Side Lighting Enhances Morphophysiology by Inducing More Branching and Flowering in Chrysanthemum Grown in Controlled Environment
Abstract
:1. Introduction
2. Results
2.1. Morphological Characteristics and Growth Parameters
2.2. Leaf Anatomy
2.3. Morphology of the Epidermal Cells and Stomata
2.4. Chloroplast Distribution and Chlorophyll Content
2.5. Photosynthetic and Chlorophyll Fluorescence Characteristics
2.6. Carbohydrates and Soluble Proteins
2.7. Enzymatic Activity
2.8. Gene Expression
3. Discussion
3.1. Variations in Lighting Direction: Their Effects on Morphology and Growth Parameters of Whole Plant, Epidermal Cells, and Stomata
3.2. Variations in Lighting Direction: Their Effects on Leaf Anatomy, Chloroplast Distribution, and Chlorophyll Content
3.3. Variations in Lighting Direction: Their Effects on Photosynthesis and Primary Metabolite Yields
3.4. Variations in Lighting Direction: Their Effects on Enzymatic Activities and Gene Expression
4. Materials and Methods
4.1. Plant Growth and Treatment Design
4.2. Measurements of the Growth Parameters
4.3. Leaf Anatomical Features and Chloroplast Distribution
4.4. Epidermal Cell and Stomatal Characteristics
4.5. Photosynthesis and Chlorophyll Content
4.6. Chlorophyll Fluorescence Measurements
4.7. Contents of Carbohydrate and Soluble Protein
4.8. Enzyme Activities
4.9. Real-Time Quantitative PCR Verification
4.10. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Tian, F. Study and Optimization of Lighting Systems for Plant Growth in a Controlled Environment. Ph.D. Thesis, Université Paul Sabatier-Toulouse III, Toulouse, France, 2016. [Google Scholar]
- Mcnellis, T.W.; Deng, X.W. Light control of seedling morphogenetic pattern. Plant Cell 1995, 7, 1749–1761. [Google Scholar]
- Chen, M.; Chory, J.; Fankhauser, C. Light signal transduction in higher plants. Annu. Rev. Genet. 2004, 38, 87–117. [Google Scholar] [CrossRef] [Green Version]
- Ahmed, H.A.; Tong, Y.X.; Yang, Q.C. Optimal control of environmental conditions affecting lettuce plant growth in a controlled environment with artificial lighting: A review. S. Afr. J. Bot. 2020, 130, 75–89. [Google Scholar] [CrossRef]
- Schneider, S.C.; Pichler, D.E.; Andersen, T.; Melzer, A. Light acclimation in submerged macrophytes: The roles of plant elongation, pigmentation and branch orientation differ among Chara species. Aquat. Bot. 2015, 120, 121–128. [Google Scholar] [CrossRef] [Green Version]
- Kendrick, R.E.; Kronenberg, G.H. Photomorphogenesis in Plants, 2nd ed.; Springer Science & Business Media: Berlin, Germany, 2012. [Google Scholar]
- Casal, J.J. Shade avoidance. Arab. Book 2012, 10, e0157. [Google Scholar] [CrossRef] [Green Version]
- Kume, A.; Akitsu, T.; Nasahara, K.N. Why is chlorophyll b only used in light-harvesting systems? J. Plant Res. 2018, 131, 961–972. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ruberti, I.; Sessa, G.; Ciolfi, A.; Possenti, M.; Carabelli, M.; Morelli, G. Plant adaptation to dynamically changing environment: The shade avoidance response. Biotechnol. Adv. 2012, 30, 1047–1058. [Google Scholar] [CrossRef] [PubMed]
- Keuskamp, D.H.; Sasidharan, R.; Pierik, R. Physiological regulation and functional significance of shade avoidance responses to neighbors. Plant Signal. Behav. 2010, 5, 655–662. [Google Scholar] [CrossRef] [Green Version]
- Aphalo, P.J.; Ballare, C.L.; Scopel, A.L. Plant-plant signalling, the shade-avoidance response and competition. J. Exp. Bot. 1999, 50, 1629–1634. [Google Scholar] [CrossRef]
