Baicalin-Induced Autophagy Preserved LPS-Stimulated Intestinal Cells from Inflammation and Alterations of Paracellular Permeability
Abstract
:1. Introduction
2. Results
2.1. Cell Viability
2.2. Gene Expression and Release of Cytokines
2.3. Gene Expression of Autophagy-Related Genes
2.4. Inhibition of LPS-Induced NF-κB Activation
2.5. Expression of TJ Protein Claudin 1
3. Discussion
4. Materials and Methods
4.1. Materials
4.2. Cell Culture and Ttreatment
4.3. Cell Viability Assay
4.4. Real-Time PCR
4.5. Evaluation of Cytokine Secretion by ELISA
4.6. Colorimetric NF-κB Assay
4.7. Western Blot
4.8. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Okumura, R.; Takeda, K. Roles of intestinal epithelial cells in the maintenance of gut homeostasis. Exp. Mol. Med. 2017, 49, e338. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Elshaer, D.; Begun, J. The role of barrier function, autophagy, and cytokines in maintaining intestinal homeostasis. Semin. Cell Dev. Biol. 2017, 61, 51–59. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Iida, T.; Onodera, K.; Nakase, H. Role of autophagy in the pathogenesis of inflammatory bowel disease. World J. Gastroenterol. 2017, 23, 1944–1953. [Google Scholar] [CrossRef]
- Randall-Demllo, S.; Chieppa, M.; Eri, R. Intestinal epithelium and autophagy: Partners in gut homeostasis. Front. Immunol. 2013, 4, 301. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Van de Veerdonk, F.L.; Dinarello, C.A. Deficient autophagy unravels the ROS paradox in chronic granulomatous disease. Autophagy 2014, 10, 1141–1142. [Google Scholar] [CrossRef] [Green Version]
- Schwerd, T.; Pandey, S.; Yang, H.T.; Bagola, K.; Jameson, E.; Jung, J.; Lachmann, R.H.; Shah, N.; Patel, S.Y.; Booth, C.; et al. Impaired antibacterial autophagy links granulomatous intestinal inflammation in Niemann-Pick disease type C1 and XIAP deficiency with NOD2 variants in Crohn’s disease. Gut 2017, 66, 1060–1073. [Google Scholar] [CrossRef] [Green Version]
- Ke, P.; Shao, B.Z.; Xu, Z.Q.; Chen, X.W.; Liu, C. Intestinal Autophagy and Its Pharmacological Control in Inflammatory Bowel Disease. Front. Immunol. 2016, 7, 695. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Makino, T.; Hishida, A.; Goda, Y.; Mizukami, H. Comparison of the major flavonoid content of S. baicalensis, S. lateriflora, and their commercial products. J. Nat. Med. 2008, 62, 294–299. [Google Scholar] [CrossRef]
- Bochorakova, H.; Paulova, H.; Slanina, J.; Musil, P.; Taborska, E. Main flavonoids in the root of Scutellaria baicalensis cultivated in Europe and their comparative antiradical properties. Phytother. Res. 2003, 17, 640–644. [Google Scholar] [CrossRef]
- Shang, X.; He, X.; He, X.; Li, M.; Zhang, R.; Fan, P.; Zhang, Q.; Jia, Z. The genus Scutellaria an ethnopharmacological and phytochemical review. J. Ethnopharmacol. 2010, 128, 279–313. [Google Scholar] [CrossRef]
- Feng, J.; Guo, C.; Zhu, Y.; Pang, L.; Yang, Z.; Zou, Y.; Zheng, X. Baicalin down regulates the expression of TLR4 and NFkB-p65 in colon tissue in mice with colitis induced by dextran sulfate sodium. Int. J. Clin. Exp. Med. 2014, 7, 4063–4072. [Google Scholar]
