Melchiorre, M.; Gómez, L.; Racca, R.; Trippi, V.; Casano, L. Antioxidant system response of different wheat cultivars under drought: Field and in vitro studies. Funct. Plant Biol. 2001, 28, 1095–1102. [Google Scholar] [CrossRef]
- Tambussi, E.A.; Casadesús, J.; Munné-Bosch, S.; Araus, J. Photoprotection in water-stressed plants of durum wheat (Triticum turgidum var. durum): Changes in chlorophyll fluorescence, spectral signature and photosynthetic pigments. Funct. Plant Biol. 2002, 29, 35–44. [Google Scholar] [CrossRef]
- Marrs, K.A. The functions and regulation of glutathione s-transferases in plants. Annu. Rev. Plant Physiol. Plant Mol. Biol. 1996, 47, 127–158. [Google Scholar] [CrossRef] [PubMed]
- Dixon, D.P.; Davis, B.G.; Edwards, R. Functional divergence in the glutathione transferase superfamily in plants. Identification of two classes with putative functions in redox homeostasis in Arabidopsis thaliana. J. Biol. Chem. 2002, 277, 30859–30869. [Google Scholar] [CrossRef] [Green Version]
- Galle, A.; Csiszár, J.; Szécsényi, M.; Erdei, L.; Benyó, D.; Györgyey, J.; Tari, I. Induction and regulation of glutathione transferases in wheat species exposed to PEG induced osmotic stress. Acta Biol. Szeged 2011, 55, 79–80. [Google Scholar]
- Xu, J.; Xing, X.-J.; Tian, Y.-S.; Peng, R.-H.; Xue, Y.; Zhao, W.; Yao, Q.-H. Transgenic Arabidopsis plants expressing tomato glutathione S-transferase showed enhanced resistance to salt and drought stress. PLoS ONE 2015, 10, e0136960. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.-H.; Jiang, H.-W.; Hsieh, E.-J.; Chen, H.-Y.; Chien, C.-T.; Hsieh, H.-L.; Lin, T.-P. Drought and salt stress tolerance of an Arabidopsis glutathione S-transferase U17 knockout mutant are attributed to the combined effect of glutathione and abscisic acid. Plant Physiol. 2012, 158, 340–351. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gill, S.S.; Tuteja, N. Reactive oxygen species and antioxidant machinery in abiotic stress tolerance in crop plants. Plant Physiol. Biochem. 2010, 48, 909–930. [Google Scholar] [CrossRef] [PubMed]
- Mehrabad Pour-Benab, S.; Fabriki-Ourang, S.; Mehrabi, A.-A. Expression of dehydrin and antioxidant genes and enzymatic antioxidant defense under drought stress in wild relatives of wheat. Biotechnol. Biotechnol. Equip. 2019, 33, 1063–1073. [Google Scholar] [CrossRef] [Green Version]
- Bhaskara, G.B.; Yang, T.H.; Verslues, P.E. Dynamic proline metabolism: Importance and regulation in water limited environments. Front. Plant Sci. 2015, 6, 484. [Google Scholar] [CrossRef] [Green Version]
- Ashraf, M.; Foolad, M.R. Roles of glycine betaine and proline in improving plant abiotic stress resistance. Environ. Exp. Bot. 2007, 59, 206–216. [Google Scholar] [CrossRef]
- Saeedipour, S. Relationship of grain yield, ABA and proline accumulation in tolerant and sensitive wheat cultivars as affected by water stress. Proc. Natl. Acad. Sci. USA 2013, 83, 311–315. [Google Scholar] [CrossRef]
- Ma, L.; Zhou, E.; Gao, L.; Mao, X.; Zhou, R.; Jia, J. Isolation, expression analysis and chromosomal location of P5CR gene in common wheat (Triticum aestivum L.). S. Afr. J. Bot. 2008, 74, 705–712. [Google Scholar] [CrossRef] [Green Version]
- Hien, D.T.; Jacobs, M.; Angenon, G.; Hermans, C.; Thu, T.T.; Son, L.V.; Roosens, N.H. Proline accumulation and Δ1-pyrroline-5-carboxylate synthetase gene properties in three rice cultivars differing in salinity and drought tolerance. Plant Sci. 2003, 165, 1059–1068. [Google Scholar] [CrossRef]
- Sharma, S.; Villamor, J.G.; Verslues, P.E. Essential role of tissue-specific proline synthesis and catabolism in growth and redox balance at low water potential. Plant Physiol. 2011, 157, 292–304. [Google Scholar] [CrossRef] [Green Version]
- Tateishi, Y.; Nakagawa, T.; Esaka, M. Osmotolerance and growth stimulation of transgenic tobacco cells accumulating free proline by silencing proline dehydrogenase expression with double-stranded RNA interference technique. Physiol. Plant. 2005, 125, 224–234. [Google Scholar] [CrossRef]
- Brini, F.; Hanin, M.; Lumbreras, V.; Irar, S.; Pagès, M.; Masmoudi, K. Functional characterization of DHN-5, a dehydrin showing a differential phosphorylation pattern in two Tunisian durum wheat (Triticum durum Desf.) varieties with marked differences in salt and drought tolerance. Plant Sci. 2007, 172, 20–28. [Google Scholar] [CrossRef]