- Yang, F.; Fan, Y.; Wu, X.; Cheng, Y.; Liu, Q.; Feng, L.; Chen, J.; Wang, Z.; Wang, X.; Yong, T. Auxin to gibberellin ratio as a signal for light intensity and quality in regulating soybean growth and matter partitioning. Front. Plant Sci. 2018, 9, 56. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wu, Y.S.; Feng, Y.; Gong, W.Z.; Ahmed, S.; Fan, Y.F.; Wu, X.L.; Yong, T.W.; Liu, W.G.; Kai, S.; Jiang, L. Shade adaptive response and yield analysis of different soybean genotypes in relay intercropping systems. J. Integr. Agric. 2017, 16, 1331–1340. [Google Scholar] [CrossRef]
- Yang, F.; Huang, S.; Gao, R.; Liu, W.; Yong, T.; Wang, X.; Wu, X.; Yang, W. Growth of soybean seedlings in relay strip intercropping systems in relation to light quantity and red: Far-red ratio. Field Crop Res. 2014, 155, 245–253. [Google Scholar] [CrossRef]
- Yang, F.; Liao, D.; Wu, X.; Gao, R.; Fan, Y.; Raza, M.A.; Wang, X.; Yong, T.; Liu, W.; Liu, J. Effect of aboveground and belowground interactions on the intercrop yields in maize-soybean relay intercropping systems. Field Crop Res. 2017, 203, 16–23. [Google Scholar] [CrossRef]
- Kong, D.X.; Li, Y.Q.; Wang, M.L.; Bai, M.; Zou, R.; Tang, H.; Wu, H. Effects of light intensity on leaf photosynthetic characteristics, chloroplast structure, and alkaloid content of Mahonia bodinieri (Gagnep.) laferr. Acta Physiol. Plant. 2016, 38, 120. [Google Scholar] [CrossRef]
- Wu, Y.; Gong, W.; Wang, Y.; Yong, T.; Yang, F.; Liu, W.; Wu, X.; Du, J.; Shu, K.; Liu, J. Leaf area and photosynthesis of newly emerged trifoliolate leaves are regulated by mature leaves in soybean. J. Plant Res. 2018, 131, 671–680. [Google Scholar] [CrossRef]
- Yang, F.; Feng, L.; Liu, Q.; Wu, X.; Fan, Y.; Raza, M.A.; Cheng, Y.; Chen, J.; Wang, X.; Yong, T. Effect of interactions between light intensity and red to far-red ratio on the photosynthesis of soybean leaves under shade condition. Environ. Exp. Bot. 2018, 150, 79–87. [Google Scholar] [CrossRef]
- Liscum, E.; Askinosie, S.K.; Leuchtman, D.L.; Morrow, J.; Willenburg, K.T.; Coats, D.R. Phototropism: Growing towards an understanding of plant movement. Plant Cell 2014, 26, 38–55. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hangarter, R.P. Gravity, light and plant form. Plant Cell Environ. 1997, 20, 796–800. [Google Scholar] [CrossRef] [Green Version]
- Maliakal, S.K.; McDonnell, K.; Dudley, S.A.; Schmitt, J. Effects of red to far-red ratio and plant density on biomass allocation and gas exchange in Impatiens capensis. Int. J. Plant Sci. 1999, 160, 723–733. [Google Scholar] [CrossRef]
- Smith, A.N.; Singh, S.P.; Wang, M.B.; Stoutjesdijk, P.A.; Green, A.G.; Waterhouse, P.M. Total silencing by intron-spliced hairpin RNAs. Nature 2000, 407, 319–320. [Google Scholar] [CrossRef]
- Smalle, J.; Haegman, M.; Kurepa, J.; Van Montagu, M.; Van Der Straeten, D. Ethylene can stimulate Arabidopsis hypocotyl elongation in the light. Proc. Natl. Acad. Sci. USA 1997, 94, 2756–2761. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vandenbussche, F.; Vriezen, W.H.; Smalle, J.; Laarhoven, L.J.; Harren, F.J.; Van Der Straeten, D. Ethylene and auxin control the arabidopsis response to decreased light intensity. Plant Physiol. 2003, 133, 517–527. [Google Scholar] [CrossRef] [Green Version]
- Kozuka, T.; Horiguchi, G.; Kim, G.T.; Ohgishi, M.; Sakai, T.; Tsukaya, H. The different growth responses of the Arabidopsis thaliana leaf blade and the petiole during shade avoidance are regulated by photoreceptors and sugar. Plant Cell Physiol. 2005, 46, 213–223. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Millenaar, F.F.; Van Zanten, M.; Cox, M.C.; Pierik, R.; Voesenek, L.A.; Peeters, A.J. Differential petiole growth in Arabidopsis thaliana: Photocontrol and hormonal regulation. New Phytol. 2009, 184, 141–152. [Google Scholar] [CrossRef] [PubMed]
- Pierik, R.; Cuppens, M.L.; Voesenek, L.A.; Visser, E.J. Interactions between ethylene and gibberellins in phytochrome-mediated shade avoidance responses in tobacco. Plant Physiol. 2004, 136, 2928–2936. [Google Scholar] [CrossRef] [Green Version]