- Sun, Y.; Liu, Z.; Song, S.; Zhu, B.; Zhao, L.; Jiang, J.; Liu, N.; Wang, J.; Chen, X. Anti-inflammatory activity and structural identification of a sulfated polysaccharide CLGP4 from Caulerpa lentillifera. Int. J. Biol. Macromol. 2020, 146, 931–938. [Google Scholar] [CrossRef]
- Byun, E.B.; Kim, W.S.; Sung, N.Y.; Byun, E.H. Epigallocatechin-3-Gallate Regulates Anti-Inflammatory Action Through 67-kDa Laminin Receptor-Mediated Tollip Signaling Induction in Lipopolysaccharide-Stimulated Human Intestinal Epithelial Cells. Cell. Physiol. Biochem. 2018, 46, 2072–2081. [Google Scholar] [CrossRef]
- Grootaert, C.; Kamiloglu, S.; Capanoglu, E.; Van Camp, J. Cell Systems to Investigate the Impact of Polyphenols on Cardiovascular Health. Nutrients 2015, 7, 9229–9255. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dou, J.; Wang, Z.; Ma, L.; Peng, B.; Mao, K.; Li, C.; Su, M.; Zhou, C.; Peng, G. Baicalein and baicalin inhibit colon cancer using two distinct fashions of apoptosis and senescence. Oncotarget 2018, 9, 20089–20102. [Google Scholar] [CrossRef]
- Kim, K.A.; Jung, J.H.; Choi, Y.S.; Kang, G.; Kim, S.T. Anti-inflammatory effect of wogonin on allergic responses in ovalbumin-induced allergic rhinitis in the mouse. Allergy Rhinol. (Providence) 2018, 9, 2152656718764145. [Google Scholar] [CrossRef] [Green Version]
- Xu, J.; Liu, J.; Yue, G.; Sun, M.; Li, J.; Xiu, X.; Gao, Z. Therapeutic effect of the natural compounds baicalein and baicalin on autoimmune diseases. Mol. Med. Rep. 2018, 18, 1149–1154. [Google Scholar] [CrossRef] [PubMed]
- Zhu, W.; Jin, Z.; Yu, J.; Liang, J.; Yang, Q.; Li, F.; Shi, X.; Zhu, X.; Zhang, X. Baicalin ameliorates experimental inflammatory bowel disease through polarization of macrophages to an M2 phenotype. Int. Immunopharmacol. 2016, 35, 119–126. [Google Scholar] [CrossRef] [PubMed]
- Vallabhapurapu, S.; Karin, M. Regulation and function of NF-kappaB transcription factors in the immune system. Annu. Rev. Immunol. 2009, 27, 693–733. [Google Scholar] [CrossRef] [PubMed]
- Shen, J.; Cheng, J.; Zhu, S.; Zhao, J.; Ye, Q.; Xu, Y.; Dong, H.; Zheng, X. Regulating effect of baicalin on IKK/IKB/NF-kB signaling pathway and apoptosis-related proteins in rats with ulcerative colitis. Int. Immunopharmacol. 2019, 73, 193–200. [Google Scholar] [CrossRef]
- Fu, S.; Xu, L.; Li, S.; Qiu, Y.; Liu, Y.; Wu, Z.; Ye, C.; Hou, Y.; Hu, C.A. Baicalin suppresses NLRP3 inflammasome and nuclear factor-kappa B (NF-kappaB) signaling during Haemophilus parasuis infection. Vet. Res. 2016, 47, 80. [Google Scholar] [CrossRef] [Green Version]
- Yang, W.; Li, H.; Cong, X.; Wang, X.; Jiang, Z.; Zhang, Q.; Qi, X.; Gao, S.; Cao, R.; Tian, W. Baicalin attenuates lipopolysaccharide induced inflammation and apoptosis of cow mammary epithelial cells by regulating NF-kappaB and HSP72. Int. Immunopharmacol. 2016, 40, 139–145. [Google Scholar] [CrossRef]
- Sun, M.; He, C.; Cong, Y.; Liu, Z. Regulatory immune cells in regulation of intestinal inflammatory response to microbiota. Mucosal Immunol. 2015, 8, 969–978. [Google Scholar] [CrossRef]