- Wang, Y.; Xu, H.; Zhu, H.; Tao, Y.; Zhang, G.; Zhang, L.; Zhang, C.; Zhang, Z.; Ma, Z. Classification and expression diversification of wheat dehydrin genes. Plant Sci. 2014, 214, 113–120. [Google Scholar] [CrossRef]
- Zhu, W.; Zhang, L.; Lv, H.; Zhang, H.; Zhang, D.; Wang, X.; Chen, J. The dehydrin wzy2 promoter from wheat defines its contribution to stress tolerance. Funct. Integr. Genom. 2014, 14, 111–125. [Google Scholar] [CrossRef] [PubMed]
- Zhu, W.; Zhang, L.; Zhang, N.; Xing, Y.; Jiang, B. The clone of wheat dehydrin-like gene wzy2 and its functional analysis in Pichia pastoris. Afr. J. Biotechnol. 2012, 11, 9549–9558. [Google Scholar] [CrossRef]
- Huang, F.; Zhang, L.; Wang, L.; Jiang, B.; Wen, J. Cloning and sequence analysis of a new dehydrin gene (WZY2) from wheat. J. Northwest A F Univ. Nat. Sci. Ed. 2009, 37, 93–99. [Google Scholar]
- Liu, H.; Yang, Y.; Liu, D.; Wang, X.; Zhang, L. Transcription factor TabHLH49 positively regulates dehydrin WZY2 gene expression and enhances drought stress tolerance in wheat. BMC Plant Biol. 2020, 20, 259. [Google Scholar] [CrossRef] [PubMed]
- Liu, H.; Yang, Y.; Zhang, L. Identification of upstream transcription factors and an interacting PP2C protein of dehydrin WZY2 gene in wheat. Plant Signal. Behav. 2019, 14, 1678370. [Google Scholar] [CrossRef] [PubMed]
- Yu, Z.; Wang, X.; Mu, X.; Zhang, L. RNAi mediated silencing of dehydrin gene WZY2 confers osmotic stress intolerance in transgenic wheat. Funct. Plant Biol. 2019, 46, 877–884. [Google Scholar] [CrossRef] [PubMed]
- Yousfi, S.; Márquez, A.J.; Betti, M.; Araus, J.L.; Serret, M.D. Gene expression and physiological responses to salinity and water stress of contrasting durum wheat genotypes. J. Integr. Plant Biol. 2016, 58, 48–66. [Google Scholar] [CrossRef]
- Pellegrineschi, A.; Reynolds, M.; Pacheco, M.; Brito, R.M.; Almeraya, R.; Yamaguchi-Shinozaki, K.; Hoisington, D. Stress-induced expression in wheat of the Arabidopsis thaliana DREB1A gene delays water stress symptoms under greenhouse conditions. Genome 2004, 47, 493–500. [Google Scholar] [CrossRef]
- Noor, S.; Ali, S.; Rahman, H.-u.; Farhatullah, F.; Ali, G.M. Comparative study of transgenic (DREB1A) and non-transgenic wheat lines on relative water content, sugar, proline and chlorophyll under drought and salt stresses. Sarhad J. Agric. 2018, 34, 986–993. [Google Scholar] [CrossRef]
- Hu, Z.; Wang, R.; Zheng, M.; Liu, X.; Meng, F.; Wu, H.; Yao, Y.; Xin, M.; Peng, H.; Ni, Z.; et al. TaWRKY51 promotes lateral root formation through negative regulation of ethylene biosynthesis in wheat (Triticum aestivum L.). Plant J. 2018, 96, 372–388. [Google Scholar] [CrossRef] [Green Version]
Target Gene | GenBank Accession No. | Product Length (bp) | Forward Primer | Revers Primer |
---|---|---|---|---|
DHN5 | AY619566 | 99 | agaagaagggcatcatggac | ggcacctccactctcagaag |
WZY2 | KF112871 | 142 | tcgttcgtcgtggtagtctg | atgaccttgctgtccgtagg |
P5CS | KT868850 | 85 | ccggtgaatggcagagtaat | ccccacggagaactttaaca |
WRKY2 | EU665425 | 131 | ctttggcttctcctttcacg | tgctgctcttgttgctcact |
DREB1 | DQ195070 | 80 | gttggtacccaacccaagtg | aacagaacgaagcagggcta |
actin [67] | AK457930 | 215 | tgaccgtatgagcaaggag | ccagacaactcgcaacttag |
ADP-ribosylati factor [67] | XM_044502292 | 165 | gctctccaacaacattgccaac | gcttctgcctgtcacatacgc |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Vuković, R.; Čamagajevac, I.Š.; Vuković, A.; Šunić, K.; Begović, L.; Mlinarić, S.; Sekulić, R.; Sabo, N.; Španić, V. Physiological, Biochemical and Molecular Response of Different Winter Wheat Varieties under Drought Stress at Germination and Seedling Growth Stage. Antioxidants 2022, 11, 693. https://0-doi-org.brum.beds.ac.uk/10.3390/antiox11040693
Vuković R, Čamagajevac IŠ, Vuković A, Šunić K, Begović L, Mlinarić S, Sekulić R, Sabo N, Španić V. Physiological, Biochemical and Molecular Response of Different Winter Wheat Varieties under Drought Stress at Germination and Seedling Growth Stage. Antioxidants. 2022; 11(4):693. https://0-doi-org.brum.beds.ac.uk/10.3390/antiox11040693
Chicago/Turabian StyleVuković, Rosemary, Ivna Štolfa Čamagajevac, Ana Vuković, Katarina Šunić, Lidija Begović, Selma Mlinarić, Ramona Sekulić, Nikolina Sabo, and Valentina Španić. 2022. "Physiological, Biochemical and Molecular Response of Different Winter Wheat Varieties under Drought Stress at Germination and Seedling Growth Stage" Antioxidants 11, no. 4: 693. https://0-doi-org.brum.beds.ac.uk/10.3390/antiox11040693