- Mullen, J.L.; Weinig, C.; Hangarter, R.P. Shade avoidance and the regulation of leaf inclination in Arabidopsis. Plant Cell Environ. 2006, 29, 1099–1106. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Van Zanten, M.; Pons, T.; Janssen, J.; Voesenek, L.; Peeters, A. On the relevance and control of leaf angle. Crit. Rev. Plant Sci. 2010, 29, 300–316. [Google Scholar] [CrossRef]
- Ren, X.; Liu, Y.; Jeong, H.K.; Jeong, B.R. Supplementary light source affects the growth and development of Codonopsis lanceolata seedlings. Int. J. Mol. Sci. 2018, 19, 3074. [Google Scholar] [CrossRef] [Green Version]
- Sack, L.; Buckley, T.N. The developmental basis of stomatal density and flux. Plant Physiol. 2016, 171, 2358–2363. [Google Scholar] [CrossRef] [Green Version]
- Niresh, J.; Kirubakaran, R.; Mohana Praddeesh, M.; Gokul, V.; Gokkul, T. An optimized observer for estimating torque converter characteristics for vehicles with automatic transmission. Int. J. Eng. Technol. 2018, 7, 573–577. [Google Scholar]
- Jumrani, K.; Bhatia, V.S.; Pandey, G.P. Impact of elevated temperatures on specific leaf weight, stomatal density, photosynthesis and chlorophyll fluorescence in soybean. Photosynth. Res. 2017, 131, 333–350. [Google Scholar] [CrossRef] [PubMed]
- Kardel, F.; Wuyts, K.; Babanezhad, M.; Wuytack, T.; Potters, G.; Samson, R. Assessing urban habitat quality based on specific leaf area and stomatal characteristics of Plantago lanceolata L. Environ. Pollut. 2010, 158, 788–794. [Google Scholar] [CrossRef] [PubMed]
- Wang, M.; Wei, H.; Jeong, B.R. Lighting Direction Affects Leaf Morphology, Stomatal Characteristics, and Physiology of Head Lettuce (Lactuca sativa L.). Int. J. Mol. Sci. 2021, 22, 3157. [Google Scholar] [CrossRef] [PubMed]
- Song, J.N.; Liu, X.H.; Wang, Y.Q.; Yang, H.B. Transcriptome analysis reveals salinity responses in four Tartary buckwheat cultivars. J. Plant Biochem. Biotechnol. 2021, 30, 1–15. [Google Scholar] [CrossRef]
- Lotfi, R.; Pessarakli, M.; Gharavi, K.P.; Khoshvaghti, H. Physiological responses of Brassica napus to fulvic acid under water stress: Chlorophyll a fluorescence and antioxidant enzyme activity. Crop. J. 2015, 3, 434–439. [Google Scholar] [CrossRef] [Green Version]
- Huang, P.; Jia, D.; Yuan, Z.; Mei, S.; Ye, Y. Physiological responses of exotic weeds Gaura parviflora to drought stress. J. Northeast Agric. Univ. 2011, 42, 102–106. [Google Scholar]
- Huang, C.J.; Wei, G.; Jie, Y.C.; Xu, J.J.; Zhao, S.Y.; Wang, L.C.; Anjum, S.A. Responses of gas exchange, chlorophyll synthesis and ROS-scavenging systems to salinity stress in two ramies (Boehmeria nivea L.) cultivars. Photosynthetica 2015, 53, 455–463. [Google Scholar] [CrossRef]
- Seemann, J.R.; Sharkey, T.D. Salinity and nitrogen effects on photosynthesis, ribulose-1, 5-bisphosphate carboxylase and metabolite pool sizes in Phaseolus vulgaris L. Plant Physiol. 1986, 82, 555–560. [Google Scholar] [CrossRef] [Green Version]
- Delfine, S.; Alvino, A.; Villani, M.C.; Loreto, F. Restrictions to carbon dioxide conductance and photosynthesis in spinach leaves recovering from salt stress. Plant Physiol. 1999, 119, 1101–1106. [Google Scholar] [CrossRef] [Green Version]
- Redondo-Gómez, S.; Mateos, N.E.; Davy, A.J.; Fernández-Muñoz, F.; Castellanos, E.M.; Luque, T.; Figueroa, M.E. Growth and photosynthetic responses to salinity of the salt-marsh shrub Atriplex portulacoides. Ann. Bot 2007, 100, 555–563. [Google Scholar] [CrossRef] [Green Version]
- Kao, W.Y.; Tsai, T.T.; Shih, C.N. Photosynthetic gas exchange and chlorophyll a fluorescence of three wild soybean species in response to NaCl treatments. Photosynthetica 2003, 41, 415–419. [Google Scholar] [CrossRef]