- Zhou, M.; Xu, W.; Wang, J.; Yan, J.; Shi, Y.; Zhang, C.; Ge, W.; Wu, J.; Du, P.; Chen, Y. Boosting mTOR-dependent autophagy via upstream TLR4-MyD88-MAPK signalling and downstream NF-kappaB pathway quenches intestinal inflammation and oxidative stress injury. EBioMedicine 2018, 35, 345–360. [Google Scholar] [CrossRef] [Green Version]
- Neurath, M.F. Cytokines in inflammatory bowel disease. Nat. Rev. Immunol. 2014, 14, 329–342. [Google Scholar] [CrossRef] [PubMed]
- Odenwald, M.A.; Turner, J.R. Intestinal permeability defects: Is it time to treat? Clin. Gastroenterol. Hepatol. 2013, 11, 1075–1083. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Haq, S.; Grondin, J.; Banskota, S.; Khan, W.I. Autophagy: Roles in intestinal mucosal homeostasis and inflammation. J. Biomed. Sci. 2019, 26, 19. [Google Scholar] [CrossRef] [Green Version]
- Garcia-Carbonell, R.; Yao, S.J.; Das, S.; Guma, M. Dysregulation of Intestinal Epithelial Cell RIPK Pathways Promotes Chronic Inflammation in the IBD Gut. Front. Immunol. 2019, 10, 1094. [Google Scholar] [CrossRef] [PubMed]
- Furuse, M. Molecular Basis of the Core Structure of Tight Junctions. Cold Spring Harb. Perspect. Biol. 2010, 2, a002907. [Google Scholar] [CrossRef] [PubMed]
- Schmitz, H.; Barmeyer, C.; Fromm, M.; Runkel, N.; Foss, H.D.; Bentzel, C.J.; Riecken, E.O.; Schulzke, J.D. Altered tight junction structure contributes to the impaired epithelial barrier function in ulcerative colitis. Gastroenterology 1999, 116, 301–309. [Google Scholar] [CrossRef]
- Weber, C.R.; Nalle, S.C.; Tretiakova, M.; Rubin, D.T.; Turner, J.R. Claudin-1 and claudin-2 expression is elevated in inflammatory bowel disease and may contribute to early neoplastic transformation. Lab. Investig. 2008, 88, 1110–1120. [Google Scholar] [CrossRef] [Green Version]
- Peng, J.; Qi, Q.; You, Q.; Hu, R.; Liu, W.; Feng, F.; Wang, G.; Guo, Q. Subchronic toxicity and plasma pharmacokinetic studies on wogonin, a natural flavonoid, in Beagle dogs. J. Ethnopharmacol. 2009, 124, 257–262. [Google Scholar] [CrossRef]
- Qi, Q.; Peng, J.; Liu, W.; You, Q.; Yang, Y.; Lu, N.; Wang, G.; Guo, Q. Toxicological studies of wogonin in experimental animals. Phytother. Res. 2009, 23, 417–422. [Google Scholar] [CrossRef]
- Cai, Y.; Ma, W.; Xiao, Y.; Wu, B.; Li, X.; Liu, F.; Qiu, J.; Zhang, G. High doses of baicalin induces kidney injury and fibrosis through regulating TGF-beta/Smad signaling pathway. Toxicol. Appl. Pharmacol. 2017, 333, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Wang, D.; Calabrese, E.J.; Lian, B.; Lin, Z.; Calabrese, V. Hormesis as a mechanistic approach to understanding herbal treatments in traditional Chinese medicine. Pharmacol. Ther. 2018, 184, 42–50. [Google Scholar] [CrossRef]
- Calabrese, V.; Cornelius, C.; Dinkova-Kostova, A.T.; Calabrese, E.J.; Mattson, M.P. Cellular stress responses, the hormesis paradigm, and vitagenes: Novel targets for therapeutic intervention in neurodegenerative disorders. Antioxid Redox Signal 2010, 13, 1763–1811. [Google Scholar] [CrossRef] [PubMed]
- Calabrese, E.J.; Mattson, M.P.; Dhawan, G.; Kapoor, R.; Calabrese, V.; Giordano, J. Hormesis: A potential strategic approach to the treatment of neurodegenerative disease. Int. Rev. Neurobiol. 2020, 155, 271–301. [Google Scholar]