- Ranjbarfordoei, A.; Samson, R.; Van Damme, P. Chlorophyll fluorescence performance of sweet almond [Prunus dulcis (miller) d. Webb] in response to salinity stress induced by NaCl. Photosynthetica 2006, 44, 513–522. [Google Scholar] [CrossRef]
- Stępień, P.; Kłbus, G. Water relations and photosynthesis in Cucumis sativus L. Leaves under salt stress. Biol. Plant. 2006, 50, 610–616. [Google Scholar] [CrossRef]
- Mauser, H.; King, W.A.; Gready, J.E.; Andrews, T.J. CO2 fixation by rubisco: Computational dissection of the key steps of carboxylation, hydration, and C− C bond cleavage. J. Am. Chem. Soc. 2001, 123, 10821–10829. [Google Scholar] [CrossRef] [PubMed]
- Evans, J.R.; Seemann, J.R. The allocation of protein nitrogen in the photosynthetic apparatus: Costs, consequences, and control. Photosynth. Res. 1989, 8, 183–205. [Google Scholar]
- Schreiber, U.; Bilger, W.; Neubauer, C. Chlorophyll fluorescence as a nonintrusive indicator for rapid assessment of in vivo photosynthesis. In Ecophysiology of Photosynthesis; Springer: Berlin, Germany, 1995; pp. 49–70. [Google Scholar]
- Rascher, U.; Liebig, M.; Lüttge, U. Evaluation of instant light-response curves of chlorophyll fluorescence parameters obtained with a portable chlorophyll fluorometer on site in the field. Plant Cell Environ. 2000, 23, 1397–1405. [Google Scholar] [CrossRef]
- Yao, X.; Li, C.; Li, S.; Zhu, Q.; Zhang, H.; Wang, H.; Yu, C.; Martin, S.K.S.; Xie, F. Effect of shade on leaf photosynthetic capacity, light-intercepting, electron transfer and energy distribution of soybeans. Plant Growth Regul. 2017, 83, 409–416. [Google Scholar] [CrossRef]
- Park, Y.G.; Jeong, B.R. Both the quality and positioning of the night interruption light are important for flowering and plant extension growth. J. Plant Growth Regul. 2020, 39, 583–593. [Google Scholar] [CrossRef] [Green Version]
- Park, Y.G.; Jeong, B.R. How supplementary or night-interrupting low-intensity blue light affects the flower induction in chrysanthemum, a qualitative short-day plant. Plants 2020, 9, 1694. [Google Scholar] [CrossRef]
- Kozai, T.; Kino, S.; Jeong, B.; Kinowaki, M.; Ochiai, M.; Hayashi, M.; Mori, K. A sideward lighting system using diffusive optical fibers for production of vigorous micropropagated plantlets. In International Symposium on Transplant Production Systems; Corbeekhoeve, Belgium, 1992; Volume 319, pp. 237–242. [Google Scholar]
- Van, G.K.; Kang, C.; Pierik, R. Light signaling, root development, and plasticity. Plant Physiol. 2018, 176, 1049–1060. [Google Scholar]
- Vandenbussche, F.; Pierik, R.; Millenaar, F.F.; Voesenek, L.A.; Van Der Straeten, D. Reaching out of the shade. Curr. Opin. Plant Biol. 2005, 8, 462–468. [Google Scholar] [CrossRef] [PubMed]
- Sheerin, D.J.; Hiltbrunner, A. Molecular mechanisms and ecological function of far-red light signaling. Plant Cell Environ. 2017, 40, 2509–2529. [Google Scholar] [CrossRef]
- Phillips, I. Apical dominance. Annu. Rev. Plant Physiol. 1975, 26, 341–367. [Google Scholar] [CrossRef]
- Albaum, H.G. Inhibitions due to growth hormones in fern prothallia and sporophytes. Am. J. Bot. 1938, 25, 124–133. [Google Scholar] [CrossRef]
- Avery Jr, G.S.; Burkholder, P.R.; Creighton, H.B. Nutrient deficiencies and growth hormone concentration in helianthus and nicotiana. Am. J. Bot. 1937, 24, 553–557. [Google Scholar] [CrossRef]
- Snow, R. A hormone for correlative inhibition. New Phytol. 1940, 39, 177–184. [Google Scholar] [CrossRef]
- Otiende, M.A.; Fricke, K.; Nyabundi, J.O.; Ngamau, K.; Hajirezaei, M.R.; Druege, U. Involvement of the auxin–cytokinin homeostasis in adventitious root formation of rose cuttings as affected by their nodal position in the stock plant. Planta 2021, 254, 1–17. [Google Scholar] [CrossRef] [PubMed]
- Sun, D.; Zhang, L.; Yu, Q.; Zhang, J.; Li, P.; Zhang, Y.; Xing, X.; Ding, L.; Fang, W.; Chen, F. Integrated signals of jasmonates, sugars, cytokinins and auxin influence the initial growth of the second buds of chrysanthemum after decapitation. Biology 2021, 10, 440. [Google Scholar] [CrossRef]
- Neogy, A.; Singh, Z.; Mushahary, K.K.K.; Yadav, S.R. Dynamic cytokinin signaling and function of auxin in cytokinin responsive domains during rice crown root development. Plant Cell Rep. 2021, 40, 1367–1375. [Google Scholar] [CrossRef]
- Ma, C.F.; Dai, S.L. Advances in photoreceptor-mediated signaling transduction in flowering time regulation. Chin. Bull. Bot. 2019, 54, 9. [Google Scholar]
- Blümel, M.; Dally, N.; Jung, C. Flowering time regulation in crops—What did we learn from Arabidopsis? Curr. Opin. Biotech. 2015, 32, 121–129. [Google Scholar] [CrossRef] [PubMed]
- Samach, A.; Onouchi, H.; Gold, S.E.; Ditta, G.S.; Schwarz, S.Z.; Yanofsky, M.F.; Coupland, G. Distinct roles of CONSTANS target genes in reproductive development of Arabidopsis. Science 2000, 288, 1613–1616. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Abe, M.; Kobayashi, Y.; Yamamoto, S.; Daimon, Y.; Yamaguchi, A.; Ikeda, Y.; Ichinoki, H.; Notaguchi, M.; Goto, K.; Araki, T. FD, a bZIP protein mediating signals from the floral pathway integrator FT at the shoot apex. Science 2005, 309, 1052–1056. [Google Scholar] [CrossRef] [PubMed]
- Adeyemo, O.S.; Chavarriaga, P.; Tohme, J.; Fregene, M.; Davis, S.J.; Setter, T.L. Overexpression of Arabidopsis FLOWERING LOCUS T (FT) gene improves floral development in cassava (Manihot esculenta, Crantz). PLoS ONE 2017, 12, e0181460. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Darwin, F. Über das wachstum negativ heliotropischer wurzeln im licht und im finstern. Arb. Bot. Instit. Würzburg 1880, 2, 521–528. [Google Scholar]
- Weraduwage, S.M.; Chen, J.; Anozie, F.C.; Morales, A.; Weise, S.E.; Sharkey, T.D. The relationship between leaf area growth and biomass accumulation in Arabidopsis thaliana. Front. Plant Sci. 2015, 6, 167. [Google Scholar] [CrossRef] [Green Version]
- Marchi, S.; Tognetti, R.; Minnocci, A.; Borghi, M.; Sebastiani, L. Variation in mesophyll anatomy and photosynthetic capacity during leaf development in a deciduous mesophyte fruit tree (Prunus persica) and an evergreen sclerophyllous Mediterranean shrub (Olea europaea). Trees 2008, 22, 559–571. [Google Scholar] [CrossRef]
- Waldhoff, D.; Parolin, P. Morphology and anatomy of leaves. In Amazonian Floodplain Forests; Springer: Dordrecht, The Netherlands, 2010; pp. 179–202. [Google Scholar]
- Kalve, S.; Fotschki, J.; Beeckman, T.; Vissenberg, K.; Beemster, G.T. Three-dimensional patterns of cell division and expansion throughout the development of Arabidopsis thaliana. leaves. J. Exp. Bot. 2014, 65, 6385–6397. [Google Scholar] [CrossRef] [Green Version]
- Terashima, I.; Inoue, Y. Palisade tissue chloroplasts and spongy tissue chloroplasts in spinach: Biochemical and ultrastructural differences. Plant Cell Physiol. 1985, 26, 63–75. [Google Scholar]
- Niinemets, Ü. Research review. Components of leaf dry mass per area–thickness and density–alter leaf photosynthetic capacity in reverse directions in woody plants. New Phytol. 1999, 144, 35–47. [Google Scholar] [CrossRef]
- Sims, D.A.; Pearcy, R.W. Response of leaf anatomy and photosynthetic capacity in Alocasia macrorrhiza (Araceae) to a transfer from low to high light. Am. J. Bot. 1992, 79, 449–455. [Google Scholar] [CrossRef]
- Wittmann, C.; Aschan, G.; Pfanz, H. Leaf and twig photosynthesis of young beech (Fagus sylvatica) and aspen (Populus tremula) trees grown under different light regime. Basic Appl. Ecol. 2001, 2, 145–154. [Google Scholar] [CrossRef]