- Concetta Scuto, M.; Mancuso, C.; Tomasello, B.; Laura Ontario, M.; Cavallaro, A.; Frasca, F.; Maiolino, L.; Trovato Salinaro, A.; Calabrese, E.J.; Calabrese, V. Curcumin, Hormesis and the Nervous System. Nutrients 2019, 11, 2417. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhu, D.; Wang, S.; Lawless, J.; He, J.; Zheng, Z. Dose Dependent Dual Effect of Baicalin and Herb Huang Qin Extract on Angiogenesis. PLoS ONE 2016, 11, e0167125. [Google Scholar] [CrossRef]
- Curro, M.; Trovato-Salinaro, A.; Gugliandolo, A.; Koverech, G.; Lodato, F.; Caccamo, D.; Calabrese, V.; Ientile, R. Resveratrol Protects Against Homocysteine-Induced Cell Damage Via Cell Stress Response in Neuroblastoma Cells. J. Neurosci. Res. 2015, 93, 149–156. [Google Scholar] [CrossRef]
- Curro, M.; Ferlazzo, N.; Giunta, M.L.; Montalto, A.S.; Russo, T.; Arena, S.; Impellizzeri, P.; Caccamo, D.; Romeo, C.; Ientile, R. Hypoxia-Dependent Expression of TG2 Isoforms in Neuroblastoma Cells as Consequence of Different MYCN Amplification Status. Int. J. Mol. Sci. 2020, 21, 1364. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ferlazzo, N.; Curro, M.; Giunta, M.L.; Longo, D.; Rizzo, V.; Caccamo, D.; Ientile, R. Up-regulation of HIF-1 alpha is associated with neuroprotective effects of agmatine against rotenone-induced toxicity in differentiated SH-SY5Y cells. Amino Acids 2020, 52, 171–179. [Google Scholar] [CrossRef] [PubMed]
Target | Primer Sequence 5′>3′ | |
---|---|---|
Forward | Reverse | |
TNF-α | GTGAGGAGGACGAACATC | GAGCCAGAAGAGGTTGAG |
IL-1β | GCTTATTACAGTGGCAATGA | TAGTGGTGGTCGGAGATT |
LC3 | CGGTGATAATAGAACGATACAAG | CTGAGATTGGTGTGGAGAC |
ATG5 | TGCCTGAACAGAATCATCCTT | CCAGCCCAGTTGCCTTAT |
BECN1 | ACAGTGAACAGTTACAGATGGA | CTCAGCCTGGACCTTCTC |
Claudin 1 | GTTGGGCTTCATTCTCGCCTT | CCTGGGCGGTCACGATGTTGTC |
β-actin | TTGTTACAGGAAGTCCCTTGCC | ATGCTATCACCTCCCCTGTGTG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Rizzo, V.; Ferlazzo, N.; Currò, M.; Isola, G.; Matarese, M.; Bertuccio, M.P.; Caccamo, D.; Matarese, G.; Ientile, R. Baicalin-Induced Autophagy Preserved LPS-Stimulated Intestinal Cells from Inflammation and Alterations of Paracellular Permeability. Int. J. Mol. Sci. 2021, 22, 2315. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms22052315
Rizzo V, Ferlazzo N, Currò M, Isola G, Matarese M, Bertuccio MP, Caccamo D, Matarese G, Ientile R. Baicalin-Induced Autophagy Preserved LPS-Stimulated Intestinal Cells from Inflammation and Alterations of Paracellular Permeability. International Journal of Molecular Sciences. 2021; 22(5):2315. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms22052315
Chicago/Turabian StyleRizzo, Valentina, Nadia Ferlazzo, Monica Currò, Gaetano Isola, Marco Matarese, Maria Paola Bertuccio, Daniela Caccamo, Giovanni Matarese, and Riccardo Ientile. 2021. "Baicalin-Induced Autophagy Preserved LPS-Stimulated Intestinal Cells from Inflammation and Alterations of Paracellular Permeability" International Journal of Molecular Sciences 22, no. 5: 2315. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms22052315