- Borsuk, A.M.; Brodersen, C.R. The spatial distribution of chlorophyll in leaves. Plant Physiol. 2019, 180, 1406–1417. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liao, J.X.; Ge, Y.; Huang, C.C.; Zhang, J.; Liu, Q.X.; Chang, J. Effects of irradiance on photosynthetic characteristics and growth of Mosla chinensis and M. scabra. Photosynthetica 2005, 43, 111–115. [Google Scholar] [CrossRef]
- Yin, Q.; Tian, T.; Kou, M.; Liu, P.; Wang, L.; Hao, Z.; Yue, M. The relationships between photosynthesis and stomatal traits on the Loess Plateau. Glob. Ecol. Conserv. 2020, 23, e01146. [Google Scholar] [CrossRef]
- Ma, J.; Zhu, Q.S.; Ma, W.B.; Tian, Y.H.; Yang, J.C.; Zhou, K.D. Studies on the photosynthetic characteristics and assimilate’s accumulation and transformation in heavy panicle type of rice. Agric. Sci. China 2003, 2, 602–608. [Google Scholar]
- Yamori, W.; Kusumi, K.; Iba, K.; Terashima, I. Increased stomatal conductance induces rapid changes to photosynthetic rate in response to naturally fluctuating light conditions in rice. Plant Cell Environ. 2020, 43, 1230–1240. [Google Scholar] [CrossRef]
- Dai, Y.; Shen, Z.; Liu, Y.; Wang, L.; Hannaway, D.; Lu, H. Effects of shade treatments on the photosynthetic capacity, chlorophyll fluorescence, and chlorophyll content of Tetrastigma hemsleyanum Diels et Gilg. Environ. Exp. Bot. 2009, 65, 177–182. [Google Scholar] [CrossRef]
- Liang, Y.; Feng, L.; Yin, C. Current status and prospect of chlorophyll fluorescence technique in the study of responses of microalgae to environmental stress. Mar. Sci. 2007, 31, 71, (Chinese Edition). [Google Scholar]
- Zhang, Y.; Liu, G.J. Effects of cesium accumulation on chlorophyll content and fluorescence of Brassica juncea L. J. Environ. Radioactiv. 2018, 195, 26–32. [Google Scholar] [CrossRef]
- Liu, Y.; Ren, X.; Jeong, B.R. Supplementary light source affects growth, metabolism, and physiology of Adenophora triphylla (Thunb.) A.DC. seedlings. Biomed Res. Int. 2019, 2019, 1–16. [Google Scholar]
- Kreft, H.; Jetz, W. Global patterns and determinants of vascular plant diversity. Proc. Natl. Acad. Sci. USA 2007, 104, 5925–5930. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fan, Y.; Chen, J.; Cheng, Y.; Ali, R.M.; Wu, X.; Wang, Z.; Liu, Q.; Rui, W.; Wang, X.; Yong, T. Effect of shading and light recovery on the growth, leaf structure, and photosynthetic performance of soybean in a maize-soybean relay-strip intercropping system. PLoS ONE 2018, 13, e0198159. [Google Scholar] [CrossRef]
- Chen, B.H.; Li, X.S.; Cao, Z.Y. A method for observing stoma by transparent gummed tape to tear epidermis from leaf. Plant Physiol. Commun. 2004, 40, 215–218. [Google Scholar]
- Kutík, J.; Holá, D.; Vičánková, A.; Šmídová, M.; Kočová, M.; Körnerová, M.; Kubínová, L. The heterogeneity of structural and functional photosynthetic characteristics of mesophyll chloroplasts in various parts of mature or senescing leaf blade of two maize (Zea mays L.) genotypes. Photosynthetica 2001, 39, 497–506. [Google Scholar] [CrossRef]
- Wang, M.; Xiao, J.; Wei, H.; Jeong, B.R. Supplementary light source affects growth and development of carnation ‘Dreambyul’ cuttings. Agronomy 2020, 10, 1217. [Google Scholar] [CrossRef]
- Sims, D.A.; Gamon, J.A. Relationships between leaf pigment content and spectral reflectance across a wide range of species, leaf structures and developmental stages. Remote Sens. Environ. 2002, 81, 337–354. [Google Scholar] [CrossRef]
- Maxwell, K.; Johnson, G.N.; Maxwell, K.; Johnson, G.N. Chlorophyll fluorescence—A practical guide. J. Exp. Bot. 2000, 51, 659–668. [Google Scholar] [CrossRef]
- Vasseur, F.; Pantin, F.; Vile, D. Changes in light intensity reveal a major role for carbon balance in Arabidopsis responses to high temperature. Plant Cell Environ. 2011, 34, 1563–1576. [Google Scholar] [CrossRef]
- Ren, X.X.; Xue, J.Q.; Wang, S.L.; Xue, Y.Q.; Zhang, P.; Jiang, H.D.; Zhang, X.X. Proteomic analysis of tree peony (Paeonia ostii ‘Feng Dan’) seed germination affected by low temperature. J. Plant Physiol. 2018, 224, 56–67. [Google Scholar] [CrossRef]
- Song, J.; Li, Y.; Hu, J.; Lee, J.; Jeong, B.R. Pre-and/or postharvest silicon application prolongs the vase life and enhances the quality of cut peony (Paeonia lactiflora Pall.) flowers. Plants 2021, 10, 1742. [Google Scholar] [CrossRef] [PubMed]
- Muneer, S.; Soundararajan, P.; Jeong, B.R. Proteomic and antioxidant analysis elucidates the underlying mechanism of tolerance to hyperhydricity stress in in vitro shoot cultures of Dianthus caryophyllus. J. Plant Growth Regul. 2016, 35, 667–679. [Google Scholar] [CrossRef]
- Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
- Manivannan, A.; Soundararajan, P.; Arum, L.S.; Ko, C.H.; Muneer, S.; Jeong, B.R. Silicon-mediated enhancement of physiological and biochemical characteristics of Zinnia elegans ‘Dreamland Yellow’ grown under salinity stress. Hortic. Environ. Biotechnol. 2015, 56, 721–731. [Google Scholar] [CrossRef]
- Feng, L.; Raza, M.A.; Li, Z.; Chen, Y.; Khalid, M.H.B.; Du, J.; Liu, W.; Wu, X.; Song, C.; Yu, L. The influence of light intensity and leaf movement on photosynthesis characteristics and carbon balance of soybean. Front. Plant Sci. 2019, 9, 1952. [Google Scholar] [CrossRef] [PubMed]
- Yang, L.T.; Chen, L.S.; Peng, H.Y.; Guo, P.; Wang, P.; Ma, C.L. Organic acid metabolism in Citrus grandis leaves and roots is differently affected by nitric oxide and aluminum interactions. Sci. Hortic. 2012, 133, 40–46. [Google Scholar] [CrossRef]
- Doehlert, D.C.; Kuo, T.M.; Felker, F.C. Enzymes of sucrose and hexose metabolism in developing kernels of two inbreds of maize. Plant Physiol. 1988, 86, 1013–1019. [Google Scholar] [CrossRef] [Green Version]
- Liang, J.S.; Cao, X.; Xu, S.; Zhu, Q.; Song, P. Studies on the relationship between the grain sink strength and its starch accumulation in rice (O. Sativa). Acta Agron. Sin. 1994, 20, 685–691. [Google Scholar]
Cultivar (A) | Lighting Direction (B) | Shoot | Leaf | Flower | Root | Shoot/Root (FW) | Shoot/Root (DW) | |||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Length of Internode (mm) | Fresh Weight (g) | Dry Weight (g) | Number | Length (cm) | Width (cm) | DVB 1 (Day) | Number | Length (cm) | Fresh Weight (g) | Dry Weight (g) | ||||
‘Gaya Glory’ | Top | 6.1 a 2 | 32.6 c | 2.1 c | 77.3 b | 3.5 d | 2.4 d | 23.3 a | 47.0 b | 31.8 c | 2.4 c | 0.24 c | 13.6 a | 8.8 a |
Side | 5.7 c | 40.0 a | 3.0 a | 95.7 a | 3.7 c | 2.6 c | 23.3 a | 61.7 a | 38.8 a | 3.6 a | 0.34 a | 11.1 b | 8.5 b | |
Bottom | 4.0 e | 6.7 e | 0.5 e | 43.0 d | 3.8 b | 1.9 e | - | 0.0 e | 11.8 d | 0.8 e | 0.08 e | 8.4 d | 6.3 e | |
‘Pearl Egg’ | Top | 5.9 b | 24.8 d | 2.0 d | 66.3 c | 3.2 e | 3.0 b | 20.7 b | 20.7 d | 32.2 c | 2.1 d | 0.23 d | 11.8 b | 8.7 a |
Side | 5.3 d | 34.4 b | 2.9 b | 77.7 b | 3.7 c | 3.2 a | 20.7 b | 38.7 c | 37.0 b | 3.5 b | 0.32 b | 9.8 c | 8.2 c | |
Bottom | 3.1 f | 4.1 f | 0.5 e | 23.3 e | 3.9 a | 1.8 f | - | 0.0 e | 10.7 e | 0.6 f | 0.07 e | 6.8 e | 7.1 d | |
F-test | A | *** | *** | *** | *** | *** | *** | *** | *** | *** | *** | *** | ** | *** |
B | *** | *** | *** | *** | *** | *** | NS | *** | *** | *** | *** | *** | *** | |
A x B | *** | *** | ** | * | *** | *** | NS | *** | *** | *** | *** | *** | *** |
Cultivar (A) | Lighting Direction (B) | Pn 1 (μmol CO2 m−2·s−1) | Tr 2 (mmol H2O m−2·s−1) | Gs 3 (mol H2O m−2·s−1) | Ci 4 (μmol CO2 mol−1) |
---|---|---|---|---|---|
‘Gaya Glory’ | Top | 15.72 b 5 | 1.77 b | 0.72 a | 467.41 b |
Side | 16.61 a | 1.86 a | 0.74 a | 479.47 a | |
Bottom | 12.25 d | 1.27 d | 0.35 c | 393.67 c | |
‘Pearl Egg’ | Top | 14.22 c | 1.53 c | 0.66 b | 463.80 b |
Side | 14.51 c | 1.87 a | 0.66 b | 467.64 b | |
Bottom | 11.40 e | 1.11 e | 0.32 c | 350.42 d | |
F-test | A | *** | ** | *** | *** |
B | *** | *** | *** | *** | |
A × B | ** | NS | NS | NS |
Cultivar (A) | Lighting Direction (B) | Fv/Fm 1 | Fv’/Fm’ 2 | NPQ 3 | qP4 |
---|---|---|---|---|---|
‘Gaya Glory’ | Top | 0.97 a 5 | 0.71 a | 2.84 a | 0.58 a |
Side | 0.99 a | 0.72 a | 2.87 a | 0.59 a | |
Bottom | 0.80 d | 0.52 c | 2.37 c | 0.44 c | |
‘Pearl Egg’ | Top | 0.91 b | 0.67 b | 2.78 b | 0.53 b |
Side | 0.92 b | 0.68 b | 2.82 ab | 0.57 a | |
Bottom | 0.75 c | 0.43 d | 1.93 d | 0.36 c | |
F-test | A | *** | *** | NS | ** |
B | ** | ** | ** | ** | |
A × B | *** | *** | ** | NS |
Name | Gene ID | GO/Pfam ID | Primer Sequence (5’ to 3’) |
---|---|---|---|
ACTIN (Cse_sc001321.1_g010.1) | 3641_0:00292c | GO:0005524 | F: AACTGGGACGATATGGAGAAGA |
R: CGCAAGATAGCATGTGGAAGTG | |||
CseSS-1 (Cse_sc003876.1_g050.1) | 4232_0:003231 | GO:0009011 | F: GACCCCGGTGGAAATAGTGA |
R: TTGCAAGGCCTCTTTCTCAGT | |||
CseSS-7 (Cse_sc012707.1_g010.1) | 4232_0:0027ec | GO:0009507 | F: GGCCTTGGAGCAAAACTGGT |
R: AGTCTATTCCAGCAACAGGTCC | |||
CseSS-9 (Cse_sc009929.1_g030.1) | 4232_0:0076eb | GO:0004373 | F: TCCGTACTTCAGACGCCAATC |
R: GTTTCGACCCAGTTCCCATC | |||
CseSS-6 (Cse_sc029166.1_g010.1) | 4232_0:000861 | GO:0009059 | F: CCAAACCAAGCAGTCCAAGAA |
R: TACGCAACTCTTCTTCCATTTGT | |||
CseSSS-4 (Cse_sc005354.1_g010.1) | 4232_0:003c28 | GO:0016157 | F: TGAGAATATGTGCTGGCGGA |
R: TCGCACCAACCCATGGATAC | |||
CseSSS-7 (Cse_sc001317.1_g020.1) | 4232_0:004d5f | PF00534 | F: ACGTTGCATTAGGGGTACGA |
R: GCAGCGGTTTTGCATTCTCT | |||
CseSSS-8 (Cse_sc008612.1_g030.1) | 4232_0:002593 | GO:0016157 | F: TGCCCCCGTTTGTAGCTTTA |
R: TCCAGGAGTGGCTCCAAACA | |||
CseSSS-1 (Cse_sc001888.1_g140.1) | 4232_0:009180 | GO:0016157 | F: TATTCGTCTTCGTCCCGGTG |
R: TGGTGAGTACGGAGGAAATCG | |||
CsePsaA-7 (Cse_sc003237.1_g010.1) | 4232_0:00aa9f | GO:0016021 | F: ACTGGTAGTGGTGGGAAAGC |
R: CTTAGAGCCTGAGCATCTGAGT | |||
CsePsaA-6 (Cse_sc022053.1_g010.1) | 4236_0:0065f0 | PF14870 | F: GGAAAGCCAACCAAATGATGCT |
R: TCCTCGGTTATAAGCAGCCAC | |||
CseFPF1 (Cse_sc015873.1_g020.1) | 4236_0:004cfa | GO:0009909 | F: ATGTCTGGTGTTTGGGTGTTTA |
R: CTACATATCTTACTTCAA | |||
CsePEF3 (Cse_sc001254.1_g140.1) | 4232_0:0032f4 | GO:2000028 | F: ATGTCGTTTAACGTACCATCACAA |
R: ATCACCACGTTTCAGCTGTCC | |||
CsePEF4 (Cse_sc001459.1_g030.1) | 4232_0:00932a | GO:0042753 | F: GATGGCAAGGTGATGCAAACA |
R: TCGAAAAATTCGACGAAAGATCC | |||
CseFCA (Cse_sc021505.1_g020.1) | 4232_0:0028ef | PF00076 | F: GGTCATACGACAACTACGGC |
R:AGTTCTTGAAAAGAATAACCTCGG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, J.; Jeong, B.R. Side Lighting Enhances Morphophysiology by Inducing More Branching and Flowering in Chrysanthemum Grown in Controlled Environment. Int. J. Mol. Sci. 2021, 22, 12019. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms222112019
Yang J, Jeong BR. Side Lighting Enhances Morphophysiology by Inducing More Branching and Flowering in Chrysanthemum Grown in Controlled Environment. International Journal of Molecular Sciences. 2021; 22(21):12019. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms222112019
Chicago/Turabian StyleYang, Jingli, and Byoung Ryong Jeong. 2021. "Side Lighting Enhances Morphophysiology by Inducing More Branching and Flowering in Chrysanthemum Grown in Controlled Environment" International Journal of Molecular Sciences 22, no. 21: 12019. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms222112019